Canis_familiaris Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Canis_familiaris EIF4A2
Canis_familiaris
EIF4A2
34
SNORA63, SNORA4
4587..4718, 4898..5039
8189
AAAGCCTTTTGGGGGAAAAAAGAAAAGAGCAACATAGACCCGAATCAAAAAAAAAAAAA
AAATCTATCTAGTCCCAAAGGGGGCACGGAGCTCTATCTGCCGGAAGCGTCCATTTAAAT
TCCTACGTTGTAAGGAAAACCAGTCCTTAGCTGTTAACCATTTGCAAAAGTTCAGGATGA
TTTTGTCGGGCATTCATTCCCCACGCGTTAGGGCGGTCAGCGTTATTTTTTAAGAGCGAG
CGAGCGAGAGGAGACCGGGGGCAACCTGAGAGCAGCGTCGGCTGCCGCGGGGACCCCTGC
AAAGGGCACTGCACGCTTTTGCCTCGCTTGGCACAGTGCCCTGCGGTGCGCCGGGGGCAC
CGGGCTTCGGGGACCTGCTCGGAGGCCGACATTTTCCCGAGCAGGAAGTTTTCACACTTT
TAGGCTCTGGATGGGTGTTAAGCGCCCCGCCGAAGGCCAGGCGGCTCTTCCCCGGAGAAT
TAAGCCGCGGGGGGAGCCGGCGGGGCAGCCCCAGGTGCCCCCGTGCAGCGCGAGGCCGCG
CCCCCGTCCCCGTCCCCGCCGCCGCCGCCGCCCCCACCCCCGGGCGCCGGACCGCAAGCT
CGCCCCGCCGCCCGCGGGGAGAGGCCGGCCGCCGCGCACGCAGCCGCCCCGGGCTTCCGC
CTCCCGGCCGCTCGCTCCCCCGGCCGCCTCTGCTTCGGGGCCGCGGAAACCCCGTAGGAG
CGGGGCGGGCCGGGAGCGCGGTTTGGCCACCGCTTGCTGCAATATTCTTCCGCCGCGAGG
CAAAGAGTCCCAGCCGCCCCCAAGGCCCCGGCATGTCCCGCGGCCCCGTAATATCGAGAA
ATAACCAAATTTGGGTTTTCCCACCCACTTGCTTGGGCTATTCTCCGAGGTAAGGACCCC
AGGATCACAATTTGGTGGGCGACCGGAGAGCGACGAGAAAATTCCTCCGCGAGAAAACGG
GTTCCGGCCGCGAGCCTATAAAAAACGGGTGGCGCGGCGCCGCTGTCTTTCCAGTCGGGC
GCTGAGTGGCTCTTCGGATCATGTCTGGTGGCTCCGCGGACTATAACAGGTACGGCGCTG
CCGCGGGGCCGGGGGTCGCGGCGGGTCGTGGCGGGTCGTGCGACGCCGGCGGAGGTGCTG
GCGGTCGGCGAGCAGCCTGGGGGCTGCGGGTTCGCGGGCGTTTCCTGGAGGCTCAGCGCC
TCTCTGCCCTTCGAGAAGCTTCCATGATGGGTAGGGCCTGGCCTGCGGGGAGACGAGGGT
ACAAAAACGGACTGGTTGGAGGGGCTTTTTTTTCCCCCCGTCCCCTCCCGAAGACGCCCT
GGCATCCCGGGCGCGTCCCCCGCCCGCCGGCGCACGTTTTAGTTGAGCGGTGGCGCAGTC
CGCAGTCGACACCGTGTAGCGGGGGGGGAGCTCTACCGGCGGCGGAAGGCGCGAGTTGCA
GGCTCGGCTTTGGGCGGGGGGAGGGGACGGCGGCGCCCGCCCGCTCGCCGGCCGCGGCCT
TGCGGGCGGATGGGGCCGCGCCGGCAACCGGGTCCCCGCGAACCGTTGGCACCGCTCTCG
CCGGGCCGCGGCCCGCGTCAATCACCGCGGCTTGCGCAGTGTGAGGGGCGGAGCTCAGCG
CGTGGAGCTCTCGCGAGACCGGCTGGCGCCGAGACGGGAGCGCCTGGCGCTCGGGCTGGG
GGAAGGGCCGGCGGCCGTGGGCCTTTCCTGGGCGTCCCCTGTGGTCGGCCTTGGGGCGGG
CGCGCACGGAACGTGACGGGCGCTGCGCCGCCGGCTCCCCGGACTGCAGGCGCGGGTGGT
GCGCACGTGTGGGGAGAGTGGCCGGCCTAGCCTAGGCCGTCCCCGGGCCGTGCAGGTAAG
AGGGCTGGGGAGAGGGACGTTCTCTAACTGCGGTGTTCTTGTCGGCAGAGAACATGGAGG
CCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGACCTCTGTGTTGGATTCTGGA
ACGTGGGCAAGGTGAGGTGTTCATCCGACTTACTCAGGCGTCCTTTTGTGTGTGATTTAC
AGAGCAACTGGAATGAGATTGTTGATAACTTTGACGATATGAATTTAAAGGAGTCTCTTC
TTCGGGGCATCTATGCTTACGGTTTTGAGAAGCCTTCAGCTATTCAACAGAGAGCTATTA
TTCCTTGTATTAAAGGTAAACGAGCTAGCTAGCCCTTTTTGAAACATGCATTAACTGTTC
TACATAACTGACCTGGACCATAAAAGGGAAAGTAACTTCTGGGGGAATAGCACCTGTTTG
TATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGAAT
ACTCATTGCTGATCACTTGATTATTTGGGCATAATTAATGTTCCAAACGGAATACATGGT
GTGAACTAGAAGTGGCGGTTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGG
GTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTC
CATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCAC
CAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGCA
TAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAACTTAGTATAAATTGGTCCTATCGA
TAGGAGCCCTCCTAATTGTCCATGCATGCAGGGAGTTTTTGTTGAGTTAAAAATAGGAAC
TGGGTGTGCAGGTATGGTTTGCAGGGTTGTGTAACAGATTTGAGAAACCAAAGTGTTTTC
AGGGTGGACTACATCTGTTCCCATTTTTAAGTTTGAATGCAGTTGTGCAACATGAAAACT
GCAGTGACATGTTATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTT
TTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAGACCTTGCTAATAAAACTAGGTTTTA
TTAAGGTCGAAAGGACGTAAGCTCCAGTACTTTGGGAAAGACTAAAGTTACCAACAAGTT
GTCCCTAGATGTGCTTACTTACAGAGTTTGTTCCATTATTTACACCTTCCTACACAATGA
AAAGCAATGTAGGAAATGATGTAACTAAAATCATTTAATTAACTTAGGTGGTATCTGGGG
TAACAGGATCCCAAGTTTGACAAGGCACAAGGAAGACACGTTAAGGGACTTTTGTCATGA
AACAGATCAGTCTGCATTTTAAGCTTGGAAGTAGTTAAGTGCTGTGCATGCATAGAAGCT
ATTTGCAGACCAGTTATTTGCTGTTATGCTTTGGAAGTTTAGTCACAGCCTGTAATTCTG
CTGTGTAATAATAAAGGGTTTTGGCTTTTAGATCCAAAAGGTAATTCTGGCACTTGGAGA
CTATATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGGAATGAAATGCA
AAAACTGCAGGCTGAAGCACCACACATTGTTGTTGGTACACCAGGGAGAGTATTTGATAT
GTTAAACAGAAGATATCTTTGTAAGTATTGCTGTCTCTGGAGTATAGTTTATTTTAAATT
AAAAGTTTGAATAGTATCCCTGTGGATTTAGAGCTGATAGTATGTTTGGCTTTCTTGGTC
AGCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGG
GTTTAAGGATCAAATCTATGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTGAGCTT
TCGTTTTTACTCTTTCATATAGTAGCTGGGGGCTTAGGTTTAATGGAAGTTAAAGTACAA
CTGAAGTCTTTGTCCCGCTCCCTTCTTAAAGCTATTGGCACATAACTATGACACTTGGTT
ATAGTTTTACTGTGAAAGTTGGCTATTTGTGTGACAAGATAATCATTGTCTTTTTAAGGT
TGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAG
AGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTT
TTATATTAATGTTGAAAGAGAGGTAATTTGTCTAATTACTATTAAATTTTGGTTTTTTAT
TTAACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGAAACTAGGATTGCCTTAGTTTTT
GTAATAATGCTAGCAGAGTACACACAAGAAGAAAAGTAACTGCACTGGATTGTAGAGACT
GGGGTGGACCTCTTTCTTAATGTCCAGTGTCCTTTGTCTTAAGATTTGGTGCAATATGTT
TTAGAATGGCCTAACAATGAATTCTAATGAACATGAATTGGAGACTAGATTTTAATGACT
GTTAACTTTGAAAAATTGTAGGAATGGAAGTTGGATACTCTTTGTGACTTGTACGAGACA
CTGACGATTACTCAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACT
GAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCCCTGGTAAGAGGTGTCCTAGTAGTG
ATAATTATGCTCCCCGACCCCCCATTAAAGCAGGATTTAGACTACAATATAGCTGTTAAG
TGCTGTGTTGTCGTTCCCCCTGCTCAAAATAAAGCTGTTTCTTAACTATACCTGTCTGCT
ATACCCCTGTAGCAGCCAGGGACGCTTGGTCTCATACATGTCAGTAAAATTAAATAATTG
ATTTGACTGGTGATTCTTGAATTAAGGTTTGTTGATTTGCAGCATGGTGACATGGACCAG
AAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTTTGATCACT
ACTGACTTGTTGGTAAGTCTCTTGCTGATCTTTTTAATCTACCAAAAGTTTGTTTTGGGG
GGAAGGTTTTTTAATAACCTTTACCAGATTGGGCTGTTTGGGAGATTAAAGAAAAGACCA
CACTCCACAGTGGGCTATATCACTTAACGTATAGTTCACTACTATTTTGTGGCCTACATT
ATGTATCTGTGTACAGTTTTAAATTAGAATTTGAACATATACCATTGTATTGCAGGCTCG
TGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGA
AAACTATATTCACAGGTGAGTAGGTGGCATCTTGTTACTATATCGGTGAAATAAATTCAT
GTGTGACTTTTCTACAGACTGATTTGTTTGAAAGGCAACTTCATTATCAGGGAAGTAAAG
ACGTAGTAACTTGGTTAAGATGTCAACTAAATTTGTATTTGGGAAGATTGGTCATCTGCA
GTGGGAAAACAGTCGTAAATGTTGCCCAAACTGTGGATCAGGTTGTTTAGATTTGTTGGT
CTCAGCTTATTTTTGAGTTTTTAGTGATCTCGTGTCCATGTGCTTTCTTGGTGATTGTAG
TTGGGATTTTCTTGGTGTTGTCTGGTAGCAATTTGAGCAGTCCCTGGTTTTTAGTTATAG
TGGCTTTATCCCTAAGTAAATTGAACTGTACTTTGTTATATGATGTAAAAAAAGACTTTT
TAAAAAATACAGGAGTCGATAGCAGCAGTTGATGACGAGATGGCGCTCAGAAACGGCGTT
GACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAG
TCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTGATATTTTTAAGTTGCTCCAG
CCAAGGCATTTTGTATGTTAGTTTTATTAGGTGGTTTGTGTTGTCTGGTTTCCATGAGGA
AGGTAGAAAGCTGCTTTGGAGGTAAACACGTTTGAGTAATTTGAGTTACAACGTGTAAAA
CTGAGCAAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTCGTTTTCCCACTGG
AAAGTTGTAAGTTTTAGACAATAGTTAACCTTGCAGCATTTGTATTTACAGTTTACAGTT
CCAGATGTGCGTCGAAATGTATTACATAACTGTTCTTCTTGTTTTATTCCTGGTGTTTAC
ATCTGTCCCAGGCTGACCTCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCA
CTACCCCAAACACAATACTGTCATCTGCTTTAAAAGTAATGCTCAAGACACCGGATAAAA
TCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAAAGGAAGATTT
TTTTCTCTAGATATTGATTAGCAGCTAGTGCGCTCCAGTTAGAAGCACGAACTGTAACCT
TATTAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCATCATGTTCAGTAGTTCCCATT
GGAGAAGTAACATTCTAATTGCTATGTTTCTTTCTCTACACAGAATTGGCAGAGGGGGTC
GATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTC
GTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCAATGAATGTGGCTGACC
TTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCG
ATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCAT
AACGGATCAGAAATACAGATTTTGATAGCAAAGCGACTTTAGTCGTGAGCTCTTGTGAGG
AAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTGTAAAAGATGGG
GTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATT
AGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAA
ATCAGCCAATTATGTTAAACTAGCATACCTGCCTTTATTGTGTTTGTCATTAGCCTGAAT
AGAAAGGCCTTTAAAATTGATTTTTTTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGG
TATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCT
AAGCCCCAGCAAGCAATCATATCTTAGATAGGGTTAAACTCCCAGTAAAATTGCCATATT
GCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGGTGCTT
TGGTGATTTTTATTTAAAAAAAAAAAAAACAAGTATCCTACAAAATTTTAACAATTCTGT
GTTAATTGCTGCATCACTGTAGCACAGAGGCTGATCAGTTGTAGATGTTCATCAGCACCA
TCTGCTAAGCATTTATCTGCTTCCTACAAGAAAACCAGAAGTTAATAAAGTTTGCCCTTG
GAGTTCTATTAAACATTGTGCTGAAATGTGCAAAAATGCCTACTTACAGCAAGTTTTTCT
GTGATGATGGATTTCTGTTTATCAGAAAGATTATCGTTCTCTACAACCACATCATGAAAT
TGACTTACAAGCTGAGTTGCTGCATGACCCTCATCTATTAAGTCCTGTAACAGAAAGTTG
TATTTGGTATGATCATTTAAGTTTCCCTTACCTGGAAGTGAGCAGTAAAGGGACTTACCT
TTACCACAGCTTCCAGTTTGTCAAAAGAGCCACTCTGACATGCAGCAAATATTCCATCAA
TAGTCCCAGCTGGTATTACCTAGAAAGTTGTTTAAAGATAAGCCTTTATCTCCAGCCTGG
GTAGAGTTCACTGTGTAAAGCTGTTTCTGTAACACTAAATCGACACCCTTGGAAAGGCAA
AGGAAGAGAACTTGGGGAAGAGCCTTATACTCCTCTACCATGAGCTCAAGAAAGCTAACC
TTCTACCCTGCCTAGGACCATCTTTATTTTTTTTTTTTTAATTTATTTTTATTTATTTAT
GATAGTCACACAGAGAGAGAGAGAGAGGCAGAGACATAGGCAGAGGGAGAAGCAGGCTCC
ATGCACCGGAGCCCGATGTGGGATTCGATCCTGGGTCTCCAGGATCACGCCCTGGGCCAA
AGGCAGGCGCTAAACCGCTGCGCCACCCAGGGATCCCTGCCTAGGACCATCTTTAAATTA
GATCAGTCACTATTCTGTAACCAGGGTGGTCTTTTCTTTGCTTCTAATAGTTTCTGGTTT
GGGTGCATGATGGAACAAGAATAGCTGATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1908..1953, 2042..2174, 2459..2598, 3391..3559, 3662..3771, 3958..4101, 4401..4538, 4782..4871, 5095..5174, 6403..7189
1040..1068, 1908..1953, 2042..2174, 2459..2598, 3391..3559, 3662..3771, 3958..4101, 4401..4538, 4782..4871, 5095..5174, 6403..6544
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved