Canis_familiaris Locus ENSCAFG00000005101
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000005101
Canis_familiaris
ENSCAFG00000005101
23
SNORA62, SNORA62
3036..3185, 5608..5762
8019
AGACACAGGCAGAGGGAGAAGCAGGCTCCCAGCAGCGGGGAACCCCATGCGAGACTTGA
TCCCAGGACCCTGGGATCACGACCTGAGCAGAAGGCAGACGCTCAACCGCTGAGCCACCC
AGGCGCCCACGTTTTTGTTTTGTTGTTTTGAGAGAGAAAAAGAGAGAGAGAGAGAGACCC
CGAGAGACCCCTCCTGGGGCGCGGTGGGGGCGCGGCGGGAAAGGCGAGACCGCGAACCGT
AAGCTCCGTGCCGAGGGGGCTCCGTCTCACTCCGAGGACTCCGATCCTGACCTCAGCCAA
CATCAAGAACTGGCAGCTCAACCGACTTAAACTGTTTTTTTTGTTTTTTGTTTTTTTTTA
ATTGTAGTATAGTTGTCACGGGCTTCAATTCTTTAAAAATAATCTCCCTGGAGTCTTTTT
TGTATCCCAGAATATCTTTCGAATATTTTTCAGTGGCTGCATAGTACTACAGGAACAGAA
TAAATTTTTAAAAACGAACTTATTGATAGAGATTCCTCTTCTAAAAAATAAAATCTGCCA
TCTGTACAGTCTTTTTTTCCTTTTGATTGATTCAGGAAAATTTCCCATAATCAGATTTCA
AACTCTGGATGTATTCCTGAGCTGTTCTCCCAAGAAATGAAAATAATTCCTTCGGCTTTT
ACCGATGGAGTACTTGGGCACGGTGTGATCAAAACGTAAGGAACCTGCAGGCTCGGCCAG
GGAGCGGCACCGGGCACCGGAGCCAAGAGCTGCGCGGAGAGCCCAGGCCGCACCCCTCGC
CGCCGCGGCCGCGCTTTGCTGACGCAGGACTCCGTGGGCGGCCGCGCAGCGCGGAACCTC
TTCGCAGCGCCGGAAAGCGCCACCGCCGCAAAGCGCCACCGCCGCAAACGGCTCCGCGGG
ATTAGGGTGCTGAGCCGCCCTTCCGCTCGGCTTTTGTTGTCATTGGCTGCTGGCGGAGTA
TATAAGGACGTCACTTCCGCCCGCCGGTCCTTTCCGCGCTACCCAGGGAAGGGTCCATAC
GGCGTTGTTTTGCGTGAGTGTCTTGTAGAGTTCGTGGCGCCCCCAAAGCCACCAGGAGGG
CTTCCTGTTGGGAGTGCGGGGTGCGGGGGCCGGGAATGGAGGCCGGCGGGGACAGCGAGT
CTATCCCAGGCCCCGCGCGCTCTCCGCCTCCGCCCGGCCGCCCCGCACGTGGTCGGGCTC
GGGCCCGCAAATTCCCACAATGCCCTGGGAGGGCGCGGAGGTCGTGCTGGACCCGGGGTG
CCCGGTGCGGGGGTTGGGCGTGCGGACTCGTTTGCGCCGGTTGGCAGGGGTGCAGAAAGC
GTCGCCGCGCCGCGATCGGGGCGGGCCCCAGCACTCGGCCTTGCGCTCAGGCCCAGGCGC
CTATTTACAACGGCTCGGGCGGATTGGTTTATCCCTTTCTTGTTAAGGTTCTTGGCAAGG
TTTTAGAGAAAATTAGTTGTGATCATAGGATTTTGAAGCGCCCACCTGCAGTCTGCTTGA
AAAAAAACTTGTTCGCATTTCTGCTTCCTTTGCTCAATTTCTGCAGTTTGTTGAACATGA
CTCCTATCTTCGTACTTGGTTGACCTGGAGGGTTAAGTGGCAATTCACTTTTCGTTTTAT
TTGGGTGTTTTTCCCACTTGCACACTCGATGGTTTGCTGTAGTGTGTGGGGTACGTCTCT
TCTATTGTGTCATTACACTAGACTGTAAACTGAAAAGTATCCTTGGGTTGGATTCCAATA
GGAAGTTGTTTAGCTCTCAAGAGTAATTAGAATGCATCTGGTCCCTAAATCAGTGGAATG
AATATGGCTGGATTGTTAACTGCTTTTTCAGGTTCCCATCGTAACTTAAAGGGAAACTTT
AACAATGTCCGGAGCCCTTGATGTTCTGCAAATGAAGGAGGAGGATGTCCTCAAATTCCT
TGCAGCAGGAACCCACTTAGGTGGCACCAACCTTGACTTCCAAATGGAACAGTACATCTA
CAAAAGGAAAAGTGATGGTTAGTCTTTGCTTTGGTTTGGGGGGAAGGGCATTGCATTTAA
GTTACAAATGAAACCACATCCCTTCATTGGAAATAAGCTTTAAAACTAAGTAAAAGTGGG
GTGCGTTACTGGCTTAGTTTGTAGAGCATGCGACCAGTTCTCATAGCTGTGAGTTTGAGC
CCCATGCTGAAGGTAGAGATTACAGTTGTTTTTTTTTTTTTTTAAGATTTTATTTTTTTA
TTCATGAGAAACGCAGAGAGGCAGAGACACAGGGAGAGGGAGAAGCAGGCTCCATGCAGG
GAGCCAGATGTGGGACCCTAGGATCACACTCTGAGCTGAAGGTGGGAGCTAAACCACCCA
GCCACCCGGGCATCCCTACTTTTAAGAGATTTTAAAGATTAAAGTGTTCTGGTGGTTTTT
GGAAGGCTAGCTTTCCGGGTTCCAGTGGAAGAGTATGTCAAATGGTAGATTATGGGACGT
GGGTTGCTTCATGAGGAGCTGTGAGATACAAAGATGATGAGGAAGCTCACTAGCTTATCT
TGTATTGTGCATTTTATTTTGCAGGTACTGATACGTGTTCATTTGACTGAATTTTCTTTT
TTAAAGATTTTATTTATTCATGATAGACACAGACAGAGACATAGGCAGAGGGAGAAGCAG
GCTCCATGCAGGGAGCCTGATGTGGGACTCCATCCCAGGACCCCGGGATCACGCCCTGAG
CCGAAGGCAGATGCTCAAACGCTGAGCCACCCAGGGGTCTCGTCATGTGACTGAATTCTG
AGCATAAAACAGAGCAGGAGATAGGAACAAATAGGTTTGGAAGGCATGTGGGAAAGGCAG
TGAGTGCTTCAGCTCAAAGATGGAGCCACTGAAGGACATAAGCCTGGGAGTGGCACATTG
TAAAGCAGTTTCAGGCGAATCTGTCATGGAGACAGGTGAAAAGGAAAGTGGCGAGAGGCC
AAGAAGTGGCTAAGAACTTGAAGGAATCCACATGGGGGCCTGATGGAGGGAGGCTTAGTG
CAGGAAGAGAGATGTGCTTCGCCTGCTGAATCAGGGGCTGCACACTATTAAAGCTCAAGG
TTGAGGCCACCGTGGCCAATGAACTTCTGAGTGTCGGAAGTGTGCTATATAAACAGCAGG
GTTTTCGCTAACACCAGTAGAGCTTGTCTCTATGACTGGAGTTTGATAGTACTCACTGCT
ACATTGTTTTTGAGAAGAAAATCCATTGCAAGTTACGTGAGGTGTTAAAAAGCTCTCTGC
CATCATAGGTATCTACATCATAAATCTGAAGAGAACCTGGGAGAAGCTTCTGTTGGCAGC
TCGTGCCATTGTTGCCATTGAAAACCCAGCTGATGTCAGTGTTATATCATCTAGGAATAC
TGGCCAGGTTTGTAAATAATATGCTCTTTATAAAAAATATGCTTACAGACCTTGGTGTAA
GGAAAAGTAAGAAAAAGTATTTTACTACTTGGAAATCTTGAATTGCTAGTATTTGAGGTC
TTTAACGTATACAATTTGGCATCTGGTGGTGTGTTGAGCTTCAGTTTTCATATCCTTGTA
TTTTCGTGCACCACCAAGTAGAGTTGATCTTGTTAAAAATGGTTTATCAGAATGTTCTGT
AGTCCGTTTTTTCTTTTTAAAATGATGAAATAGTCAAAATTTGGGTGTCCATTCCAATTT
TTTTAAGATTTATTTCTTCATGAGAGAGAAGCAGAGGGGAGAAACAGGCTCGGCTCCCCT
GTGGGGAGCCCAATGCAGGTCTCATTCCTAGGACTCTAGGATCAGGACCTGAACCAAAGG
TAGATGCTCAACCATTGAGCCACCCAGATGTTTCTCAACTGCAAAATTTTTAAGAACGGT
TTTTTTTTTTTTTTTTTTAAGTTTTTATTTATGTGTTCATTAGAGACACAGAAGGAGAAG
CAGCCTCCATGCAGGGAGCCCGATAAGGGACTCAATCCCGGGACTCTGGGATCACATCCC
GAGCCAAAGGCAGGCGCTCAACTGCTGAGCCACACAGGAGTCCCAAGAAAGCTTTTCTAA
TAGGGTACCACTCCCTTTCTAAGGCTCAATTCTCCTAAGAGTAAGAATCTTTGCCAACAC
AAAAGAAAACTTAATTTCTTTAAATGGCCAGTGGGATAAAACTTCTGTTTTGCCCCTTTT
CTCTTTTGACAATTCTTTTTCTGTTGAGAAAATTTAACAGTTAATAGCCTATTGTTGACC
TTTAGCAGCCTCACCAGTAAGCTAAGCAGTCGATTAACACCTTTTGTTAACACATACTAT
ATACTATATTTTAAGCTGTAGAAAGGAAAATACACCGTACTGTAAAATATGTCCTTAATG
AGTGGATCTCCATGGTTTAAAGCTAATGGTGGTGTTCAAGAGTCCACTATATATAAAAGC
TCGAGCAAGGATTTCGCTGAGCCCATTTATTTCTAATTTGAAAAAGATGTTTAGCTTGCA
TTTTGACAGGCATTTAAATTGTATAGTGAGACAGGTTCTCTTGTACTTGAAGGTTGATGG
TAAAACTGGTTCCCATGAGTTTAAGATTGTTTTCCAGGGGGTTATTCCCCAGGAGCTGGC
TTGCGACAGGACTTAGAGTTCAGTGCATGGTAGAAGACTGTTTAGAACGAAAATTAGTGC
CCACTCTCAATTTCCCTCAGCAGAAATTTACTGAGTGTTTATATTAAGTCTAGTGTTGCT
AGGGGCTTGAGATACAGCAAGAAAACACCAAGTCTGCCTTTTTTGAAGGGATGCAGGAAA
CCAGTTTTATAAAGGGAAAGAGCGTATATTCCTGCTTTATTAAAATAGGGTAGCTGGGAT
GAAATTAAACCAGAACGTGGAAGTGCTTATTGCTGTCGGGCATTGTTGTACTGTCTGTGT
TGGTAAATTTAACTTTCATGATCCCATGAGGAAGTTAGAAGCACATAAATAACCTACCAC
ATTCACTCCAGGAGTGAATTAGTTGGTTCTTGAAACCAGGCGGTGTGGCCCTGGAGCCTC
CAGATGTGAGGAAGCCAGTGAGCTGCAGGTGATCTAAGGGATGTGGGAGTGGGTAGGGCA
TTCCAGACAGACGGCCTGGAGGTGGGGTGTACTTAGCATTTCTGGGCCCTGGTCTATAAG
TATTTCTCAGGTAGCATAGAGGACAAAGAATTGTGGGTGTGAAGTGCTTTGATGTTTTCA
TTGTTGAGGGGATAGTAGAAGGGCTCCAGCTCCATGGGCTGCTTTGGGGCTGTAGAACTG
AGTGTCTGCACATGGACATTTGGGGAGGTCCTGGGATGCCATCCCCGGAGCACTGCTAAC
TCTTGATATTAATTCTTCAAGCGAGCTGTGCTGAAATTTGCTGCCGCTACTGGAGCCACT
CCTATTGCTGGCCGCTTCACTCCTGGAACCTTCACTAACCAGATCCAGGCAGCCTTCCGA
GAGCCAAGGCTTCTGGTGGTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGAGGCA
TCTTACGTTAACCTGCCTACCATTGCTCTGTGTAACACAGACTCTCCTCTGCGCTACGTG
GACATTGCCATCCCTTGCAACAACAAGGTAACGGCATTATGACACTAGAGCCTCAATAGT
GAGTACTCTTGAAACAGTTGGGCATTCCTCTGCACATTGTTAGAGCTTGGAGTTGAGGCC
ACTGGCTGGCCGATGAACTCACAAGTGTAGGTAGTGTGCTACATGAGGGGCAAGTCTTTT
CGCTAACACCACAAGGGTCTCTGGCCCAATGAGTGGAGTTTGATAGTAATTCTTGCTACA
AGTAGAATTCAGATATGTCAGAGCTTTAAGGAGAACCCGTTTTTTAGATGGTCTGTGTTT
TCTGTTTTTCTCCATATTTCTTAACTATTTGGGCGACTCAGGCATTACTGGGCTTTTTCG
GTTTTCAGAGCAACTTGATGAATCGTGCAATGAGGTCCTTAAAAGGTGGGTTGCATATGG
TTCAAATTGGTCCAGTGTATTGGTCTCAAAACCTTGGTTCCATGTAAGAATCACCTAGAG
ATGTTTTAATACCAGGGTCCAGGCACTCTTTAGGTATTTTGTTTCATTGGGGGCGGGGGG
TTCTTGACAGTTGTGTTTTTGTATTTTAATTCCCATGGGTCCAGTGGAGACCCACTAATT
ATAGAGTACTCCTTGTTAAAAATAAGTGCTTAAAGTGGGAAATGTGTCTATTTTCTTGGT
ACCAGGGATCTAGATGATGGGACAGAAAAGTGGAATTGGGAGGTGGCTAGGTGTCCCTTC
TTAACCTGGCGCTCTTGCAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTAGCCC
GGGAAGTCCTGCGCATGCGTGGCACCATTTCCCGTGAGCACCCATGGGAAGTCATGCCTG
ATCTCTACTTCTACAGAGATCCTGAAGAGGTAAGCTTCCTCCGCAAAGGCCTGTGGTTAC
ATAGCAAATCAGACATCTTGGTTTATGCTTCTTTGAAATAAAATTTGTCCCAATAAACTT
TTTTTCCTTAACCAGATTGAAAAGGAAGAACAGGCTGCTGCTGAAAAGGCTGTAACTAAG
GAGGAATTTCAGGGTGAATGGACGGCTCCAGCTCCTGAGTTCACTGCTACTCAGCCTGAA
GTTGCAGACTGGTCTGAAGGCGTGCAGGTGCCCTCTGTGCCTATTCAGCAGTTCCCTACT
GGTATGTATTGTGATAGATCAGGCTAGTCACTTGGATTTTTGGTAATTCTCTAACTTACA
AGATCTCCATGGCTGTATATACTAGTATTGAAAGGTTTTTATGCCAGTGCGGTATAGCTG
TGCTGATAACTTGACAGATTGAATTTGGGTGCTTTTGAAGTGGTCTGGCCTTGCGTGTTT
GTCCTTTGAAATGTGTATTTGGTGGAATTCACAGCACAGTGCTGGTGGCAGTGGGGCTGA
CTGTTTTTTGGTGTTTTCTTAACAGAAGACTGGAGCGCTCAGCCAGCCACTGAAGATTGG
TCTGCAGCTCCCACTGCTCAGGCCACTGAATGGGTAGGAACAACCACTGAGTGGTCTTAA
GCTGCTCTTCCACAGAAGGAACAGAATGGAAATAAGGTTGACGGAAAATAAACAGTTTCT
AAAAGTCTTGTCCATTTCCGCGTTTCATTTACAGATCAAGATGCCTGGGATTACTTCAAG
TCTTGACTTCAGTTTTACTTCTCTAAAGCCTGCTTTAGATAAAACATAGTGCTTCTTGGG
AGTTTCCTTTTAAGTGCCAACTCTTGATTTCAGCTCAGGTCATGATCTCAGGGTTGTGGG
ATCAAGCCCATCATTGGGCTCTATGCTGGACATGGAGCCTGCTTGAGATTGTCCCCACCC
ACTACTCTTGTGTACACTCCAAAAAAATGGGATAATTGTAAATATTATAGTGGTGCCCTT
GGAGTTTTTTTTCTAAGGTCAGACCTGATAATTCTTTTACTAATGTCTGCACTGGCAAAT
TCTGTAGGGCCAGAGTAGAGTAAATTGGCTTTTAGTGATAGCCCTGCTGTATGCCAGTTG
TGTGGCCACTTCCTTTTTTTTTTTTTTTTTTAAGGGCCAAATTACCATTTGTTTTATTTT
TTTATTTCTTTTTTAATAATGAATTTATTTTTTATTGGTGGTCAATTTACCAACATACAG
AATAACACCCAGTGCTCATCCCGTCAAGTGCCCCCCTCAGTGCCTGTCACCCATTCACCC
CCACCCCCTGCCCTCCTCCCCTTCTACCACCCCTGGTTCATTTCCCAGAGTTAGGAGTCT
TTATGTTCTGTCCCTTTCTGATTGTGTGGCCACTTCTTGAGTGGCCTCTATATTTGAATA
CCAGCCTAGGTTAAAGGTAGAGTAGGAACCACTGGAGGGGCCCCAGCCTGTTACCAGGTC
AGCTTGCCTTCAGGTTCTGGGAGGGTTGTACAGGTGTGTGTACAAAAATGTCCTGTTGTG
CTCTCCATATCTGTTCTGTGTTTTCGATTCTATTTAATATGCTTAACAGCTCTCCTGAAG
TCCTAGTAACATTTGACCCATTAAAAATTAGAGAAATAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1831..1996, 3248..3366, 5301..5546, 6260..6388, 6495..6660, 6925..7019
1864..1996, 3248..3366, 5301..5546, 6260..6388, 6495..6660, 6925..7016
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved