Canis_familiaris Locus Q9XST7_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris Q9XST7_CANFA
Canis_familiaris
Q9XST7_CANFA
15
SNORD73, SNORD73
3130..3202, 4398..4467
6092
ATGGTGGGAGAGTAGAGGGTAGGAGACCTCGCATCCCTTCGTCTCCTTGGGCTGGGTGG
GACCCTTGGAGCGTGTAGGAGGACTGAAAGGGATCACAGGATTTAAAGGTCTGTGGGGCC
TTGAGTGGGACCCGGTTTCTGGCTGGTGCGGGGCTCTCGCCAGGGGGGCAGTTTAGACCA
GAACTCCAGGGCCGTGACTGGGTACCACGCGGGGATGGGCCAGGGTATGGCCCTTTCCAG
GGGCTGCACCACTGGGCGTTTATAAGCCACATCTGATCAGGGTGTGTTCTGCTAAAGCCC
TACAATCAAAAAATTTTTTTTTGCATCACCTGCAAAAAATGAAAAATTTGGCGATTTCCA
GCTTTTCTTGAAAAATTAAAATATCTGGGACAGTGGACTCCTACTCCCTCGAGGAAACCA
TCACATTAACTTGCATCAACGTATAAGCGTCTGGAAAAGCGCGCGCGTGACCGGACGCTC
ACAAGGGCACGTTCCCCACCAGCCAGCGGTCCTGTCAACGTGCACACACTAGCATCTCTA
AAGTCATACTTACTTCATCCTACTAGTCACCTGATGAGGCAGGTATAGATTATATTACAA
TCTCCTTTTTAAATACGAGGAAACTGAAGCACAGACAAGTCACGGGGCTAAATACTGGGG
CTGGCATTTGAAACTGGACCTGCTGCCCGACTCCAAACCCCACACTCTCCACAAGAAACA
GGTGAATCGCTAAGTTCGCTGCCCATAACGCGGAGGGGCGGCCGCCCGCCACGGAAACCT
CCTTCCGGGCGTCAGAGCCGCGGAAACCAACGCACCCGGAGCCCGCGGCAGAGGCCGCGC
AGCCCCGCCCCGCCAGGCCCCCGGACGGCCGTCCGCGCCGCGCGGTCTCCACACACGTGA
GGGCGCTGTGGCAGCTACCGTCGCAGTTCCTGTTTCTGTTGTCGCGATATTCTTGACGCC
GGAAAAACGCAAGATCGAAGGTCACGTAGATGGCACGCCTCTCCCAGGACGCCTAAGTTC
TCGCGTGAGTTGCACTTCCGCCCTTTTGGCTCCCGCAGCAGCGCCATGGCGGTCGGCAAG
AACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTGGCTCCT
CTCCTGGCGCCCAGCCTTCTGCGGCTACGCTGGGCTCGGCGGGCGGGTTCTAGACGGCAG
CGGGGGCCGGATGGCGAGGATGCCCGATGGATTGTGAGGGCCGTGCAGGGTTGGCAAGCC
CGGCACGGCGCCCTGACGGGACGGTGCTGCGCCGGCGCGGGCCGCCTTCTGGTCTTTGGC
CCTCTGGGTCTTGTGCGCGTCTCTTCTGAGCTAAACTCGACGCTGCACGGGGACGGCGCG
CTCCGTATTGTGGGCTCCCGGGCTTTGCAGACGTCACGAGCAACCGTGGTACTGCTCCCG
AGGCTGGGGTTGAGGAGGTCCCTCTCGTCCACCCAGGACCTCGCACCCCATCGTCTCCCT
GGGCTGGGTGGGACCCTTGGAGATCCTAATGAGCTCGGGTGGGTCCCTGAAGAGCCTGGG
TTACCAGTACGCGTTTGCTGCCCCAGTGAAGTTCAAGAGACGTGCGTGTCCTTCGGAGGC
CGTGCTGCTTGTGTAGTCCCAGAGCCGACGCGGCGCGGGGTTGTGTGCGTTCGGAGCGTC
CGGGGGGGACAGTGAAGCGGGCATCGTGGGCAAGAGCTGGGTTCGCTCACGCGTCCCTCA
CGTCACTGGGAGGAGCAGGTTCTTCCCAGGGTCCGGTTGCTAACGTGCCAGTTAGCTCTT
CAAAATCATTAGAATGAGGAAAGTTTTACTTTGTTTTTTAATTTTTTTTTAGAATGAGGA
AAGTTTTAAAAGTTCAGTAAGAATAACGTGATCTACGATAAAACTCACATAAGTGTTTTG
TGAATACAGGGTTGATCCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCGCCAGCTAT
GTTCAATATAAGAAATATTGGAAAAACACTAGTCACAAGAACTCAAGGAACCAGTGAGTA
TTTTATTCTTGTTTTGTATTTTTCATAAATCAAGGTCTACTGGTGGTTCTGTGGTGGAAG
AATTAAGAAAATACCTCTTGGTTGCAGCTTTGGCTACTGTGATGCTTAATGTCTGGTAAA
AACACTTGTAGAGGAAAGGTGGGGCCTTAGATGTACTAAGAAAATGTGCAAAGGCTCTTA
GTTTCTAGTGAGCACTGTCCGTCAGTGTCCAGGTGGATTTGATTAACAAAAGTTAGGGTC
TTGATAACTTACCATTAACTTTCTAAGTTCAACTTTAGCATAAATGTTCTTTGTTGGCTT
GGCTTTGTGTGGTTCTTACTGTTAATAAGACAATTCTTGTTTTATAGAAATTGCGTCTGA
TGGTCTCAAGGGTCGGGTTTTTGAAGTTAGCCTTGCTGATCTGCAGAATGATGAAGTTGC
ATTTAGGAAATTCAAGCTAATCACTGAGGATGTGCAGGGCAAAAACTGCCTGACTAATTT
TCATGGCATGGATCTTACCCGTGACAAAATGTGCTCCATGGTCAAAAAATGGCAGGTGAG
AACAAAAGTTCCTTGGGATGGTGCTTTGGCGTGAGTGGCCAGGGATGGCCTGTTACGACA
AGAAAGGAGCATGTGTGTTTGAAGCGCATTGCATTTTAAATCCTTGATGTTTGCTTTTAC
TGAGTGCTGACTCTGGGATTGGCACTCTTGAAATTGAGTAAAGGAGTAAGCAAGCCATGA
TCCTCCCATTTAAGTGGAGTTTAAGACTTGTTTATTTACTTGTCTATTTTCTTGTAAGTT
TTAAAGTTGGGTTTTCAGAGTTAGAGTGGCAGAGCTCCTGGTGTGAGGTTGGAATCTTGG
CTCCATTTCCCAATTGTGTTCTCTTTGGCAAGTAACTTACAGCTTGCTAATAAGCCCCTT
GATGCCTTTATCTAAAATGGTGGGTATCACCTCTTAGAGTTATGAAGATGAAATAAGAGC
CAGGTAAACATGCTTAAGTAAAGCTTGACACAAAGCCTTTAGAAAGCATTGTCCTAGGAA
ATAATGACATTGGTTCAGATGTGTCTGGCTAAACCATTCGGTTTGGGGATGGGGATGTCA
TGTATATGGGAATGAGTGATGACAAAATGTTTCGGTCCCAAATGATACATATTGATTATA
CCGCTACATTTACTTCTGACATTCCCTAAGATTTTTATGGTTGAATTTCTGGAAATATTT
TAAGGTCCTTTTGCTGTAAGCGTACTACTCATTTTTTAAACTGAAGTATACAATTTTCAA
AATACAGAGGTATTTCAGTTTTTGTTGCTACCTAAGAGTAGTAATTTTTTGACTTTAGGC
AATAATATAAGTAGTTGCGGATTTTTTATTACATTTTAGCTGTGAAAATGATTATTTACT
CATCATCAGGCTTTAGTTTGGAGCATGAAGGACATTTAAAAATAGTGCATTTAGTGTTAG
AGCGATATTTCACCTATTCAGACATTTTTTAAAAAGGAGTAAGTGATGTAGAGTCTCTTA
ACCGTGTTTCTCACATAGAGTCATACAGTTGATGGGTGGGAAGGATAGGCTATTAAAGGC
TGGCGTGTAAAATCTGGGGCTGGGTGCTGTTGAGATGGGGATAGAAGTATTACCTAGAGA
AGAGTTGAAGGGACTGTATTTGATTAGATATGAAAGATAGTAAGATTTGGAGTAATTGTT
GCTAAGTTCACTTCAAGGAGGTGCTGTGAATTAGGCATGTAGTTTATATTATACTTTATA
TTGTATGATGAGTACTTTTTCTAGCTTTTTTTGTATTAGAATTCGAGGGCTATAAATTGA
TAACATTAAAACCTGGTATATCTGACAATATCTTTTTTTCCCACTAGACCATGATTGAAG
CTCATGTTGATGTAAAGACTACCGATGGTTATTTGCTTCGTCTATTTTGTGTTGGTTTTA
CTAAAAAACGCAATAATCAGATTCGGAAGACCTCTTACGCTCAGCACCAACAGGTCCGCC
AAATTCGGAAAAAGATGATGGAAATCATGACCCGAGAGGTGCAAACAAATGACTTGAAAG
AAGTGGTCAATAAACTGTAAGTGTTTCTTTTCCTCCTACCACATAACTCTGAATCTCTGA
TTATCCCTGAGCTGAAGGAAAGCGTATGAAACAAGGTGGAAGTCCGACCTGTGTTTAAAT
CTTGTCTGTGAGACTGTTAGGTTTATCTCTTGAAATGAAAGCATGTTAAGTGCTCAGTAA
ATGGGATTTGGTTTCTTTATTTGATTGAAGCAGTCTGAAGGCAGACCGCTTGTGAGACTT
GAAGCATAGGAAATGATTTTGTCTTAATTAGAAAATATACTGAATAGGCAAAACTTGCCA
CCATGAATAATGTATGGGAATAGATGATGACAAAATGTTTCGGTCCCAGATGACAACCAC
TGATAAAACTTAACATTTTTCTGATGTTCCCATGCAGTTGGCTAAGAGGGTGGAATAGAA
AAGGCAGAAAGCTCAAATGCTTACTCTCCTACTAACTAGCTGTGTAATTCAGATCATTTA
ACCTCCAGCTGTAAAAGTGCAATAAAAGATTGTCTAATGTGAAGATTTGAGTGGATTAAA
TAAGGCAGGTATTGATATATTTATAAGTTTATCCTTTTCTGTCATTACTGGTTTACAGGA
TTCCAGACAGCATCGGAAAAGATATAGAAAAAGCTTGTCAGTCTATTTATCCACTCCATG
ATGTTTTTGTTAGAAAAGTAAAAATGCTGAAGAAGCCCAAGTTTGAATGTAAGTGAAAAA
TCAGGGGCGGGGTGGGGGGGGTGGGCAGAATGTGGCCAGATACATTTGAGGGTTTTTTTT
TCTTTTTGGGGGGAGGGGGGCAGATGATGGCTTTTCTGTCACTTTATGGTATTGAAGGGC
ATTGTTTTAAGACAGCGGTGTGCTATAACTTTTTTTTTTTTTTTCTTTTAGTGGGAAAAC
TCATGGAGCTTCATGGTGAAGGTAGTAGTTCTGGAAAAGCTACGGGGGATGAGACCGGTG
CTAAAGTTGAACGAGCTGATGGATATGAACCACCAGTCCAAGAATCTGTTTAAAATTCAG
ACATTTAATGGTGACCAATAAAAACATATTTGTGATGTTTAATTTCTTATCATTCTTTTT
AAATAATCAGGCTCGGTGAAGCAGATGTTTTGAACTGACCGTGTGAACTTTTCAGAACTA
TTGTATGGATCTTATCCATTGCTCTTGGCTACTAAATAGCTGCAAAAGGGTAGTGATCTA
TTTTAAGCTGTAGTGATCTGGATGGAAGTGTTCTAGATGGTTAATAAAAGGAAACTTTTT
TAACGTGTATGTTTTCAGCTGGTTCTTAAACCATCTGGAAGGCTTGTTAAAATAGAACAA
GTAGATCTATAACCCCCCCCCCCCTTTGGGCAATAAGCGGTGTTTTTTGTTTTGTTTTGT
TTTTTTATAAGCGGTGTTTTTTAAAGATTTTATTTATTTATTCATGAAAGAGGCAGAGGG
AGAAGCAGGTTCCCGGCAGGGAGCCTGATGTGGGAGTCAATCCCCACGACCCGAGGATCA
CCACCTGAGCCAAAGGCAGACACAACCACTGAGGCACCCAGGCGTCCTCATTGAGATCAC
TTTGGAGCAAGCCGCTGTTATTACCACCTGGACTGTTAGCTGCCTACCTGGTTCCCTTAG
GTACCACCTTAAGGTAATAAGAGGTCAGAAGCAAGATTACATGGGCCTTGACTGAGTGGC
CCAGGTGATCTTGCCTCTGACCTATTACTGTACCCCTAATGTTTCTAGCCAGGTTGTCCT
TACTATTCTGGGTGGGCTAGGTATGTTCTAAGGCTTGTTTTCTCTGCACATGGAATACTG
TTCCCTTAAATGCCACTGTGCTTGTTCCTGTATCGAAGTCTCAGTAGATCCTAATGATGG
GCTTGGCCTATTAAAAATTGTACCCTGTCCTCCAGCATTCCTAATTCCCATTATTTTTCT
ATAGTTTTCACTTGTATTTACTAGAATACTCCATGAAGTGTGGGGTACCTTCCACTCAGG
TCATGATCCTGGAGTCCCCTGGCATTGGGCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1126, 1929..2032, 2387..2574, 3887..4095, 4678..4787, 4971..5092
1065..1126, 1929..2032, 2387..2574, 3887..4095, 4678..4787, 4971..5089
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved