Canis_familiaris Locus RL4_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris RL4_CANFA
Canis_familiaris
RL4_CANFA
30
SNORD18, SNORD16, SNORD18, SNORD18
1218..1289, 1634..1732, 2184..2255, 3097..3166
5432
TGTTTATCTTTTTTTTTTCCAATTTTTTTTATCGTTTTGTGTTTATCTTAATCCTCTCT
GGAAATCATTCCGGTCCTCTTATTTTAAAAGTTGTCCTGTTTTGTGTCCTTTGAATTCTT
AGCCCATAATAGGACTACTGTCCCGCGCGCTGCTTTTTTCACAAATAGTGTTTGCATGCG
TATTAGGTAGTGTCTTGTGCTCTGTGGAGTTCGGTGAAAAAAAAAAAAAAAGCAAAACAA
TCCATCCTTGTGATGCTTGGATGGTAGTTTGAACAAATAACACCAAAATGCCAGATGATG
GTAAGTGCTGTGGACCCCGGTGGCTGGAAGAGAAGGCAGTAGTTGAGCTTTAAAGTGATC
AGAGAAACCTCCGAGAACATGGCTTGAAGGAGCGTTGAGGAAGCATGTTGAGCAGCTTCA
GGATGGAGACCAGTGTGTCTGAGGCAGAAGGGGAGTGGCCTGAGTGTAGGGACAGTGATG
GTCAGAAAGGAGAGGGAGATGAAGGGTCCAGCAGGTGGTGTAGGCCATTCTTGGAACTTG
AGTTTTACCCTCAGGTGGTAAGTCTTTGGAGAAGGTTCAGCAGAAAGTAACATGACCGGT
AATTTGAGGTGTGTTCAGGTTGAAGGGGGCCAGGGGCAGGAATCTGAGGTAGGGTTTGTT
GTGGTCGCCCAGATTTGGGGACACTGGGTAAGAGTTTAGGTGGCGGCCTTAAATAGCCTT
TTCAAACCTTACAGTATGCATTTGATCGTTTTCTTTTGTAAGCTGTGGTTTGAAATTTTT
AACAAATTATGCGGTAGAGTTTGAGAAGCTAAATGTCCTTTAAGTTTTAGAATTTATTGA
ACTTAATAGACTTGATGTGTTGGTCACAACCTTTGTTTTAGTTCTAAGTGTTGTCTTCCG
TTCCAAACCAATCTGTTCTGTAATGCAGTTTTTAAGGATACTGTTGATATGCGAGATGAG
TGCCTCTGGCATTGTCCATATAAATTATCTTTTACTTTTTGCAGGCGTGTGCTCGTCCGT
TGATATCTGTGTACTCCGAAAAGGGGGAATCATCCGGCAAAAATGTTACCTTGCCCGCTG
TGTTTAAGGCTCCCATTCGACCCGATATCGTGAACTTTGTTCACACCAACTTGCGCAAAA
ACAACAGACAGCCATATGCTGTCAGTGAATTAGCAGGTACGGGTTTTTCAAGGGTTGATA
TTTTGAAGACCCACTTAACAGCAGTGATGAAATTCCACTCCATTGGTCCGTGTTTCTGAA
CTACATGATTTTCCTGGATGTTCTGAGGCTGTTGGCTGCTATGCGTGATAGTCCCAAATG
GGTATGGTTGAGTAGCTAAAACTTGTGTTTCTTCCCAACCTCAGGTCATCAAACCAGTGC
TGAATCTTGGGGTACTGGCAGAGCCGTGGCTCGAATTCCCCGAGTTCGAGGCGGTGGGAC
TCACCGTTCTGGCCAGGGTGCTTTTGGAAATGTATCCTTTGTTTTATTGTATAGATTGGT
CAGCTCTTAAGGCATTTACGAGACTGGACCAAGTTTATTCGTGTTAGTAGTGATGAAAAT
ATTTCCAACATACTAAGTGTCCAGGTTAAACATTGTTCTAGGCAGTTCGGAGCTTGGCAT
TAGGAACTTCTGCTTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGT
TGCCTGCTGTCAGTAAGCTGGTTCAGAAGGGTGACGAAAATTCTTACTGAGCAAGACCTA
ACCTTTTTTAATTCCTAAAATTTTGAGAAATGTGATTCTTAACTGCGAAAATAGATGTGT
CGTGGAGGCCGCATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCACCGCAGAGTGAAC
ACAACACAAAAGCGATACGCCATCTGCTCTGCCCTGGCTGCCTCAGCCTTACCAGCACTG
GTCATGTCTAAAGGTTTGTATATTCTATTATTACAGAAATAATACAAGGATAGCCTTTTT
TTCTTCCACCCAACCCATTTCATTCACGTTAACAGTAACCTGTATGGATTCTATTCATCC
CAGAGTCCCTGACTAAATTTCTCTCTATTAAGTAATAGTTCTAATCGACAAATACAGTGT
AACTGGGGAGCTAAGTGAAATGTGGTGCTTTTATGTATTAGAAAACTTGCCACTTAGACT
TCATGTTGCTTATTTTGTAAACTGTCAAAATGATGAGATTCCACTTAAATTGGTCCGTGT
TTCTGAAACACATGATATTTGTGGAAATCTGATTTGGCACATCATATGCTATTTTGCTTT
TGTGGATTATATGAAATGTTTGTAGATTTTTCAAAAGGTTCGGGGTAATGAGGTATGTGT
TGATATTTGTTAATTGGCATCGTCAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTT
GGTGGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAGGCAGTTTTGCTTCTTAA
GAAACTTAAAGCCTGGAATGATATCAAGAAGGTAGGCTTAATGAACCGATTTCCATTTTC
ATGGTCCTTAACATAAATTTGTTGTCAGATTTTAATGTCAAAAGATGACTGGAGGGCAGT
GTGACTTCAGTGGATATGAGAACAGGGACTCTAAAACCTTTCACCTTGGGTTTGAATCCT
GACTGTTAAAATGGCTTTGTGTGTTAATGTTGGACAATTGTTATGGCTCCTTTTCATCAT
AAATATTCTCTCTCTTTAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAAT
GAGAAACCGTCGTCGTATCCAGCGCAGGGGACCCTGCATCATCTACAATGAAGACAACGG
TATCATCAAGGCCTTCAGAAACATCCCTGGTAATTGTACTGTTGATACATGTTTTGATTG
CCTGTACTCTGCAAGCTTACTCGGCTTTTTTTTTTTTTTTTTATGATAGTCACAGAGAGA
GAGAGAGGCAGAGACATAGGGAGAGGGAGAGGGAGAAGCAGGCTCCATGCACCAGGAGCC
CGATGTGGGATTCGATCCTGGGTCTCCAGGATCGTGCCCTGGGCCAAAGGCAGGCACCAA
ACCGCTGAGCCACCCAGGGATCCCGCTTACTCAGCTTTTAATGTGATGAAATTCCACTTC
ATGGTCCGTGTTTCTGAAACACATGATTTTGTGGAACTTCTGATTCTCGGCTGAATGAGC
ACATTGATGGTGGGAACTACCTAATTAGTAACGTAATTTCTCAGGTACCTTAGGTAGCAC
ATAAGTCATAAGCGTAATGTTTCTTGTATTTAAAATACAGGCTCCCTAACTCTCTTTTCC
CTTCTAAAGGAATTACTTTACTTAATGTAAGCAAGCTGAACATTCTGAAACTTGCTCCTG
GTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGCAAGTTAGACGATC
TGTATGGCACTTGGCGTAAGGCTGCCTCCCTCAAGAGTAACTACAAGTGAGTGTTCTTCA
TGTTCATATATCGAACACAGATGTTCACGCTGTGGATATTTATATTCAGAATTGGCTTAT
GGGTGATGGATAATGTTGTGTTGCCATTTCCTCTTACATAGATTGAGTACTGTGAAATGG
TGAGATGTTCTGAACAGTGATAGTGTAGTGGAAATTCTGATGGAACACTTGGAGAGTTTC
AGTGGATAGTGAGAAGTAGGAATTGAGCATCTTATTGTCAGCATGTTTTTCTTTTCAGCC
TTCCCATGCATAAGATGCTTAATACAGACCTCAGCAGAATCTTGAAAAGCCCAGAGATCC
AAAGAGCCCTCCGAGCACCACGGTAAAGTTGTGATACTTTATTATGCTCCAGCTTCGTAC
TGTATTGGTTATTTCAAAAACGTGGATAATGTGAGTAAAATAAAATTTCTGCCTTTTTAC
AGCAAGAAGATTCATCGTAGAGTCCTGAAGAAGAATCCACTGAAGAACCTAAGAATCATG
TTGAAGCTAAACCCGTATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAAG
AATGTAAGTGATAGGTTTTTGCTGAAACGTTAACTTTTTTTTTTTAAGATAAAATTCTTA
AGGTCTTTTTTTTTTTTTTTTTTTTAATTTGTTGCAGCACAAACTCCGGATGGATAAGGC
AGCAGCAGCTTTAGAAGCCAAATCGGAGGAGAAGGGAGTTCCAGGCAAGAAGCCCACGGT
AGGGAAGAAAGGAAAGAAAACTGTTGGTGTGAAAAAGCCGAAGAAACCTGTGGTAGGAAA
AAAGGCTGCAGCTACCAAGAAACCAGCAGCTGACAAGAAACCTGCAGAAAAGAAACCTAC
CACGGAAGAGAAGAAGCCCGCTGCCTAAAAACTTATATTTGTTTATTCCATAAAACTCAA
ATCATTTTGGACAGCTAATTTTAAATAAAGACCTGATCAAAGACAGTGAGAAACATAACT
TGTTGGGTGTGTTTGTGAATCATGGGTAGAATTTTGTGGGTTTTTTGTTGTTCCACATAA
TTCCAGCCTCTTTGGTTCCATTTCATTATAGATAGTCTGGTATAAAACCGGGCCTTGCCT
TTATAGTAAATCCATGCATTTGAATGGGAAGAATGTTGCATAAATCCAAATATAAAAGCC
AAATTGAAAATGTTTTGAGAAGCAGATGGTTAAAAGACTCATCTCAAATATGCACAAGCT
GCCAAGATTTAGCACTCCTCCAGGGCCTGGGTGGTTCAATGGGTTGAACACAGACTCTTA
GTTTTGGGTTCAGTTGGATCCTATGGATCGTGGCATTGAGCCCCTTCTGGCGTCTGAGTT
AAGTGGGAGAGTCAGCTTGGGGTTCTCCCCTGACCCTCTCCATGTGCTCACTGGTAAGCT
CTAGTTTTTTAAAAAAAGATTTAGCACTCCTCCCTCAAAAACCACACCTTCAAGAAGAGA
AAGGTAAGGGGACTTTGTTTTCTTTTTAGGACCACAGAGGGCAGAATGTATTTTGAGGCA
CTGCAAAAAATTCATGGTTCCTTCAGGAAGATTCCTGTTAAAACCTGCTGTGGGAAGTGT
CTAAGAGGACACTTCTTAGAGGAAATGCCACCCTTGGTATTTTGGCCTATGACCTGGAAG
TGTCCAGCATGTTTCAGCTAGTGGGGTTTTTGCAGTTTTAGTAAGGGAATGGATATGATG
CATATGTTGGCCACATAGAGCACGGAAAAGCCAATCCAAAAAGATGGGTTTTTTTCCTAC
CCGGTTCCGTCAGCATGTCCTCACCTTAGGGGACCTACCCTGACCTATCTTGTCCCGGCA
ACATGCTTTGCATCTGGTTTGTTTCCTTTGGTACATCCAGGGGGATGAAGCTGGTTTGGA
GTAGAGATTTGAGTCCTTTAATACTTGAAGGCACCAGGTCCCAACTGAATGTTAGCAGGG
CTTTACCTTCCTAATTAGAGCCCTAAACCAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1175, 1364..1470, 1794..1932, 2366..2490, 2719..2848, 3309..3465, 3718..3801, 3902..4022, 4117..4432
1001..1175, 1364..1470, 1794..1932, 2366..2490, 2719..2848, 3309..3465, 3718..3801, 3902..4022, 4117..4344
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved