Canis_familiaris Locus mono:SNORA62
snOPY snoRNA Orthological Gene Database
Canis_familiaris mono:SNORA62
Canis_familiaris
mono:SNORA62
23
SNORA62
1001..1147
2147
ATTTTAGTTGTAATTAGTTGGAGAGAGAAGCTGCTTATACCCATTTTCCCTGGAATTAA
AAATATTTAGGCCGATGAATTTTAATATAACTGAGTGTAGTTTCAGATTCCACATAACAA
ACGAGTATTTAAGAAACTCTACCACTTGTCAAGTTTTAGTGTAGTACCAATAAAGAATAT
CCACAAATATCTGTGAAGACTCTTAAAAGTACTCTTCTTTTTCCAACTACATATCTGTGT
AACACCAAGTTTTCTTTTCAACCAGAACAGTATGTTGCGGTACATTAAAAGCAGAAACAG
AAGAGTCTATTAAGTCAGACATTAAAAAGATTCGCAAAAATATAAAATAACACCACTCTT
TTCACTGATATTTTTGTTTGGGAAATATTTTTTTTAAAGATTTTATTTATTTATACATGA
GAGACACAGAGAGAGGCAGAGAGAGAGAGGCAGAGACCGGGGAAGCAGGCTCCATGCAAG
GAGCTTGATATGGGACTCTATCCCAGGACTCCGGGATCACGGCCCAAGCCCGAAGCAGAC
GCTCAACCACTGAACCATCCAGGCGTTGCGTCTCAAGGAAACGAGAATTTTCATTAAAAT
GTTCTGTATTAAGATGCCTAGGTGGCTCAGCGGTTGAGCATCTGCCTTTGGCTCAGGGCA
TGATCCTGGAGTCCCAGGATCTAGTTGCATGTCATACTCCCTGCATGGAGTCTCTCATGA
ATAAATAAATAAAATCTTAAAAAAAAATGTTCTGTATTGGATTAAGTACCATATTTAGTT
GAATTTAAAAATAACATTTTCTCACTTTTAATTCCCAATGTGGTAAATTTTGATCGATGC
AATCAACATAAACAAAACCATTTTGAGTCTTCATTAATTTTAAGTATGTAAAGGGGTTTT
GAGACTAAATAGTTTAAGAATTGCTAATTTAGTAGGTAGTTGGTTTCCATGCATTTATAA
CTTTATACTCTCATTTTCTGGTCTTTACAAGGCAGCATGGTactacacattgttagaggt
tggagttgagggtactggctggctgatgaactcagtgtaggtattgtgctacatgagaga
caagactttaataccacaggagtctctggcccaatgagtggagtttgatggtaattcttg
ctacaagtATTTAAAGGGGGGGGGGCAACGTGGGAATCAAAAGTACATCAACTTGTACAG
TTATCATGATGAGCACTGAGTAATGTATAGAACTGTTGAATCACTATATTGTATACCTGA
AACTAATGTAACGCTATCTACTGGAATTAAAATTTTTTAAAAAGTGTATGAACCTTGAGG
AGGTCAAAAGAACATGCATTTGTCTTCCAGTTTCCACCACTTATTTTCTAAAGGTTAAAA
GCCATTTAACTTCTTTGTATCCTGTTTTGTAAAGTGAGGATTATACTTCAAAGGATTATT
GTAAGGGAAATGTTAGGTTAAATACCTGACTTATCTACATTCGATAAACATTCCTTGGTG
TAGAGTTACATATTTTTAACAACTCCCAACCTTTGTGAAAGGGTATAAAAACCTCTGATT
GTAAGCCAGTAGGTGTTCTCCAATTTAGTCTACTGATCCCTTTCTAATAATAAAGAATGA
TCATTTATTGCAGATCTCTAGAATAGTAAATTCTGTATTGTCTGTAGTGACATTGAAGTA
ATTGAGTTCTTTAATGTCAATTTAGTCCTATTCTTGTAACAACCAGATCAGGAAAGTCCA
GGAGTATGATCAGCAAATGTGTATATATAGGTCTAGTTTGGGAATGAGATTGGAGGTGAA
GTTGAAAAACAAAATGAGATCAGGAAATTAACCCAGGAAGAAAAGGCAAGCAGGATGTGA
GTACTATAAACAGTGACTGATGTCAGTTCCAGGGTCCATGATAATTTGTATTATCAGAGC
AAGGCAGGCAATCAGTGGGGATCAAAATAGGCAGTTGAGATTCTATCAAGGAAAGCCGAT
ACTTGATGTCAGGCAGGAATTGGACACTGGTTAGTAAAGGCTCCTGGGTTCAAGTGCCAT
GTATATGGACACAGACCAAAGGACAGGAACCCAGTTCCTGAAAGTAAGAGTAGGGGCCTA
GAAGATCCAAGTATAAATATCATGAATGTAGTTGGAAACATGGAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved