Canis_familiaris Locus EIF4G1
snOPY snoRNA Orthological Gene Database
Canis_familiaris EIF4G1
Canis_familiaris
EIF4G1
34
SNORD66
9952..10027
17150
gcccgccagggcccgatccctggcccacgtgtgcccggcctggcccggcctggctgctg
ggtgggggtgggggagcgcggggccggaatgtgcggtccccgcgggctgctggggcgccg
ggttcgccggccgcgaggtgccaccccggcctgacccgagggggccccgcgggcgcaggc
accgcggctcccggcccaccgccccctcccccctttgcggcccggccgccgggaagtgac
acgttgttctttggcactggccggcgctgcgcagggagggcgcaggggagggaggcggca
gcggcgggcagggaggagcccccggccccgcccgccctccgggccgaccctcgcttgcta
ggaaccggcttctcttcggccgccgcccgcctggccttttagggcccgactcccgccctt
cctggcctccagtcctgggcggcggcaggcctcgcgaccggccccgtgcgggcgcccccg
cggccacccgcagcaggcgtgccttgtgtgcccccgggcctggccccgaacccggtgtcc
ccaggtggggggtggggacaccacggccgaagctgctagctccgtttgtgatccgggagc
ctggtgccagcgagacctggaatttccggtctggttggtcttgggccccgcggagccagg
ttgatacccctcacctcccaaccccaggccctcggatgcccagaacctgtaggccgcacc
gtggacttattcttaaccgagggggtgagtgagggggctgtttgagcagaccaggggggt
ggttggaggtgatgcgggtttgacaacgtgttggtggggacgtaagctggatcttttctg
ctccttcaccccggtcgcacctccgggactcggtgtgggacccagcccttggttcaaccc
ttcccccactccgcttgccttcagcttgggtcccttcccctttccgagctccactctttc
ccaacaggtgctggggggaccctgatgtggcaccaaatgaaATGAACAAAGCTCCACAGC
CCACAGGCCCCCCACCTGCCCCATCCCCTGGACTCCCACAggtaattagggaggaattag
cagagactggggtgggggtgggggagatcaggcagctggtcaggaacaggttccaacctc
tggattttcccacccccatctgtgtcagggcaaagtgcagcttcctgctgccaaattgag
acagggcccctgggctgttcccaggggctgtcatggggaagagggggcatgtggactgct
gaagctcttgccacaggtctgctccccttactttaccagcttaggaaactgccccacccg
ggttcccctctgctgaaactctggtctcccccttcAGCGTGCGTTCCCCCGGGGCAGACA
GCACCGGTGGTGTTCAGTACGCCACAAGCGACACAAATGAACACGCCTTCTCAGCCCCGC
CAGgtgaggggctctggggaggggagtagggggcctgggtgggagccatggaaaggttag
gccagttcgggccgaggatggaaactgtggaggccctgtacctgccccaatttcctgaca
gttgctctgtgttctttcatgcggctctgcactttgtgctgttgattacttacggtggct
ggccccttggggagtatgtagtcggtgggggtggcattactaggggtcctggtgccttga
gaattgggagcagcgcttcgggccctgctgccaactcctgttcctatttcctccttttcc
tgggaggttgtgattgctccgctccgctccccttcccttctttctctttggactgtggcg
agataaacactccatctggttcttgcctttctctgttccctaaattcttcctcactaagt
ggggacattcttgtcctacttccttcattgttttctctctcatcaccttggggataattc
tcttctctcctgtccccatgtgctctcagGGAGGATTCAGGTCTCTGCAGgtaatacccc
tttgctaattctggaccctctcacggtctcacccttcacctctaccctagtcaagggcta
gacacagggactggggggtcttcagggtggggacatgtttgctgttaaggttctcagtct
gacactgactgatgcatgctagaggctagatcttgcagattgcaaatctgggaactggga
gactgttgcatgttagtggttagctcctctgtaccttagggtggagcaatgcatgctggg
gagtatgttgctcaaaagggctttacttgggcatgatgcatctgggtgttaggaagcctt
tgcagaggggtagcctggtagaggtgacatgagtattcacggtagtgagggagtaaatat
tcgtggagtgcaaagcgcatacctcagtgtggagggtatgtgtgagtacaagaggccacc
taaccatcagtttggttaagtgggtgaggattggcccccgtgctccaaagcccccagtat
ttttctccagactagagacatggcggagtggccattttggatgtccacttcctccctttc
ccaacgccaactgccttcctccctcttgacagCACTTCTACCCTAGCCGGGCCCAGCCCC
CGAGCAGTGCAGCCACCCGAGTGCAGAGTGCAGCCCCCGCCCGCCCTGGCCCAGCTGCCC
ATGTCTACCCTGCTGGATCCCAAGTAATGATGATCCCTTCCCAGATCTCCTACTCAGCCT
CCCAAGGGGCCTACTACATCCCTGGACAGgtgaggttggaggcttgggggctggaagcca
tggaacctttaaacctcaatcctcctctccctttaccctgatcctccagtcccatctctt
ctccagaggtgggacttcttctggtcattgcccacagttggcttgtcctgtcttgctctg
cattctctttggcctgatagggtactcatagctccctcaactcctctcccctcctcttcc
cccttccccaccagGGGCGTTCCACATATGTTGTCCCGACACAGCAGTATCCTGTACAGC
CAGGAGCCCCAGGCTTCTATCCGAGTGCAAGCCCTACAGAGTTTGGGACTTACGgtaagc
aggggaaggagtcaggtgagagtgagtcccagggagcacctaaactcacctacaaattcc
tagatccttcctagccttatttcttgatctaaaaatgatagggttagtaggtagtagaga
ttggtgcttaatatataactggtgttgggtgcgtagggggggtggagcagggagcatttt
atcctattgatgagagttggaattccttgccatgccaaagaatataggatcagatacaag
tttgaggggcctgttaataaacattcccagtgacacttgttccgtggttggtgggagccc
atgtaacgtgaatttgggaagtttttgtagctgtttttcatttatattctaggaaaggat
tagtctgttctttatggcagtggtttccaaaattttttgatcatctatcaggaaaaattt
tgagtatgtacctctaatacatgtatgtttttgtttgtttatacatatgcatcatttaaa
caacacaatgttccttgtcaaaaacaagtggagattatggatgagattaaagaacacatc
ccattttggagaccattgctttaaggaattaatttttccacatcctgggcctggttcata
atgttactctttgtttccttgccccttagcaaagggctggagactggaactggactcagg
ttgagtggaacagggttggcaaatctgtttttctcattcccagccaaagacctgattctg
tttcaggttaagtagttactgctccctcagaatacatgtgtgtgtgttgctgggggtggg
gtggggggcatacataataccttctagggtagaagagaaacagaagtcctgctagtggta
gctggtatgtggtggagaaggagtgcctgcctacaaggtgtgtgtatggcagtgtcagga
attcttgtaaacgcagttcagactggttccccagctttgatagacacctaaatcccttgg
ggaggcgggtggggcagggcaaggggccgactgtgggtgatgagaggttctgagatggga
ggtgtgaggtattcaagcaggcatttgtatatggttgggccctgacgctgccaccattct
tcatttctgtgtctgtccccctgcccctcaagCTGGCGCCTACTACCCAGCCCAGGGTGT
GCAGCAGTTTCCCACTGGTGTGGCCCCCGCCTCAGTTTTGATGAACCAGCCACCCCAGAT
TGCTCCCAAGAGGGAGCGGAAGACCgtgagtaacagcaaggggctctgggacatctggga
aagggagaatcaaggtcaagcgcattgtgggtcagggagcagaaagttgaggaaggagag
cttcagctgggagtggttagagaatggaggtttgtgaagcgctcagattctttgtaaggt
actaagacttcagtgtagaagtagctcatgggaagactgaggaggctagtgctgcaggag
ttcctgagagacccaggttctgggggtccataagatctgtgcttggttttgggtttctgg
tggcttgtcttggaaatggtttgttttctgtggccccaccccccacctcccagtcctgga
agctcttgaggcctccgcctctgctcaatcctcaagccctgggcgtggtgcccagaatag
ggtgccagggctggggaagccgctgagtcaccctggctccacccactggatctgggccct
gcccccagagatcaggccgactagccacaagtgagctgcttgggtgctagatgggggtcc
tgggccccatggtgtgcagccagtgacttggggactgctggtggcgcagggctgagggag
ggaggggcattgtgatgtacaggactgctctgtgaggtcaagagtctcttaggggtgggg
gccaaggtagggagtacaagattagctagatgggttaacagtagaactcatggggtttct
ggcacccacccacctgctacccagtggggggtggggggttggcctagagtcttaggagtg
gggcagggtggagaggtgggctcctcctggttttccactcatcccggagctttctttccc
cagATCCGAATTCGAGATCCAAACCAAGGAGGGAAGGATATCACGGAGGAGATCATGTCT
GGGGCCCGCACCGCCTCCACACCCACCCCTCCCCAGgtattgtctgatctttgagcgagg
ctcttgcctaggatggctgttctgacctgagttcccacgttctttgatcttctctttcaa
tgaaaggatttatttccctgttttccgtggatttttaggcagagtgaaagtagaaatggc
tctaatagagaagggttgtgggcctcttcagggcaaactttggtaaccctttgtgtcctg
cagACGGGAGGTGGTCTGGAGCCTCAAGCTAATGGGGAGACACCCCAGGTTGCTGTTGTT
GTCCGGCCAGgtaggtaagcaggtggggcagagcttttatggggaaaaggagtgtgacta
tttcaaatgctaaggaggtagagtaacttgacctgggtgccagagaagaatgacttgggt
tttaggtagtgggattttgcaagtgggccagatttggggtgagaaggggaaaggccttag
gtaggagaatgttgcaggggtattaggctgggaatgtcttggctggcaggaggaggaaaa
aagtagtgacctgcctttaatgatttgtctttcctgtggtgtagATGACCGGTCCCAGGG
AGCAATCATTGGGAGCCGGCCGGGGTTGCCTGGCCCAGAACACAGCCCTTCAGAATCCCA
GCCTTCATCACCTTGTCCGACCCCATCACCACCCCCAATCTTGGAACCGGGGTCTGAGCC
TAATCTCGCAGTCCTCTCCATTCCTGGGGACACTGTGACAACGGGGATGATCCAAATGTC
TGTAGAAGAATCCACCCCCATGCCCCGTGAAACTGGGGAGCCATATTGCCTCTCTCCAGA
ACCCACTCCCCTCGCTGAACCCATACTGGAAGTAGAAGTGACACTTAGCAAACCGATTCC
AGAATCTGAGTTCTCTTCCAGTCCTCTCCAGGTTCCCACTCCCTCTGCATCTCACAAAGA
GGAAATTCTTCCTGAACCTAATGGCATGGTCCCATCTGAGGATCTGGAACCAGAGGTGGA
GTCGAGCCCAGAGCTTGCTCCTCTCCCTCCCCCAGCTTGTCCTTCCGAATCCCCCACGCC
CATTGCTCCAACTGCCCAACCTGAGGAACTGCTCAACGGAGCCCCCTCGCCACCAGCTGT
GGACTTAAGCCCAGTCAGTGAGCCAAAGGAGCAGGCCAAGGAGGTTACAGCATCAGTGGC
TCCCCCCACCGTCCTCTCTGCCACTCCAGCTATGGCTCCTCCAGCTACTTCCCCAGCTCA
GGAGGAGGAAATGGAGGAAGAGGAAGAAGAGGAGGAAGAAGGAGAAGCTGGAGATGCTGA
GGCTCAGAAGGGAGGAGAGGAACTTCTCCCCCCAGAGAGCACCCCTGTTGCAGCCCACCT
GTCTCAGAATTTAGAGGCAGCAGCTACCACCCAAGgtaaggtgtggctggatggtgcaag
tgggttgggctgaaaggtgttttttgttttttgttttttctttcttttcattgatgatct
ctcaattgtgtggcactgtgtctgggtcatagaaaccctttgatgaacctaagagataaa
attccaagattaagggattttaatagtctggggtgggtatgatggaaagatgaaatactg
tggagtagctgctgctttttatttccccagggagtaggggtactccataaattattccca
ctttttttcttttttttaacctcccaaatagTGGCGGTGTCTGTGCCAAAGAAGAGACGG
AAAATTAAGGAGCTCAATAAGAAGGAGGCTGTGGGAGACCTTCTAGATGCCTTCAAGGAG
gtaaaggagcagaaagtaatggaggggagaggacagagtttgggtatgaacactagtcat
actgcaaccaaaatgaaatatcctacgtgtcctacgtgtgacctacagGTGAGCCCAGGA
GTACCAGAAGTGGAAAATCAGCCTCCTGTTGGCACCAGTCCTGGCCCGGAGCCTGAGGGC
AGCAGTGGACCGCCGAGGCCTGAGGAAGCAGACGAGACCTGGGATTCAAAGGAAGACAAA
ATTCACAATGCTGAGAACATCCAGCCCGGGGAACAGAAGTATGAGTATAAGTCAGgtatg
ctgaaggaagggctgagcagggttgggtattcttgccagggccccgggagacaaaggtat
gattcgctcatctcgtcttcctcgtagATCAGTGGAAGCCTCTAAACCTTGAGGAGAAAA
AGCGTTATGACCGTGAGTTCCTGCTTGGCTTTCAGTTCATCTTTGCCAGTATGCAGAAGC
CGGAGGGATTGCCCCATATCAGTGATGTGGTGTTGGATAAGgttggtaggcttgaggggg
aggagtcatttggggctggctggctaggggaggagcctgaggtcctgaaagagtagtcaa
gagccctagtctgtttctcatgccttccctgtcttctttgcagGCCAATAAAACACCACT
GCGGCCACTGGATCCCACGAAACTTCAAGGCATAAATTGTGGTCCAGACTTCATCCCTTC
CTTTGCCAACGTTGGCCGACCAGCCCTTAGCAACCGTGGGCCCCCAAGGGGTGGGCCAGG
TGGGGAGCTGCCCCGAGGGCCGgtgagtgggactggtgagaggggcggatggtcaagggt
agttgggggatggctcctttgtcttttggggagaaggaggatatttgccttagtgatgtg
tggtggcggtgtcacagattgtgctgactagctctgtgtcttcactcgtcctcactcctt
gcttagcagGCTGGTCTGGGACCCCGGCGCTCTCAGCAAGGCCCCCGAAAGGAACCCCGC
AAGATCATTGCCACAGTGTTAATGACTGAAGATATAAAGTTGAACAAAGCAGAGAAAGCC
TGGAAGCCCAGCAGCAAGCGGACAGCCGCTGATAAGGATCGAGGGGAAGAGGATGCTGAT
GGCAGCAAAACCCAGgtaatgatcagtgttgtttttgctctccatgtcttctcttcaaag
tctgtcctctgagccaattttgtcctcttcatttctgtcttccttatcaccagtatctga
gtccttaccattctctcatccctcccagcgacctcttctgagaacctcactggattgtgt
cttctctgttccctctaccagGACCTGTTCCGCAGGGTGCGCTCCATCCTGAATAAGCTG
ACACCCCAGATGTTCCAGCAGCTGATGAAGCAGGTGACGCAGCTGGCCATTGACACCGAG
GAACGCCTCAAAGGGGTCATTGACCTCATCTTCGAGAAGGCCATTTCAGAGCCCAACTTC
TCTGTGGCCTATGCCAACATGTGCCGCTGCCTCATGGCGgttagtttccattgttactaa
acattgtggtctagtttcctacttctcttcctaagactccttgagtccagcttcttggtt
ctcttccagcctgcgctgttaatggcagccaggcggtggcagagtgggagctgaggatct
tcctgggttagatagctaaagacttttggagggcctacctgctcaggactaacgtgatac
tctctttgacatacagCTGAAAGTGCCCACTACAGAAAAGCCAACGGTGACTGTGAACTT
CCGAAAACTGTTGTTGAATCGATGTCAGAAAGAGTTTGAAAAAGACAAAGATGATGATGA
GGTTTTTGAGAAGAAGCAAAAAGAGATGGATGAAGCTGCCACGgtgagagaaaacccacc
aaccccacagtccacccagatgctactttgctatagaatagggggtggggaagtaaatgg
aagttgggggtgatggtgttttggggattttctctgccttaagacaggaatacttgctgc
tggggttaggaatctagatagtggagagaaggattttagcccagtggctaggtacctttt
tgatggatttttgtcctataactgtcagGCAGAGGAACGAGGACGCTTGAAGGAAGAGTT
GGAAGAGGCTCGAGACATAGCCCGGCGGCGCTCTTTAGGGAATATCAAGTTTATTGGGGA
GTTGTTTAAGTTGAAGATGTTAACAGAGGCTATAATGCATGACTGTGTGGTTAAACTACT
TAAGAATCATGATGAAGAGTCCCTTGAATGCCTTTGTCGTCTGCTCACTACCATTGGCAA
AGATCTGGACTTTGAAAAAGCCAAGgtgagggtcttgggttggggaatgggacaggctga
agtgccaagtgcctggggcttgctgtccactgacagactccttgttgggctgccgggtgt
gagtcatcgagctacagtgatggacctgagggtctaaagaggggccgggcctacagttga
aggtaaggtgtcacaagctcctgacctgatccttttgcttcttcctagCCCCGAATGGAT
CAGTATTTCAACCAGATGGAAAAAATCATTAAGGAAAAGAAGACTTCATCCCGAATCCGC
TTTATGCTGCAAGACGTGCTGGATCTGCGACGGgtgtgtgtcctctccttctcactgctg
gtctgctgcctgtatgcgtatccaacattgcttggtctggccctctgatatgattatctt
gtgactggcattctgtccccacagAGCAATTGGGTGCCACGCCGTGGGGACCAGGGTCCC
AAGACCATTGACCAGATCCACAAGGAGGCTGAGATGGAGGAGCACTGGGAGCACGTAAAA
GTGCAGCAGCTAATGGCCAAGGGCAGTGACAAGCGTCGGGGTGGCCCTCCAGGCCCACCC
ATTAgtgagtttgggactccggttacgagggggcagagtgaggggttaaactttccactg
atgacttcttgttagtgccacgtgtctgggccactgagaccacatgatggaactgaggat
ctgaggaagggggtctgggggtagccccaggtgatcggggggctaggagttactcattat
tgtaatatactctttgtcccagGTCGTGGCCTCCCACTTGTGGATGATGGTGGCTGGAAC
ACAGTCCCCATCAGCAAGGGCAGCCGCCCTATCGACACCTCACGACTCACCAAGATCACG
AAGgtaggggggcgtattggagggtgtcactacctagtggtagtggtcattggagggaaa
agagggatcagttggcattgaacatagatttggatcttcatctccttacttctgaggttg
aaaaggtgatggctttcctcttggactaactggttagactcctagagacaggactgccag
ctcaagaagatgtattcacatctgtctgggccagcaaactcgcacagcagatctgtccca
ttccttctctacattccacagctaagaagcggcttttacagttttaacagttgaaaaaaa
taaaatggatgatttgagtaatgaaattactcaaaatgtaaatttcagcatgcataattt
tattagaaaacatgaccaaattcattccccttaagtattgcgagtgactgtttttgtgct
acagtggccatgtggaatggttgaaatagaaactatatgatatgcaaagccttaagtatt
tactatttggccttttagaggaaaagtttgcctggctcctggtctatgccatttgctact
gtgtagctatgggctttggccagatcagactgatgctccactccactcccgtttccttcc
acagCCTGGCTCCATTGATTCTAACAACCAGCTCTTTGCACCTGGAGGGCGATTGAGCTG
GGGCAAGGGCAGCAGTGGAGGCTCAGGAGCCAAGCCCTCTGATGCAGgtacttgaggcca
tcgtaaggagctgggggcctaggaatcctcttatttgagggcagagccttatttgtagga
gaggcttttgtataaagtggttgggtaataacaggaggcttatgcttgggacgaggggga
ctgaatgaactgtgttcatgttgggagtaggaccaagtgtcctaaactggcgagtaggag
atggaatggaagaaagtaggaagagattttgatgtgggctttctgcctccccagCATCAG
AAGCTGCTCGTCCAGCTACTAGTACCTTGAACCGCTTCTCAGCCCTTCAACAAGCAGTAC
CTACAGAAAGCACAGACAGCAGACGTGTGGTACAGAGgtgaggcttcccctgcgagtgtc
tttgtttttcacgtggggagtactgggattgggctttggtggttgccataggaatcctca
catctgtaatgctcatagtccatggctagatgggggcacattccagattccaggaactat
gcctgatgattgctgagcttgttggaaagttctacaggagagtgcctaggcagtacaggt
gagaggtgacatgcctgttttttctccagGAGTAGTTTGAGTCGGGAAAGAGGTGAGAAA
GCTGGGGACCGGGGAGACCGCCTAGAGCGGAGTGAACGGGGAGGTGACCGTGGGGACCGC
CTCGATCGCTCTCGGACACCTGCCACCAAGCGGAGCTTCAGCAAGGAAGTGGAGGAGCGA
AGTAGAGAGCGGCCCTCCCAGCCTGAGGGACTGCGCAAGGCAGCTAGCCTCACAGAGGAT
CGGGACCGTGGGCGGGATGCCGgtaagggaccgggagaggaagggaaaggtaaggtgtgg
gtttgggactagccagcctccagtcttcagagctccaggtctttcttgctaggaaaattg
gaactgaagagtctctgatctgtttctccccccttcagTGAAGCGAGAAGCCACCCTGCC
CCCAGTGAGTCCCCCGAAAGCTGCGCTTTCTGAGGAAGAGCTGGAGAAGAAATCCAAGGC
CATCATTGAGGAATATCTCCATCTTCATGATATGAAggtaggcagtgggaggtgtctcag
tgacagcagggtggccagggagggacatgtgctgacatgcatggagtgtggggttaggac
cagacagtgactgccctctccctctgcccacactcctgcaGGAGGCAGTGCAGTGTGTAC
AGGAGCTGGCCTCACCAGTCCTGCTCTTCATCTTTGTGcgnnnnnnnnnntttacatccc
acagacttcctttcttgtgtaggatctgtgaaccttggatgagagtatagccatcccggt
tagcattactttggcaggggtagagtgtaccatgtaaggacaaaagtgtggccttggctt
gagataattgccccatgtctaggaagtgttcttgagggtctccacagtggatcctttaac
aatgtcatcttgccccagagggatggtgggggtccagcttacctttcctagaatgtatga
tttctttctccttaaaagatttatttttatttgagagggagggagggcaggcaggcaagt
ggaaggaggggtagaaggggagagaaacctcaagcagactccccactgagcatggagcta
gacagggctcaatcccaggaccccaagatcatgacctgagctgattaccgagaatcagat
attctgctgactgagctacccaggtgcccctagaatgccctgactttgaattccatttgc
aggCTGTATGAAATCTTAGAATTGGCTGAAGACATGGAAATTGACATCCCCCACGTGTGG
CTCTACCTAGCAGAACTCATAACGCCCATTCTGCAGGAAGGTGGGGTACCTATGGGGGAG
CTGTTCAGgtaagccccctttggggattcaggggaggtaaagacaagaagaaagctgggg
agggggagtacatatggcaggttcaatgcctggatttggggagggatggggcagtgtact
gactgagtgagccattaacactctgtaatttcctttttttctctatagGGAGATTACAAA
ACCTCTGAGACCCCTGGGCAAAGCTGCTTCTCTGTTGCTGGAGATCCTGGGGCTCCTATG
CAAAAGTATGgtaagtaagagccttttgggggtgatgtgtagagacttctcttccgacca
tgctcttttggccagttgctgtgaccctgatggctcatggtcctttggtgggatggggtt
aatggcgagggtggtgctgtgttggtacctgagaaaggaaatgtcgaggctggcgctggc
actctcagaccagttcctgtcatgagttctggctaagactggaggacagtgacagtctga
gaccctaagcccttgattgattctttgattcaatcaatcattcattcaactaacattttt
ttttaaacatgtaccaaccacatagtaggcactggggatagcacattgaataaaacacag
ttaggaaactggctggaagagaaaagtaagaaatgacagcttaataaaaacagtgtgaag
caaagcgtgaaataaaatagtagaaatggagtgccttgagtactgtgaggttgcaaagga
gtttctctttggtaataatgttcatgacaaagcttcccacaaagttgctgaaactgcttt
gtaaaagttaagtggtatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnntggtagatctagagaggcagaggcagaagctcatgagcaggg
agcccgatgcagggactgtatctagggaccctgagatcatgatgagctgagcctagggcg
gacacttaactgactgagccacccaggcacccctgaatatctgttattatagagtaatgc
ctctggaatctcttgtcccttcacagaaaatgggctcagactgtttgtgaggatttctga
tttgccttggggttgtgtggggggatttatctgctgcttaaattttttggacttggtaac
caaaaaggcttattatttgtgagatgtcctgtctcatgaacatttgttatagcttggaat
aatgaaaaactaagctattctagaaaaagaagtgtagaggagtgtggaaggcttaagttg
aggtatttggatttggtgttttacctttctcagtaaaggtaatcctgtgaaagctaattg
acctcttctctagaggctcttaggctattcctccttgcccttgccatttcctagcactgt
ggtaggtgatttcttgtgtctttgagtgattattggctgatatctgtatctggtactagc
ctgtaggcatggatagatggtgtcttttcggtacttctgtaacatcctgaagcccctagt
gggcacatagtgaccttgtagtaaatatttgttgggtgacatttgcagagctaggtcttg
gagggagagaaggttgctaaattgttcttgtattttctagGGTCCCAAAAAGGTGGGGAT
GATGTGGCGAGAGGCTGGACTCAGCTGGAAGGAATTCCTACCTGAAGGCCAGGATGTCAG
TGCATTCGTCGCTGATCAGgtttgcggctagagttagattaattctagcatttgggactg
gccattcttcttcctcttgcttcagcacacttacgtggtacacttaacctcctgactgtg
ggtcttatttagAAGGTGGAGTATACCTTGGGTGAGGAGTCAGAAGCCCCTGGCCAAAGG
ATGCTCTCCTCCGAGGAGCTGAACAGACAGTGGAGAAGCTgcnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagggtaatctggattgga
aaggactgagtaatacttgactgagacaggaagaaaggaaaatagctaagtgtagacaag
gtctttggatttagataatcttttgtccaaagacaaaaatcttttgttcgagtgtaagag
ataatggttgtaaaggaggcccattgtgtttagatgggataaacttgggcttgaaaatat
agggcagactggataattgattatgtaggatccccagggtaggtgtgcatgggatttgga
acacaagtttgggataaatgctctgctgctgtagggtgggtctggagagcagtggttgtg
aatttgaatgtgtgtaccctgagaaacatcctggcttgcactttctcatagatggctgtc
agtgtttcatctaggcctagattccagaaattatattcacaacttggcgtccctttgctt
ttggaaagattataaaagtgtgggctttgggataggttgtgttcagggcttataggacaa
gtgcttgggaagacttaattagtagccaggttggggagaaagagggtcagagcaaggggt
gctggagttgagcctaaagaaattcactgggaaggtgacaagagaaaggatgttcctggg
aaagaatgcagcacatttaagtgtcaaggccagagagggtatgtatgttcaggagatgtg
tggaaagtgagaagaaattgggatccatagttttccagggtctttgatgggggctgttga
atgttccaggatacaaacccttgactttggtgagtgatagttctgggacttaacatcatt
cccaaaatgaggagtaccaattctttgtatagtttttcttaatatattgtgagtgaagct
gctgaggtgaatcttggacaggttttaaggttttgctgtcacttgttactatgcactagt
ctcttggatcatgaaattaacatcttgttctagagacccacctagtcactctggaatggt
cagacacagatatcaggatggtgggtcaggcccttgttcgaacagtggagcccaggagtg
gaatggggtggctgtgggcagcacaactcttaactgctgttttcctgcctgcttgcagAC
CTGCTTCGGATGTTCTTTGATGCGCTGTATGACGAGGATGTGGTGAAAGAGGATGCCTTC
TACAGCTGGGAGAGTAGCAAGGACCCTGCTGAGCAACAGGGCAAGGGCGTGGCCCTTAAA
TCTGTCACAGCCTTCTTCAAGTGGCTTCGTGAGGCGGAGGAGGAGGAGTCTGACCACAAC
TGAGGGCGGGTGGGGCCGGGGACTTGGAGCCCCATGGACACTCGGATGGCCCGGCCAGCC
GCCCGGACTGCAGGGGGGGCGGCAGCAGCGGCGGCGGTGGCAGTGGGTGCCTGTAGTGCG
ATGTGTCTGAGCTAATAAAATGGCTGAAGAGGCAGGATGGCGTGGGGCTGCCTGGGGCCC
CCCCTCCAGGATGCTGCCAGGTGTCCCTCACCTCCCCCTGGGGCACAGAGATATATTATA
TATAAAGTCTTGAAATTTGGTGTGTCTTGGGGGGGGGGCACCACCGCCTGCCCCTGGGGT
CCTTTTTTATTTTCTGAAAATCACTCATGGGACTGCCGTCCTCGCTGCTGGGGGCATATG
CCCCAGCCCCTGCACCACCCCTGCTGCTGCCTGGGCAGGGGGAAGGGGGGGGCACGGTGC
CTGTAATTATTAAACATGAATTCAATTAAGctcactgcctctctgctttatggcctgctc
cctctggagaaggggtatggataggtgggcagcctcctttccagagctggcactgtagca
ctgttcctgtaacctggcacccctcttgcctcttcccctgtccatgattgtggggattgg
agggtccactttcctggagggttggacccttgaaaccgacatggtggggttccctgttag
ctggtagggaagaagaaaaatagctgtgggagtacttccagaacacactcgctgggctta
ctctcctagaagaatgtgatgcagacggacctgtgcgcggaggaggccctgggtttcacg
ctactgtggccaagaaggcctttatggcttcaaggtcccctctgcaagaagggctgaacg
cgaggagtctgaccccaacgcggtatgccgggcagcccgcgcccatgagctcccgcgcac
cctcttccctcagggtggctccccagggcctgggaggagaggacccggtgtttccggact
cggccccaggccgcccctgcgtggccgtgacgcgttcgccccgcctgccttgggtggtga
cgcgggtggccacgcccccgcgctgacgtcaccggcccggttccctctccggggagcggc
ggcggacgcggctcccaccccctcccctctcgcgggctctcccctccccgg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1355..1442, 1949..1969, 2552..2728, 2954..3053, 4172..4284, 5103..5195, 5403..5469, 5744..6574, 6871..6959, 7068..7254, 7347..7480, 7603..7761, 7929..8114, 8301..8498, 8716..8862, 9088..9324, 9528..9632, 9744..9903, 10102..10202, 10804..10906, 11154..11256, 11489..11721, 11858..11975, 12100..12157, 12663..12787, 12948..13029, 14380..14478, 14592..14679, 15838..16469
1001..1059, 1355..1442, 1949..1969, 2552..2728, 2954..3053, 4172..4284, 5103..5195, 5403..5469, 5744..6574, 6871..6959, 7068..7254, 7347..7480, 7603..7761, 7929..8114, 8301..8498, 8716..8862, 9088..9324, 9528..9632, 9744..9903, 10102..10202, 10804..10906, 11154..11256, 11489..11721, 11858..11975, 12100..12157, 12663..12787, 12948..13029, 14380..14478, 14592..14679, 15838..16022
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved