Canis_familiaris Locus ENSCAFG00000006545
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000006545
Canis_familiaris
ENSCAFG00000006545
15
SNORA53
5811..6057
8477
ggcacctgggtggcttggggattgagcttctgcttttgacttcagccttgatctggcag
gtcctgggatggagtcctgtgctgggctccgcatggggagcctgcttctccctctgccta
tgtctgtgcttctctctgtctctcatgaatgagtaaaatcttaaaaaaaagaaaaagaag
aaaagaaacagattcatagaaattgagtgaatttccaaggttactttatcaacagccagg
acagggtcagagccggaattctaacaggggtttgactcctactaaactctccccagtgaa
actaggccctttttggtgttgaactgaatctactgaagattttctaaatttattgaacac
acaaaatctgctgccactttcactctagttcaaccatgtacccccaggtcgtgtaaaaaa
tgcatttacttaatgttttaataggtcataaaaagttgtgatgaaccccgaagctgtctt
gtctaaagagttcttgctgcacattttcttttaaaatactttccaatagtctaatggaaa
atgcagacatgtctacgtggaatgtcaatggaacttactgtcaagcgctatacaaaatac
tgcagtaacattctaactgcaacaccgaaataaagtatcatcacacgtttgggtgttttt
ttctttttttccctctttttatttaagtgagtaccactgtgactaacatcaacgtaaaac
aatcgaaccctgaggtcaagaaaagacgcctgaaggtgaaaggaccaaaagaggaggtca
cgagcacgacgccacagcgctcaaaacctcggccctggaatgcgcgcctgcgcagaacga
atcctcctgcgcagaagccgggcaggaagggctggggcgggcgggggcggggatagggtt
gctaggagaacgcgatgacgccatggccttggcgctcgtctccaccaatgggtgccgcct
gctgcagtgacacgtcgtgtgcgtcacgctgacggcgcgcgAAGGGCACAGATCTAAGGG
TCGGGAGGACGTTCGGCCTCTGTGAGCCGCAGCCTGTTCCAGGGAGCGGTTGTGTGTTCG
CCATCTTAGCAAgtgagtgtgccgggccttgtccccggtgagtgcgggcgacggagcccg
tctgaggggctgcttcggctctaggttctaggtggttcttctccttggaggaggccgcca
tgacctcctcaagggcgcggaggcggcaagatggaaggccggcgtcgaggtcctagggtg
ccggtgacttgggcggcctgaggagcggccctttgctttccctctgaccgctgctctctc
tccctttaggaagATGTTCTCGTCCGTGGCGCATCTGGCGCGGGCGAACCCCTTCAACGC
GCCGCACCTGCTGCTGGTTCAGGATGGCTTGACGGGCCCCCGCAGCAACCCCGCGGGGCC
CCCGGGCCCGCCCCGCCGTTCCCGCAATCTGGCGGCAGCCGCTGTGGAAGgtgagcttag
agccccccgcatgcggtcgttagctcccctcgtggtccactcggcctttgtggcccggag
gacggagaaggacgcagctggccttctgcactacgggacggtgcctggttgcctgcctta
ggtagtctgccctcctcccctaggcggtgtggcggatccttggccctccctcaagggcgt
ggaagggcccaggcacagttcccctctgtgacctccactttcccgggagagtagaattct
agaggccgtgactcgctccttatcttcgccctgagcccgatggtcaggagaggctccttc
ctagcccttggccacctgcaattctttattataactgtaatagctgttgcttgatttggc
tttcattttctttttaaaaatactccttccttccttaagtattcttgaagtctaatatct
gttgataccaagtatatgaaaaactgggtctcttgttttaatgtaattggcaaaggaggg
aacagaagcctcagataggctataaaaaaacagatgataactggtagggaggggtccctt
tagtctctcaggaatctttttggtcagactgaacttcaatttaattgtatgctttaaatc
ccagtggagtgtatgtacggagaaacccgaaaacccctagatcatagctctgtaaatgtt
ccatctacgttgtgtgcccgtaaaatctaaagtttaaaatcgtttgtgtttctgttacgt
ctttagtgtgggtaaaaaaaaaatctttacaccgttgtttagtaaatgtatttgatcttt
ggaatttatgtttatctcatcttatgcttatgtgaatccgaaagtggggagagtattgat
tggtggctgggggacacttagcagattgcaagcttttacttgtctagtgctttcccgagt
ttgatatgtattctgaagtgtgtttttattagcagttaatgattggaagtttgatttcaa
ttggaagagccattaatgtcatcagagacattttagtatagcagagtaaagccaatgtct
cccagaaccttcataagctaaatgattctctgattttggcagtaaatgtcttattaacat
gaggtggaaaatcatctttcaccttaattgtaagcagtggccaaagctctattcagttgt
gacagcactgttgcacagggaatccgttctctttcattcccgtggccttagttatctctg
aagaagaaatacttacttgatttttcttttcaatcaaacagAGCAGTATAGCTGTGACTA
TGGATCTGGCAGATTCTTTATCCTTTGTGGACTTGGAGGAATTATTAGCTGTGGCACAAC
ACATACAGCATTGGTTCCTCTAGATCTGGTTAAATGCAGGATGCAGgtttgttttgcatg
ttggattaaaagcatatggttgaagcatggcttctaagttgtacaacatagactctacta
acaagccgtgtggaaacctaattgtccaagaggtaagttgataactagtaacatgagttt
tatattaaaatgcatggtgtgtcttgtcttactacagagtacagttgcgaatatggctcc
atgaagttttatgcactgtgtggctttggtggggtcttaagttgtggtctgacacacact
gctgtcgttcctctggatttagtgaaatgccgtatgcaggtttgtattgagatggcaaca
tcgaatgtatcgttcatgtgtgacttaattccaaataattttaaaggccctgacaaatga
gaaaatatgaagacatcacaactgctagaaacttccataggaaaccaaacccagattttc
ttaactcctgatctttattttaattagtgttttatttattttattttcaagattttattt
atttatacatgagagacacagagaggtagagacacaggcagagggagaagcaggctccat
gcagggagcccgacatgggactcgatcccaggcctccaggatcacaccctgggccaaaga
cggcgctaaactgctgagctaccccggctgccctaattagtgtttttttttttaatttat
ttttaagatttttatttatttattattgagagagagagagagattgaggcagacacacag
gcagagagaggagcaggctccctgcatggagcctgacatgggactagatccccagtctcc
aggattacaccttggctgaaggcaggtgctaaaccactgagccacccgggctccccccta
attagtgttttaaatggaagaaatgcctcttttgaaattagattgtaggcagatttttgg
acctcaaaccctggctataagtggtattttgctgctatgcttaattctgtctagagtttc
ttttcaaggcctgctggtcctttatgctcccaaatagtcattttatgagcagttacatat
cagagtaggtaatcttaatttttgaactaacttctctttactgataagatcagggcaaaa
cattatgtagattaggaaaaatacttagtattaaaattttgcagacatacataccttctt
gtatatttatttacataaaagtcttgtacaattagaatttcgtaattaggattattgaaa
caaaaataatcaaacgtcaaaaatttatttgtcccaaacaggattagaagtctacttacc
taaaaagagaggaaggtgaaataaaggaaggtgaattgttagcagggagaggaaggtgac
gtataccagcccttttagtactggcagatacagtgaaataagattttttttctttttcca
ttagttaatagaatggatgtgaaataaaccttcgctaaaatgtatgtatgtatcttcaag
taagtttaagtcaaaagacagattctcattatgttgatctacccttttaacttgcattta
atttgccttaaatttataaaacttgatagtataaactccttgatggactagcgtataatc
atggatatagacttatctgttacttagggagtagcttcaaaactaattttttaaaagtgt
tagagttggatggtgaaaaatttgattctgttttatcatatatttttctaggaattttac
tcttaaacgaattctccaagacttaagtatgaaagaaagctagaccttaatgtataaagt
tacatttacaaagatgattatagatattaagttggtatgcagtgaatcctgtgtttacct
acctcttgtgtagttactgaggtttatttttattttaggaaccaaaaggaaaaacagaat
agtgaaattcagtgtatatgagaaccgatagctctctggtgcatttaattaatttctttc
ttcttgttttaaataaagGTGGACCCCCAAAAGTACAAGGGCATATTTAATGGATTCTCA
GTTACACTTAAAGAGGATGGTGTTCGTGGTTTGGCTAAAGGATGGGCTCCGACTTTCATT
GGCTATTCTATGCAAGGGCTCTGCAAGTTTGGCTTTTATGAAGTTTTCAAAGTCTTGTAT
AGCAACATGCTTGGAGAGgtatgtaatttaattttgaaatttaaagtactaagctttaac
ttaaaatttaagaccaaaaaggattttttttttttaagtctttattattctgtgttgctt
tccaagtagttagttggattttgagttttttaaagagaaggattttgagattcccaggta
tatttggcacctagctattcaaaacataattcacattgtactgtggttgataaggttatg
ggagaggacatacattcagtcacaccatgtgtattaataagatgtttgaagtacaactgt
tttctagaactgtcccttaatagaaaatagccaatgccatggcaatgtatgttcttgctt
gtgtttttcaattagGAGAATGCCTATCTCTGGCGCACATCACTATATTTGGCTGCCTCT
GCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTAGA
ATTCAAACCCAGCCAGGTTATGCCAACACCTTGAGGGATGCAGCTCCCAAAATGTATAAG
GAAGAAGGCTTAAAAGCgtaagtaaacctatgtctagaattctagtatagaaatactcat
ttaaaggaattttatttgttagcattaaacctaccagacttttatttttaaagttactat
gttcatgtctttactttttatgtagaacataaagtctaagggcaagaataaattgatacg
tggcttgagccctagattaaagattttttttttctaaagattgtgtttgtcaatctgcag
atgacttgatatttgacattagttgttagcttttgggaagggcttgttagagttcttgtc
ttctgtgtttacagctaagaatttgcatataatctggtcactacatgcttccttagatcc
acctttgtggatgctagtcttgaactgagttctacttgtaaacatttggtttcttgtagt
tccagtcaggaaacatccagcaacttttttggttgtatagtcaaaggtgcttgagtcatt
ggcatgtgagataaatatacctgcatgttagtcttaggttctgatagaaatgacacgcaa
ttgtgctgccattttttgctgtcaggactcgactggtgtgcggacacttttgttaatgat
gaaaatctgctaggtgaataaataaaactgagtgaaataagtctcttgattttctagATT
CTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAATTTGC
CTGCTTTGAACGTACTGTTGAAGCATTATATAAGTTTGTGGTTCCCAAGCCCCGAAGTGA
ATGTTCAAAGGCAGAGCAACTGGTTGTAACATTTGTAGCAGGTTATATAGgtatgagtta
ccgcatgtttgtgaaattaaggacaaaataatcatttccaatattggcttctttcttttt
tttttaaagattttatttatttattcacgagagacacagagaaagaggcagagacatagg
cagagggagaagcaagctctacacagggagcccgatgtgctatatcattgttttttttgg
tctagtttttcaagaatacatttttaacacaaaggaaaatgttgattaaaatgggaatat
aggggatccctgggtggctcagaggtttggcgcctgccttcggcccacatcgtgtgtgat
cgagtgtgatcgagtcccacatcttgcttcctgcatggagcctgcttctccctctgcctg
tgtgtgtgtctgtctgtctctctctgtctcttgtgaataaataaaatctttaaaaaagaa
aaatgcaaatataaaaatttgaaggattgttctgttttccctaggggaggctgctatata
actttttaaagaactaaatattaggaaaaggttgatgcttatgatgtgaattttttattg
atcccattatggattatttatcttgacttttttcagCTGGAGTCTTCTGTGCAATTGTTT
CTCATCCTGCTGATTCTGTGGTATCTGTGTTGAATAAAGAGAAAGGTAGCAGTGCTTCTC
AAGTCCTTCAGAGACTCGGATTTAAAGgtaggattcttttttctctcccctctaaacaaa
gactaacacttgggtatgtttcatttttcattcatattctatatttcaactagGTGTATG
GAAGGGACTCTTTGCTCGTATCATCATGATTGGCACTCTGACTGCACTACAGTGGTTCAT
CTATGACTCTGTGAAGGTCTACTTCAGGCTCCCTCGCCCACCTCCACCTGAAATGCCAGA
GTCTCTGAAGAAGAAGCTTGGGTTAACTCAGTAGATTGATCAAAGCAAATGTGGACTGAA
TCTGCTTGTTGATCAGTGTTGAGAAAAGTGCAAGAGGAACTTTTATATATTTGACAGTGT
AGGAAATTGTCTATTCCTGGTATAATTACTGTAGTATTCTTGCCTAAGGCAAGAGTTTCA
AACCCACTGGTGAAATAAACCCAACTATTAATGATTTTgtctgactcgatgcttattttt
aaaactttaaccctaaaatggaaggtactaagttaaaacttcagggaaaaaatgcaaact
aatccgtatcagttaattgaactgtggataaatatttgtggttatattttgacaagtaaa
tctcagtgtaatcaaatttttgaaacacatactaaaaatgctaatgagtttgctaatcat
ttgtagaagtaagtaatctaggggcacctagccggtgctgttggaggagtgtgccagcca
ggtgcccttgatctcaaggttatatatatattttttacttaaatattttatttatttatt
catgagagagagagaggcagagacacaggcagagggagaagcaggctccatgcagggacc
ccgatgtgggactcgattcgattccaggtctccaggatcaggtcctgggccgaaggcggc
gctaaaccgctaagccacccgggctgcccagggttatatgttctgagccctatgttgggt
atagatattatacttaaaactaaaaaattaagttgaaaaaaggtaatccaaattaggctg
attgtagaatatttcttatatttatttaaagattttgtttttttaagtaatctacactca
atgtgggactcaaatttataaccctgggtcaagagtcacatgttctactgactaagccag
ccaggtgcccctagaatgatagtttttaaaaggaacaaagcacttgatagctgaaaacca
ctttaggtaacagttattttcaaacctatcggactttctaattacaaaaataggtagcat
gaaatcacctaaatagtaagccactgtctaaatttaagaaccagacctatttagttgaag
gctaacttctctatatcctcactcggtcttgtttaagattataaacttatggggcagcct
gggtggctcagcggtttagtgctgccttccgtccagggcctgatcctgggagatccggga
tggaatcccatgtcaggg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1091, 1333..1489, 2741..2865, 4818..4997, 5355..5536, 6177..6349, 6936..7046, 7133..7477
1333..1489, 2741..2865, 4818..4997, 5355..5536, 6177..6349, 6936..7046, 7133..7293
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved