Canis_familiaris Locus ENSCAFG00000004745
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000004745
Canis_familiaris
ENSCAFG00000004745
15
SNORD55, SNORD46, SNORD38, SNORD38
1271..1350, 1826..1929, 2736..2806, 3241..3310
4584
GCTGAGTGGTCGCGACGGGCTCCATATCCCGCAAAGCCTATTTACTTGGTACGTTTTAC
AAGAAAAGTTTGCTTTATGCTCTCTCGCGGGGTTCCATTCATCCGGGTGACCTTAATCAT
CACCGTTTGTACACTACCGATTCCCAAAGTAGCATCTCCTATGCAAGACCTTCTCTAAGG
AAGCCAGACATGCACACCCAGCGGCCTGTCATTCGAAGGGATCGAGTGAGGAATCGGGGA
TCCTTGACACCTCCCTTTCCCTAACCGCCCCCCACCCCATCTATCACCAAAGCCTTCAAA
ACAAAGTCCAAGTCCAGCACTCGTTTCCACCCCTACTGCCTCCCACCCTGGCCCACAGCA
GCCGCGCCCGGCTCCGAAACGAGTCTTTTCAAAATGTAAACAGAGGGCAGCCCGGGTGGC
TCAGTGGTTGAACGTCTGCCTTTGGCCCAGGGCGATCCTGCGGTCCCGGATCGAGTCCTG
CGTCGGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCT
CTGTCTCTCGTGAATAAATAATAAAAAATAAATAAAGGGACAGCCCTGGGTGGCGCAGCG
GTTTAGCGCCGCCTGCAGCCTGGGGCCTGATCCTGGAGACCCAGGATCGAGTCCCACATC
GGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCCTCTC
TGTGTGTCTCTCATGAATAAATAAATAAAATCTTTAAAAAATAAATAAATAAATAAATAA
ATAAATAAATAAATAAATAATAAAATCTTTCAAAAATGTAAATCGAGCCGGTCGCCCCGC
GCTGGCCTCGGGCGCAGCCGCTCGCCAACCCCTCCGGAGCTCCCACGCCCCCCTCGCGGT
CGCAGAAGCGACGTCGCGCTCCGACTCCGGCTCCGGACCGCGGCGCCCGGAAATCACGTA
AGGGGGCGGGGCAGCGTTTTACAAACCGGACCGTGAGGCTTTGCGTTTTCTCTTTCGCAG
CCAGCGCCGAGAGCGATGGGTGAGTGTGACTGCGTCGGGGCCGGGGAAGGGGGTGAAGCT
CCATCCGGCGCCATCCTGCCTCGCAGCCGCGTCGGGAGGGCGGGCGCCTCGGCCCCCGGC
ACCAAGCAGCCACGCGGTGGCTGCTGTGCTCGGTTCTGGCCTCCGAGGCCCGCGCCGGGG
GCTTGCGGGGCTTTGGTGCCGCGGGCGCTGCCAACATGGCTGCCGCGGGAAGGAGCCCGG
GCTGGGCCGCGCGTGGATGATGACACCTTCGTAATGCGGAAAACTCCCGAGTGCGCAGTG
GGGGAGCCAACCTTGGAGAGCTGAGCGTGCGGCGCGCCCGGTGCAGGGGTCTCTGGGGCT
CGCGGGGCGCCGGCTAAAGCTCCCGCCTCCTGCTCCCACACGCAGGCATCTCTCGGGACA
ACTGGCACAAGCGCCGCAAGACCGGGGGCAAGAGGAAGCCCTACCACAAGAAGCGGAAGT
ATGAGCTGGGACGCCCCGCGGCCAACACTAAGGTGCGTGCCGGGCCCTCGCCTCCCGCCC
GCTCCCCCGTCTCCAGCGTGGTCTGGCCTCCGCGCGGTGCTTGAGGCTTCCCGGGGCTCG
TGATTCGTCTGGGGGGCCGGGCGGCCTCCTCACCTTGACGTGTAGTTAAGACCCAAGAGG
TTGCGCGGAGACTCATGCTGGTATTAGGACTTCAAGGGCGCCTGGAGGGCGTGGGCCCCT
TGAGGGATAGTCAGAAACCCGGTATTTTTCTGTTGCATAGAGACTTCATTTTCAGGGTTT
GGAAGCAGGGTTTCTCTCTTGGAGGTAACCGGAGTGATGAGAAAGAATCCTTAGGTGTGG
TTGGGGCCGTCTTGGCCACCTGTGTGCCACATGCCAGTGCTAGGACTTGTCATAGTTACA
CTGACTGTGTTGCCTCCACGGGGTCTAGGGTTCCCCTGCCTCCTCTTGTCTTAATCTCCT
GGATAACCTAGTTCCTGTCTCTGTGTTTTTCCAGATTGGCCCCCGCCGCATACACACAGT
ACGAGTCCGGGGAGGCAATAAGAAGTACCGAGCCTTGAGGCTAGACGTGGGGAACTTCTC
CTGGGGCTCGGAGTGTGAGTGAGGCCCTTCAGGAGTGGGTGGGAACCCAACGCCTAAAAC
TTCTAAGATTCAGTCATTGCTTTTAACAGGAGGTTTATGGCTTCCACCAAGATACTGAAG
TTTGTTTGAAAGCCCTTAAGGTTGTGGTAGCTGGAGAATTCTCTCCTTCCTGTTTTGTCT
CTTAACTCCTGTAGCCTCAGGGATTGGGACTGAACCTAGAGACACTGTGTGTGGTTCCCA
GTCCTCTCTGGAAAGGTGGCTTTGTGGAAGATGAGCTAACACCCCGTGGTAGGGTAAAGG
CTTATTCCCTTGCTTCTCCTTAGGCACTTTGGGGGGAGAGGTGACAAGGCCAGTTGGCTT
CTGGGACTTGATTCTAAATTTCCTCCATGAGCAGGTTGTACACGCAAAACCAGGATTATC
GATGTTGTCTATAATGCATCCAACAATGAACTGGTCCGCACCAAGACCCTGGTGAAGAAC
TGTATCGTGCTCATTGACAGCACACCGTACCGACAGTGGTACGAGTCCCACTACGCACTG
CCCCTGGGACGCAAGAAGGGGGCCAAGCTGGTGCGTGTTCTCTGGGAGCCACCTTCCCTG
TGGGGGTGGGGGAAGGAAGGTCAGCCTCATTCCAGCCTTCTTATGATGAAAACTGTCCAG
TTCTGCTACTGAAAGGAAAGAGATGAAAGCCTTTAGTGCTGAGGAAGGCAGCAGGGATTG
GGATGTATAGGGTATTGAGGATACTTTCCCTGAGCCAGGGCCTTGGGAGCCCCAACTAAC
CTACCTTACCTCCTTTATTCAGACGCCTGAGGAGGAAGAGATTTTAAATAAAAAACGATC
AAAGAAAATCCAGAAGAAGTATGATGAAAGGAAAAAGAATGCCAAAATCAGCAGTCTTCT
GGAGGAGCAGTTCCAACAGGGCAAGCTTCTTGGTGAGACGGCTCTTGCAGTGGGGGGAGG
AATCACAGTACTGTCTGCATTTCGTTCTTGCCTCTTCTTTCAACTGCCAGCTGTGTGGCA
GAGGCTTGCTAGGAGAGTTGAATGATAGCAGCATATAAGCACGACTCAACATGTCATCCC
ATTGGCATGAAGCTGAAATGGGAAATAGTGGGCAGGAGAAGTCTGTGGGCTGAGGGGGCC
GTCTTGGTGATGAAAACTTTGTCCAGTTCTGCTACTGACTTTAAAGTGACGATAAAGTAT
ATCTGAGGAGACACTGGGCTTCAAGCCTGCCCCCGGGAGAACTGAACAAACATGGACTTT
TAAGGAGACTGCTGGTTTGGGCAAGGCCCCATTGTCCTTTTGCTAATGAATGCATACATT
TCTTGGTTTCTTGCAGCATGCATCGCTTCGAGACCAGGCCAGTGCGGCCGGGCAGATGGC
TATGTGCTAGAGGGCAAGGAGCTGGAGTTCTATCTGAGGAAAATCAAAGCCCGGAAAGGC
AAATAAATCTTCTGTCTTCGGTCATGTAATAAAGGTGTTTATTGTTCTGTCCTGTGTTCA
CGTATGAATGTCCAATTGCTCTGCATGCTTTCCTTGTAGGTCAGTCCTAGATGTGGGCTG
TGCCTTTATAAAGCTGGGGGGACATTTCTCACCACAAAAGTTAAGTGTTCAGTGGGAGCA
GGGATGTGACGTTCAGACCAAGCAGAGGCTGTGTGAAGGACATAGCCCAGCACTGGGTCC
CCATATTACTGGGGTTGTGACTGGAACCTGAAGCCATGCTGCCTCTAAAAACGTGACTCT
TTCAAGGGTACCTGGGTGGCTCAATTGGTTAAGCATCTGCATTCGACTAAGGTTATTATC
CCAGGGTCCTGGGATCCAGTCCCAAATTAGTCTCCCTGCTTAAGTGGGGAGTCCACTTGT
TCTGTCTCTCAAGTGAATGAATAAAATCTTTTAAAATAAGTAAAAACTTTGCTCTTAGAG
ATCTGTACCCTTTTCCTATGTGAACCTTTGTTTTTAGGTTTTAGCTTGATGTTTCTAGCG
TCAAGTTCATGATGACCTTGATAATCTTGAAGTTGTGTTCCTTTTCTGCGTTGAGAGCAA
GTTGTACACGTTGGGGACTATCCTGTCAGCTTTTGAATGTCTTTCTAAAGTAATTTTTCT
CTTGAACCCTAATCCCTTCCACCCTCACTCTACTCCTGTGTAAGATAACCAGTGATTTGT
GCATTGCTAAATCCTTAAGGGTCTACTGTGTCTGCAGCTTGGCTACATTGTCTGCTGTCA
GTTTTTTGTTTTTTTAAGATTATTTTTCATGAGAGACAGACAGGAGGAGAAGCAGGCTCC
TGCGGGGAATCCACCTAAGATCCAATCCCAGGACCTGGGATCATGACCTGAGCCAAAGGC
AGATGCTTAACCACGGAGCCACCCAGGTGTCCTGTGTGCTACATTTTTCTGACTAACCCA
AACCTATTTAATACCTGCACTTGGGTATCATTATTGAATTCTCAAAAGTGAGCGTGTTAA
AAACATGACTTTTCCTCAGCTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1425..1531, 2014..2113, 2494..2669, 2902..3031, 3436..3584
1035..1038, 1425..1531, 2014..2113, 2494..2669, 2902..3031, 3436..3542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved