Canis_familiaris Locus PABPC4
snOPY snoRNA Orthological Gene Database
Canis_familiaris PABPC4
Canis_familiaris
PABPC4
15
SNORA55
8835..8969
15067
TAAATGGAGCGGTGGCTCCCCCGGCCGCCTCTCTCCGCCCCGGGTCGCCGCCGCCTTCG
CCGCCTTCAGGCCCCGCAGCCTGAAGGAAAAACAGGAAAAGATTAAAAAAAAAAAAAAAG
AAAAAGGAAAAGAAAAGAAAGAAACAACAAAAACCAAAACCCGAAAACGCTTTAAAATCT
TAAAAAAAAAAAAAAGCGAGAGAGAGAGAACGAAAAAGCGCATCCTCCTCAGCAGCCGCG
GGGAAGTCACTCGCGCACGCTTCCGGCCTGCCCGCGCCCGTCGGTCCGGTGGTGAGCCGC
CCGCCCGCGCCCACGCGCCTCCGCCCCGGCCGCCCCCGCGCCGCGTGGCAGCCCCGCGCC
CGCCGCCCTCGCCCTCGCCCTCGCCCCCCGCGCGCCGGCCCGGGGCGCACCACGTGTCCG
CGCTGCCCTTCGCCGGCCCGGCGTGGGAGGCGGCTGCGCGCCCGGCCCGCGGGGCTTGCC
GAGTCGGCGCCGCCCGAGATTCGGTTTCCCTCTCCTGGCTGCTGTAATCTTAAACCGCCG
GGAGCCCGAGGCCTATATTTATAGAGAAACGCGTGTCCCGGAGGCCCGCCGTGGGCACCA
TCGGGTTGCCCTCTTGGAGCATTTTTCTCCAAAAATTCTCTTGGAGAAATTTTTTTTTCT
TAATAATTCGGAGCGGAGTCCCCGTTTTAATACGTTACTATTATTAGCTTTTTTTTTTTT
TTTTTTTTTTTTGGACAGCCTGCAAATTAACAAACTCCCAGGGAGGGCCATATTGTTTTT
TGAGAGCCTTTTGTCTGCGGTTTTGCAGTCTCGAACGAGCTGTCCCTGAACTCCTCCTTC
CGGTCCTGCGGCTCCCCGAGCCTGCCCCGGCGTCCCTAAGCTTCCCTCTGCCACCTGTGA
GCCGCGGCGCGGGCCACGGCTCCGAGAAGAGCCCCTTTTGTCCTGTGTGGTCCCTATAAG
AAGTTCTCCTGGCGGGGCTCGGGGTGGTGGGGGCTGGGGAGATGAACGCTGCGGCCAGCA
GCTACCCCATGGCCTCCCTCTACGTGGGTGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTATGAAAAGTTCAGTCCTGCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGCCGCTCCCTGGGCTATGCCTACGTCAACTTCCAGCAGCCGGCCGACGGTGAGT
AGATAAGATGCTCCATCCACAGAATCGTGGGATCCTAGGGAGCCCTGGGAGACTACCCCA
CGGAGGGGGCAGGGGACACACACAGGATGCCGGGGTTCAGAATGAGGATCCTGGCATCAG
GTGACAGGGAGTTCCAATCTTGCTTCTTCCACCACTTGCTAACTGGGTGACCTTGGGCTA
ATCAGTGGTGGCGGTGGGGTCGGAACTCAAGGAGAGCGGAAAATGGGATTTGGAGAAAGT
CCCTGTCAACCCCCATCGCGTACGTGGTCCTGCTTCGGCGGGACCCTGGTCAGTGAGCAC
CGCTCGGTCGGTGCCCCTCCACAGACCTTCCAAAAAAGGCAGAACAATGGAAACAACAAT
TCCTGTAAAAAAATTTTTGGATTCTAAAGCTGCTGCTCCCCTCCCCTCCCCTCCCTCCAC
CCCAGACTGAGCCTCTTTGCTTTTGTACTGGTAAAGGGTCTTTCAGGGCAAGTGGGAGGC
AGTGGGAAGGATCCTGTTCGTTTTGCTTGAGTGGGGACTTGTGTTGGCACCACTGGCACT
GCATGTGCCAGGCCAACTCCTGGGGTGGAGGAGCCCCTTACCCTCTGGACGAAGCCCCGG
GCTGTGGAGAAGAAGGGATACCCCCTTGGGGTAGTCTGGGGGAAACACCATGTGGGAACG
GGCCAGGCTGCTGGGGATTACGGCCTCACCTGTGGACAGAGCTTTACCCCTGTCAGAACA
CTTTTCCTTCATCCCCTGCAAAGAAATTGGGACTCCAGAGAGGGAAGGGGAACCCCCGAA
GGCTGGAGGCTCAGTGGGGCCTGCTAGCCCACACCGGGGCCCTCGCTGCCTGGAAGCAGG
GAGAGGTATGCTGCAGGCGCGGCCGAGCCAGGCCCGAGGAAACCTAATCAGGGACTGCAC
GTGACTTCAGATTAAAGGGAACAACTGTAGAGACCATTACGGGGAGAAACCAGCCATTCT
GTGGCAAAGGATCTCTGGGTCCCTATTTTTGTCCACACTTCGTTCAGTGTCCGTGAGCCA
CAGAGAATGTCACTTGCCCAGGCCGCAGCTGAGACCAGAGAGTCGGACTTGTTGAGAGAC
ACAAGGCGCTGCTACCATCAACTCTGCATGCTGCGAGCTGTGTCTGGCCAGAGGGCACCA
AGGTGGCCCAGTATGGCCTGGGGGGGGGAGGGGGCGTGGGAGTAGTGGGTACATTGGCTG
TTGCCTGCCTTTTTGACACTTTCTGAACAAAAGTCCTGTCACTTAGTGATAGTAGCAGAA
GCTGTTGGTCAGTGCGCCTGCCAGCACATGCCTGTGCAGGACCTCTCCCTGCTATAAATA
AGTGCAGCCAGATTTGTTAGGCTAAGCTGACTCGCCTTCTGCAGCGCTGTGTGGAAAGAC
ACGAGGAGCCCTAGTGAAATGGCTCCTTCGCTGCTAATTAGCGAGACACCGGGGTCCCAT
CCAGGCTGTGGGTCGCAGGCAACCATCGCAAGTGACCACTCTGTCCCTGGACTTTTCCCG
AGTTGGATTGACACGGTCTCTGCTTTCCCTGACCTCCTGCCACCAACTCCATACCCCACG
AACCCACCCCAGAAGGTGGGAAAGGTGGTTGGAAATGAGTGAAAAGGAGATCCTCCCTTG
GCTAACTGGACAGCGGAGCTTGTGGAGGGGTGGAATTAAGGAATTTGGCCTCTGTCTTAA
GTGAGGTGGTAACTTGGGACAGGAGAACCCCCACCCCATCCCCTCACGGAGGACATTGTG
GAGGGAGGCTGGTCATCACATCAGGAAAAGTGGCCCCCAGCTCTGGGAACTTGTTCCTCC
TGGTAAGAGAAGCATTCCTGCTGACAGGTGATGGTCCGTCGGAGCTTCTGGTCCTTGAAG
TGATGAGTGGTACACACGTGGATTGGTCGGGCAGCTAAGGAAGCGTCCCAGGGCACTGGA
TGGAGAACTGAATTCAGATTAAGAGAACTCATATTAAGACTTCCACAGAAGTCAGATTAA
GACTTCAGAAGGCCTGGAAACCACTGCGTGCGGAACTAACTGCACTGTGTGCTTAGGCAG
AAAGATGTGGTTTCATCCTTATCATCCTGATAATAAAAATAATGTTTCCACGTGTGACCA
TTAGTGTCTATCATTTTGAGGCTTTTTGAATCCATTTCTGTTCTCAGAAATCTAAGAAAC
TAGACTGAATTCAGGGATAGCACATTTTTCCCTGGTGAGTTGCTCCTAGGTTTTGTCCTG
TCATTTGTTTCTCAGAGGGGTTGTAGACTGAATGGCAGCTAGTTGGTAATTAGACGCAAT
ACCTTACTGAAAAATAGTCAGAAAGTCTAGATTAGTTTCTTAATCTCTAGTTTAGCTTTG
TGGCTTAGCCATCCTGGACGTAAGTTCGCTCACTTTATGAAGTAGCTAGTGTCCCATCTC
CCACCTACGTCACGATGGGTGGTAAGCACCGAAGTCTTCATAACTAATACAGTTTAAGTC
AAGTGTGCGGCGTGAGGATTTGATCTTGGTGCCAGAAGGCCATTCAGACGATTTTGCCCA
ACCCCCTTCCCCACCAAGGGTGCAGGCCCAGAGGGCTCCTGGAGCCCTTGCCCAGAACAT
CTAACCCCCTGTGGCAACACAGGCTAGAGGGATCTGATGCCCTTTGATTTTAATAGCGTT
GCCTTTTATCAGAGTGATTACCTTGAAAAGTCCTAGAGTCATCTGTTCCTGGGCTGGTGG
TAATCATCTACATGAGGTGACGTTTTATATCCTTGACTGAAACGTGTTTCTCTCTTGTAG
CTGAGCGGGCCTTGGATACCATGAACTTTGATGTGATTAAGGGAAAGCCAATCCGTATCA
TGTGGTCTCAGAGGGATCCCTCTTTGAGAAAATCTGGTGTGGGAAATGTCTTCATCAAGA
ATCTGGACAAATCTATAGATAACAAGGCACTTTATGATACTTTTTCTGCTTTTGGAAACA
TTCTGTCTTGTAAGGTAAGCATTATGGACTCATGAAAAACAAACAAACAAAAAATAGCAA
AGGGGGAAAAGGCTTGGAATTGGGCGATAGGATATGGTCCTTTTCGAAATGCTGGAAATG
GCTCTGAAGCCTAAAAGTTCCCTGTTCATAATCTTGTGCCACAGCCCAGCGGGACCAGCA
GGTGCTTTTGGGTCTTTGTTTATTCTTCCCTCTGCCTAAAATATCCTTCCTGTTTCCTAC
CTTTGGAGGGCATCAAAGGGTTTCTCTTTTCTGGGGGGAGAACCAGAGCAGTGCCTCTGG
TCTCCAGGCAGCTGTACTTAGTCATTTCAGAAGCATAAATTCATCCTCTTCCTTCTCCGT
GCACCTGTTTATGTGGAGAATTTTGTACAACTGGCGTGGTGGTTGTTTACATGTCTGACT
CCACACTAGACTGCAATTCTGCTGCAGGCTTGGAAAATGGTCTCTCTCTCTGCAGCACGG
TGGCTTTGCTCCTAAACCTCAATGTCTTTTAATGAAATAAAACATTGGAAATAGAAGCAG
CCTAATAGTGGCTGCCACTTATAAATGGAACATCACTAGGTGCCTGGTGGTGCTCTCAAG
TGTCCGGAAAACTTTACCTGCAGTAGTCTCCTCTCTTTGGACCGTGGATGGGCTTCGGGG
CCTCTTAGACGCAGGAAACTCTGAGTAGACAGTAGATGACCATGTGGTTCTTAAATCTCT
GGAGATGCCTGCGGTGCTAAAGTGGTCTGCTTTGTCTTCGACAGGTGGTGTGTGATGAGA
ACGGCTCTAAGGGTTATGCCTTTGTCCACTTCGAGACCCAAGAGGCTGCTGACAAGGCCA
TCGAGAAGATGAACGGCATGCTCCTCAATGACCGCAAAGTGTGAGTGTCCCAGTCCGGAG
CAACAGCCATCGCATGAGCCAGCCGTGGCCCCACCTCGGTATTAACTGGCACACACAAGG
CGGCTACTGGTTCTCTCGGCCCAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGG
TGAGTCTCCCTGCCCGAGCCGTGGCAGCCCTTTTGACTCGCCAAGGTGGGCTTCCTGCCC
AAGCCATGGCCTGCCTGCCGCCTCTCCCTTAAAAGCATCATCTGTCCGTGGGTTTTGTGA
GCACCGGCAAACTGGGGCTTGCTGGATGGCAGCTCTGAGCCCTCTTTGATCAGGGGTCTT
GGCCAGCGGCAGAGTGGAGAGGGCCCTGGACTGACCAGGAGCTGTGTACTAGCCATATGA
CCGTGGCCTTACCGTGACTCAGGTCTGTCTATAGGGTCATTTGCTAGGGGTTGATGCCAA
ATTGTCCCCAGATCTCCACTTGGCTAACTTATAACTCGGTGGCCTTCTAGAAGGCTGGCT
CTACAGTAATACTTAATTTGGTTATAATGAAAAAAATCTCATCTGATGGCAGAAGACACT
GTTCATAATAGACCTTGTCGCTCTGGTGTGGTTATTGCAGAATGAGGGGCGGGGTGGATC
CTAGCTAAGCCATGCAGGGAGAGAAGGGACCATAAGTCTTGGCTATAACAAGCAAAAATC
ATGTCTGTTCTTTGTGGGGCACCTTGTTGTCTTGAACAGACCAGGGGATGGATTGCACTG
ATAATGTGTGTACGTGGCCAGTGGTCAGGTCTTCCAGAGGTACCACTGAAAAGAGATCTG
AAGATTTTCAGCGTATGGATACATTTTCCCACTGAATATAAACCATACCTGGATGAGTCA
CGTGCCAAAGCCAAGGCTACCTCATAGTTCACTCTAGCAGTCTCACCCCCTAGCACTAAC
CACTGTTAACAGTTTGGTTTGTATCCTTCCAGACATTTTCTATGCATTTACATAGATGCA
CAGAAATGAACGTTTTAAAAACATGGTCATCAGGTTTCTTCACGAAGGCAGTGTGATGTG
GTAGGAGTAGCCCTGGTCTGAGCCAGGAGTCCTGGGGCTGGTCCTTGTAGGACAGTCCTG
CCTCTCTCTTTCTGCTGGGGAGTTGGGACATCTCTGAGCTTGCTCTCGGTGGTTGGATGG
GGACTCGTGTATTTTAACCTCTCCTGTCAGCCTTTAACCTATATTCCTCTGAGCCCCTGG
AAATCATGATTTGTTCCTCTGGGTGTTCACTGTTCTCCATGGTTTCTTTTTAGGTTTGTG
GGCAGATTCAAGTCTCGAAAAGAGCGGGAAGCTGAGCTTGGAGCCAAAGCCAAAGAGTTC
ACCAATGTCTATATCAAAAACTTTGGGGAAGAGGTGGATGATGAGAGTCTGAAAGAGCTC
TTTAGCCAGTTTGGTAAGTTGGGCTTCTCTGCCTCATGTGCCCCCTTCCTCAATGCACCA
GACCTAGAAGTCCTATATCTTAGTTGTTTAAGAGGTGAGGGCGCCTAGGTCCGGAAATAA
ACTACTATGTGTGGCAGGATCACAGGTTAGATAGAAATAGACACTTGGTTTCATCCTACC
TCATTCCCAGCCAGCCCCAGGACCGTCTCAGTAGTTTGGTCAGAAGTAGAAAGCCAGGCA
CAGCGCCTCTTTGTAGAGCCCGTCTGGGTTTAGCAAGAGTTGGCTTCATTTGGGCTCCTA
GAGAAGCTTTCTCTCCTTGAGCTGTAACAGAGATGGTGTTACTAATAGTTCTGTCCTTTG
GTAATAGGTAAGACCCTAAGTGTCAAGGTGATGAGAGATCCCAGTGGGAAATCCAAAGGC
TTTGGCTTTGTGAGTTACGAAAAGCACGAGGATGCCAATAAGGTGAGAGTACCACAGGGG
TTGGGGAACCATTTGCAGGAAATGGCCCCCGAGTGTGGGCAGGGCCTGGCTGGCACACAG
TAGAATGGAGCTGGCATTGCCCAAGCATTCGTAGTGATGTAGTTCTGGCCTGAGGGATTT
TGCATGGTAACCCACCTTTACGTTCCCAAAGCACTTGGCACCTTCCTGTCCCCTCTGCTG
TTCAGCACTGTAGGTTGAAAGAACAGGATGGGTGTTTGCTCCCCTTCATAGCGAGGGGAC
TCAGGCCCCAGGAGTGCTGACGTGCTGACGGTAGCAGCAGCTGCTTCTAGGCAAAGCGTG
ATGCTGGGCTCGCGGTGTCCATCACTCACTCCCCACAGGAGAGCCTGAGAGACTTAGTGA
CAGCCAGATTAGCAGCTTCGGCTCATGTCTGCCGTGCCTGTATTTATAAAATTACCATTT
TTTTCTGTATCCTCTGGACCAATAACCCATTTAAGTAGTAACCCCATTTTACTCATGAGG
AAGTTTGGATTTGCTCAGCTGACTTCAGAGATGGAATGAAATTAGTTCTTAGCCCTGTAG
GAAAGAGTTCCTTCTCTCTGAATATTTGGTGGGACATTAGGCCCCCAGAGCAAGGCCCCT
GCCTGTACGTGGGGATTTTAAGACCTGTGTTTCCTCTTTAGGCTGTGGAAGAGATGAATG
GAAAAGAAATCAGTGGGAAAGTCATTTTTGTAGGCCGTGCACAGAAGAAAGTGGAGCGGC
AGGCGGAGTTAAAGCGGAAATTTGAACAGTTGAAACAAGAGAGAATTAGTCGGTATCAGG
TGAGAGGTGGTCCTGGCCCAGCCTCCTGTCCAGGGCTTTCCTAGCAAACACTGGCAGGCT
TTCTCTTTGGGCCTAGGGATCTGTCTCTTCCTCTCCTTTCTCCCAAGATCCTCAGGTTTA
TTTTATTTTATTTTATTTTTTTAAATTTTTATTTATTTATGGTAGTCACAGAGAGAGAGA
GAGAGAGAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCACCAGGAGCC
CGACGTGGGATTCGATCCCGGGTCTCCAGGATCGCGCCCTGGGCCAAAGGCAGGCGCTAA
ACCGCTGCGCCACCCAGGGATCCCAAGATCCTCAGGTTTAAAAGGAAATGCCTACCAGAT
AGAACAGCAGTTTTAGAACAAGGGCAGAAGATGGACTTACTCATTTAGAGACTCATTCCG
GAAGCTTCAGTGTGTTCTTAAATGATTGCCATTTGTGGAAGTGGTGGCAAGAGGCCTGCG
GGGGCCGGTGGTCGGCCAGAGCAGCTGTGCAGAAGGCCAAGCCTATGGGTCTTGTCAGTC
TGCGGCAGGAGTCTCAACCCTGAGCCTGCACCAGAATCCCCTGTGGGGCTTGGGAAAACA
TGGCTTCAAGACCCACCCCCCACCCCCCCCCACCAATTTCTGATTCAGTGGATTGGGGTT
TTAGCCCGAGAATCTGCTTTTCTAAGAAGTACCTGAGGAGGGGGCTGCCGCTGGTCTAGG
GGACCGCATTTTAAGAACCTGTGTCTTGGGGCATCTGGGCGGTACAGACCTGCGTTAACA
GTGATCCTTCTGCTTCAGGGGGTGAATCTCTACATTAAGAACTTGGATGACACCATTGAT
GATGAGAAGTTAAGGAAAGAGTTTTCTCCTTTTGGATCAATCACCAGTGCAAAGGTATTT
TATTCTGAGATCTGGGATCAAAAGTAGAAATGACCATTTTTTAGAGGTTTATTGGCATTT
GTTTCATTGAAGGAGTAGAATCTAAATTGTGTTCCTTTTGGAGAATAGATACTATGTTTA
TCTGGCAAATTCCTCCTGGCCTTCATTACACATCTAGGCATGTGCTCCGGTTAGGTGAAC
ACTGTGAACACTGCGCTGTCCCCCAGGCATGGAGGTGTGGGGTGAATCTGAGCAGCCCCT
CCTGCCCACCCCTAAGCACCTGAATCTTTCCCATTCTTTGCTGCTCTGTGCTGGTGTGGG
GACAGACGGTGCAACAGTACAAGCAGAGGAAATCCAGACAGGTTGTTTTCCATTTGTCTT
GGGGCCTGTCTCTACGACTCTGCCACACCTTGTCGTGGACAAAGGTACTCTGAGGACTTG
GGAGCCAGGGTTAGGAACTTCCATCCTGGCCTTAGGGAACAAAAGGCAAGGAAAGGGAGT
GGAAAGATGGCTCTTGCACGTTTTGCAATGTGCATTATTTGCTTGGTTTTCTCTGATAAT
CCTATCAACTGATGCAGCAGGGTGAGCTTGGCTGAGTCCCCTTCTAAAGATAAGGAATTG
AAGTCCTTGAGCTTGAGAACACTGGTTACGTGAGGAATATCGGCCGCATGGCCTTGGTCT
GTGGGGGATGTGTTGGGAAGTGATGATGTGTGGAATTCTGGGGTCCTAGCCCGATGCAGA
CACTGTTGCTGTACCCTAGAGCTATAGCACATATCAGAGTCTTGCCATGGAAGAGAATGG
AGGCCGAGTGGGCTGGTTAAGACTTGGTGACCATGCGTTGGCCCGAACCTTAAGTCCTAC
ACAACCTGAGAATGTCACAAAAGGAGCATTAGTTGTAGCAGGAAGTTGATCAGAGGCCAC
CCTATTGGAGTTCCTTGTTTCCTCGCCCCTTCCCTCTTATCACCTCCTTGACTGGCCTTC
CTCAGTGTGAGGAATGATGCTCTCCTTGCTTATCAGCACAATGTTCGGGTTGGCATTTGT
AGGAAGAGAACAAAAGAGCTGTGTCTTTAAGTTTCCCAGGCCCCATGTTCAAGATGAGGG
TGCTGTGTTTTCATACGTACTTTGGCCCACCTCACTGGTAGAGAGCTGTTGCGTTGATAC
ACATCCTTCCATGTCAGGAGGCTGTCGAGGCACCAAGCTAGACACAAAATGGGGCCAAAC
GCACAATGTCCTGTTGCTACCAATGTTTCCAAGGAGATAGGCCAGGGGAAAGCCACAAAG
TCACCTTTTCAGATAAGGAAAAGGACTATCTAAAAGACGAGCTGTATGTGGGGAACCTGT
GGCTTTGTGGCAATTTGCTTTAGGGGATACCATGGCCATTGAGGCTCAGAGAGGGCAAGT
GTTTATTAAGATCATATAGCATATGGGCGCCTAGGTGGCTCCGTTGATTAAGCATCTTGA
TTTTGGCTCAGGTCATGATTTCAGGGTCTTGAGATCAAACCTTATGTGTGGGCTCTGAGC
GGAGTGTAGAGCCTGCTTTTAAGATTCTCTCCCTCTCCCTCTGCCCACCGCCCCCATAAC
CGTGCCCATACCTACTCCCATGTGCGCATGGACTCAGATTTTTTTTTGAAAAAAAGATCA
CACAACTCAGGAATTGGCTGAACTGGGCCTAGAATCCAGCTGTCTCTCCTAGCTGGTCCT
CTTTCTGCTGTTAATTCCCGTCGAATTAATGGTGGCAGTCATTGGTTTTGTAACTCCTGC
TACCCACATGTGGTATTTCAAAAACATGTCCTAACTCTGCTAAGAGATGGTAAAAGTTTT
GTTCACCAAGGTCTTGGTTCAGATGAGATCTATAGGTAAACAGCTGAACACTGTTCAGAT
CTCTCGTGGATACCAAGAAACAGCTTTTGGGTTCCGGGTTTACCCATTAGCCATATCATA
GTGTTTAGAAACTTGAGATCACCTGGGGATCTAACAAAGAAAGTGCCTAGGCCCTGTCCT
TAGAAGTTGTGACTTACTTGGTCTGGAGTACCCTTGCCCTAGACTTTGGAACTATTGCGG
CAGAAACCAGGTTTTTTGGCTCTTAATAGCTGTCCCCTAACATAGAACATCTTTTCCTTA
AGTAGCCGGTCCCTTTGTAGGTAATGTTGGAGGATGGGAGAAGCAAAGGGTTTGGCTTTG
TCTGCTTCTCATCTCCTGAAGAGGCGACCAAAGCAGTCACTGAGATGAATGGACGCATCG
TGGGCTCCAAGCCACTGTATGTCGCCTTGGCGCAGAGGAAGGAAGAGAGAAAAGCTCATC
TGACCAACCAGTATATGCAGCGGGTGGCTGGAATGAGAGCGCTCCCTGCCAATGCCATCT
TAAATCAGTTCCAGCCTGCAGCTGGTGGTTACTTTGTGCCAGCAGTTCCACAGGTGGGTC
TGCTTGTGCTCAGGGATCTTTGGAACCTGCCCCCTGACGGCTGTTCCTGTAGCCTGTGGT
GGTTGGGGGGGGGGGGGGGGAGTTCAGATTGTCAGAGGACCCATGAAAATGAAGATCTAT
TCATTCTCTCTCACTTACTTGCAGGCAGTAGTGAGTTAGAATGAAAGAATCCCCAGTAAC
CTGCCTTCCCTCCCTGGGGCCTTTGAGGATTGAGAGAGCTTCTGCTCGAATAATTAGTCT
CGGGCCTGGCAGTGAGATGAGATGAGCTACTTCTCTCCTGTGACATAAGGTCCTTCAAAT
AAAAGGGCCTGGATGCTCTTTCCTGCAGGCTCAGGGAAGACCTCCATACTACACCCCTAA
CCAGTTAGCACAGATGAGGCCAAATCCACGCTGGCAGCAAGGTGGGAGACCTCAAGGTAG
GTGGTGGGGAACGTGATTTGATCACCCGGGGTATGCCTGTCCTGGTCTCCCCACCCCCTC
TGAGGCGCAGCCGAGGCTCCAGTCCCCATGCTTCATAGGTGATGCACAATTTTTGTCTTC
ACCAGGCTTCCAAGGAATGCCAAGTGCTATACGCCAGTCTGGGCCTCGTCCAGCTCTTCG
CCATCTGGCTCCAACTGGTAATGCTCCGGCCTCTCGTGGCCTCCCTACTACTGCTCAGAG
AGTCGGTGAGCAAACTGGCCTTGAGTGTGGCCTGGGGATGAGGGAGTCAGGTTGGCTAGG
CTCTGCCCAGGGTTGGTCAGTTTGTTGGGCTCATGTTCCAGTTCTGGTTCCATAATCTTA
GCCGTGTGCTCTGGTTGGCACTTGAGCAGAGAAACAACGGGAGTTCTAGGAGTGTCGGTG
ACTTAAGATTTTTTGCTCATTGGACTCACGTGAAAAGAGGTTAATTATAGAAGCTTGTTA
GCTGGATGACTACGGAGGCAGCCTCTTCTTTTGGGCGGGGTTGGGAGATGGAAGGAAACT
GTTCTTCACAGAATATGTCCTGTATTCCAAGAGGCGGAAAGAGTTGTGTGCTCTCTGTTG
GCTGCTCCTTGAAAGGAGCGGCAGCGGCCCTGTGTGCGATGTGTTGCGTGAATATGCTTT
GGAAGTGCTCCTTCCGTGGGACGTGGCCAGTTGGACATCTGCGCCGACACTGATGTGCAT
TTGCTGGTCTGTTGTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGC
TGGCGCCGCCCAGCAAGGGCTGACTGACGGCTGCCAGTCTGGAGGTGGTATTGGATGCAC
ACGGAATGGGGAAAGATGGGATTGACGGGCCTTTGCTCAGACTGATGAGCTTTAATTTTG
CTTGTTCTTCTCCAAAGGTGTGCCCACAGCCGTGCAGACCTTAGCACCTCGTGCTGCTGT
CGCCGCTGCTGCCCCTCGGGCTGTCGCACCTTACAAATATGCCTCCAGTGTCCGCAGCCC
TCACCCCGCCATCCAGCCTTTGCAGGTGAGGCCTGCCAAAAAGAATGCTAAAAGGATTTC
CCGTGTTTGCTCTTGGTTGAAAAGATGCCTTGCTTTGATTCCTCCAACAGGTATAAATGC
CTGCTCCGTGTCAGGGTGCTGTGTTTTCTGTGATGACACTGCCTTTGAGGGGCTCTCTGT
ACTGGGAGAGAAAGGGCTGGAAAGTATTCTTCTCTTGTAATAGTCCACTCAGGAATGCCC
CGGCAGAAACAGCTGGTGTTTCTGCCCTCTTTTTTTTTTTTTTTTTTTTTTTTAAAGCAA
CCTGTGTGTGCTTGCTTAGCTTGTTGAGCTTCTTACGTCCACTGCCAAGTTGATCCTTAG
CTGCTCGGCAAGATTGGGACATGAAGGCAGGAAACAGCTTCGTGTGACAGATGAGAAGTT
CAGCTTCAGAGATCGTGGGTCGGGGTCGGGGGACTGGCCCCAGAGCCCAGCAGTAATTTG
CTTAAAGGAGCCACACACTGCCTTGTGGCCTCTGAGCTTGCTTGCTCCTGCTTCACACTC
TAAGTAAGAGATGCCTCAGAACATTGCTCGTGTGAAGTCATTTGTACTTTCAGAGCCTTA
CTTGTAATTTTAGGGCTGTGACTGGCCTTGGCCATGCATGTTGACAGTCCTCAAGCATTT
GATAGAATAAAAACACTGGGTACAAATTTGATGATTGCTGAGCCTTGTAGGTTTATTTTC
TTACTCATTTCCCTTTCTCTCCTAATAGCATGCTGTTTTTATTGTATTTGGTTTTGTGTT
CATGCCTGTACCACTCTTGCCCATGTAGCACCCTCATCCCCCAAGCTTACAGTTAGTTCC
TTGGCAGCAAGGACAGCCACCTTCATCTCTGTCACATTAGTAGGCTTTCAGATTGGCCGG
ACGGAGGACCATCAAGTATCCTTTCCTTGTTGCTAACCTGCTGCCTCTCCTGGTTCCTAG
GCCCCCCAGCCTGCCGTCCATGTACAGGGGCAGGAGCCCCTGACCGCCTCCATGCTGGCT
GCAGCACCCCCCCAGGAGCAGAAGCAGATGCTGGGTGAGTGACCCACGTATTTGCAGAAG
AGGAGGCCAGAGCCTGGTGTTGACCTGAACACCAGCACCCATTCCGCACTGGGATTCAAC
CAGTTTTCAATTAAACATCTTCCCCCAGGAGAACGTTTGTTCCCACTCATCCAAACCATG
CATTCAAACCTGGCTGGAAAAATCACAGGCATGCTGCTGGAGATCGACAACTCTGAGCTG
CTGCACATGCTGGAGTCCCCTGAGTCTCTCCGCTCCAAGGTGAGCTGGCCCCGAGATGCT
GCAGCTTTTGCTTGCTCCAGCTGGGACGACAAGGGGTGGCCTCAGCACTGGGTGTGGCGG
AGAGAGGATCAGCCATCTCCTGACCGTCTCCTCACCTGTGATGTGAGGGCTACTGTAGGG
TGGAAATTAGAAAAAGCAAGCGGGCTGCACCAGGAGACACCACTGCTGGGCCCGGGCACC
TGGGAGGGGCCGAGGACCTCTCGTCCAATGTCACTAACCACCTGGAGATTCCTCACAGGT
GGATGAAGCTGTGGCGGTTCTACAGGCTCATCATGCCAAGAAAGAAGCTGCCCAGAAGGT
GGGCGCTGTTGCTGCTGCTACCTCTTAGACAAGGAAAAACCGTATGTTTGGCTGTTTTTG
TTTTCTGCAGTGGCTTTGACTTGTGACTATCTTTCTAAAAGATGAGGGGCAGCGCATATA
GAGAGCCATGTTTTTTGCCATCATAACCTGATAACTTTTGGGCAGGCTATCACCTGGGTT
TTCTCCAGAAGGAGCACCTGGTTAGATCTTTCTCAAGAAAGACCTTTTTGGTTTAGAGTA
ATGACAGATACACAAGGTGGTGTCGTAATCAGATCCCACAGCCTCATTTCTATGTACTTC
TTGGTTTGGCTTGAGGTTGGTGAGGTCAGCTGTCTGTGCAGCCATGGCTTGGCTCTGGGA
ACACAAGGCACACAAGCCCTGGTGTCGGAGTGGGACAGGCAGACACACCTGACAACAGTT
ACAGGATGTGTTCTAGTTGACTTCTGACCCTGGGGCCTGTGGCCCCCCCGTCTGCAGGGG
CGGGGGTGAGTGAAGCTTATCTGGGACCTCTGACAAGGACTGGTGGGTGCCTTCTGATGG
AGGGAGGAGAGAACCAGATGAACCACAGGCAGAAGCCAGGGAAAAGGACACGTGGTAAGG
GCCCAGACCCTTCATTTGGAATTTAAACAAAGAGAATGGTAGCTTTGAGTACAGGGTGGC
CAGGAAGGGCCCGGGGCTTTATGGGACCTAGCTAGCCTCAGAGTGGGTGCTTCTCAGCCA
GGGGTGCCCCCTCACAGGACATTTGCCAACAGAGACCTAATTTTGGTTGTCAACTGGAGA
TCGGTCACTGGTATCTAGTGGGTAGAGGCTGGGGATCCTGTCAAATGTCCATACGCACTG
CTCTCTGCAGTACTTCCTTTTAAAAGCCAGAGATTTCAGTGCATCTCTAAAGTTTTTATT
TATGCTGGTGCTTTTCTTTTCAGGATTCAAAAGCCAAATAACCCCTCCTGGAATTCAGCT
CAAGGTTTGAAGATTTCTAGCGTGTCCTATGGACCTCAACACCAGGAACCACAAATTGGA
AATTTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3960..4153, 4904..5019, 6293..6432, 6787..6881, 7541..7678, 8478..8573, 10700..10972, 11308..11395, 11525..11644, 12137..12223, 12317..12444, 13380..13473, 13588..13718, 13978..14067
1001..1193, 3960..4153, 4904..5019, 6293..6432, 6787..6881, 7541..7678, 8478..8573, 10700..10972, 11308..11395, 11525..11644, 12137..12223, 12317..12444, 13380..13473, 13588..13718, 13978..14064
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved