Canis_familiaris Locus EEF2
snOPY snoRNA Orthological Gene Database
Canis_familiaris EEF2
Canis_familiaris
EEF2
20
SNORD37
3965..4029
11353
atagagatatggaatggcatgccgatttgttctctcgagccaaagacctgaatacaata
gtttgttagggtcacattaggacacaaatgcaaaatagacttgtgaacctccggctggag
aggaaatgaaatagaaaatgagatggcacctggaaagcgctgagccctgtgcctgagaca
tagcaaaccatgtccctgaaataaatgttgtattaatagcaatgatagctaattaagaga
gctgacgtgctttgggtgctgtgtcaggcaccagagctaatccctttgcatgtgtttact
ctttccttcccccagtgaagtagtaccgattaccccattttacagatgaagaaactgagg
ctcagaaaaacccaaatacctagtgtaagagcaggtaaagtggtggggctggtaaggtgt
tttgtttattgctatagcgactacacctatcacagttcttggtgaagtagatagccaatc
tatctttgtgggataagcgtgtgattaacatctgctttcaaaaaaggttttcatatttga
aataattataggcaggtagttgcaaaaatagtacagagaggtgtcgagtatccttgctcc
actgtccctcagtggattcattacataacagcaaaaccagaaaactggctgcggtacaat
ccacagacccttttcccattgtcaagtgctcttaacagaagtgcatggcattttggaagc
tgatagagctgctacgattaatattctcagctaaaacggcgcctttcgctttctgcacct
gagcatcgcattctggaggcgtgcccccaggtcccgggagaccaccgcccccgggagctc
ccgcagccacgccagcgcctgaagggttaaccggaggagtgcgtccttgcgcctgcgcag
ggcgttgcttctcgccccgcccccgcagcgcggtcagatgacccgcccaaccggcttctg
cctataaaaggtcgggtgttgacgtcaacgttctcttccgcCGTCGTCGCCGCCATCCTC
GGCGCGACTCGCCTCGCTCGGATCTACCTGGGAGAATCCACCGCCATCCGCCACCATGgt
gagcgacgccggcgggccgggcggcctgggagggcggcggggcctccgcggggccggcgc
tctcggccttggagcgctggggccgcccggacgtggagaagacatggcggcgccggcggg
gccggggctgaggaagcggccgccgccatgtctgcgcgacgcgccgttcgccgagcccct
tccccgcttccgggggcgcctccgcctcgcgtggagcccgggccggtccggagctggggc
cgaggcggggcgggggggtggtggtggtggtgatgatgtggcagacgctgtaatggcggg
cgccgtgtggggagcgcggcgaggggagccgccttctgtaacccgggtcgtgagctgggg
ggtccgcgggggggggggagcccctccccccgcccagcgcggggggcctccctcgcccgc
ctgcctgtgcccccggcgcgtccgcgtcccggctcagaacagctgacagccggcctgcaa
atggaggctggcgtccgcggggggcagggcgagctccccgcccagccgtccctccggggg
acgctggccccgtgtgacccccagctggagggatgaccttggatctccggttgggagagg
ccggggagaaggcagcggggatggggcttgcggggagcctcctccttcctgcaccctgca
gcggccgggctgcctctgaccagcgtgtgccctgggaagtcacggcctcggggccagaga
cttcgtccccgcccgagttgcggtgtgtccgtgacaggcggcgttgcccctccccccccc
cccacggggcaagtggcattttcaaggggtgtcagcaaacagatggagttcaggtggtgg
tttggggccagcccagctgcagtgtgcacacctggcaggggcctggcagcccatcgattg
tgaagtcccaaggccgcctgggcaggcctgagcctcccctcctcccctccccgcccagGT
GAACTTCACGGTAGACCAGATCCGGGCCATCATGGACAAGAAGGCCAACATCCGAAACAT
GTCCGTCATCGCCCACGTGGACCACGGCAAGTCCACGTTGACGGACTCGCTGGTGTGCAA
GGCCGGTATCATTGCCTCCGCCCGCGCTGGGGAGACCCGCTTCACTGACACCCGGAAGGA
CGAGCAGGAGCGCTGCATCACCATCAAGTCCACgtgagcaggctctgatatcctagggag
gatgggagggaggtcctcacccaggtcttgggtggagaagccagagggcaggtgctaccg
tgttcctggggctgctggggagatgattggagcagctgggggttgggattctgaactgtg
aggcagacaggcgcagtggagtgatggaaaagtgcagccagttggagaggcgcagtgatg
cttggggtggggcggcaggggagccttgaaaagagggttaacccggcagcttcatttcag
ggctctgggcagtgcctggagaagtgtgggggtagtgccactggcataaggacgctgcca
aaaatcttatgctgtgcagcgacagttttttggctccccgttttgagcaagggcattcaa
agtagtgcctgtagctgccaattatctattgtttgtgaggttctactaggtcatttgaga
tttattttaggtgacaacggagggaaagagatagtttagggtttttagatatagtttggg
cacagggtcaatatttggaagcaagtgtgttgagcctgggaataacctgaatgaaggggc
tgcacaggtggactcccagaggctgctattggtagctggtactaggagggaggtggacct
ccctggctgagggcaaagctgcttgggtggaatggtttctttgtgggaaatctgaaatct
gtctgcaggaagaagtaattagcaaggagaggaaacaggttgtggtgtttttgtagtgtg
ggacttggttttttaaccgtttacaatctccttgatacttaagaaagccatattaaccct
ggacaggaacctgggcttgactccaggggtcactgggagggcaatgaaacgtggcttcca
tcgatccaacttgcaccaatctcctcagGGCTATCTCACTCTTCTATGAGCTCTCCGAAA
ACGACTTGAACTTTATCAAGCAGAGTAAGGATGGCTCTGGCTTTCTAATCAACCTCATCG
ACTCCCCGGGGCACGTGGACTTCTCCTCAGAGGTGACTGCCGCCCTCCGTGTCACCGACG
GTGCCTTGGTGGTAGTGGACTGTGTGTCTGgtaagcgataagtacccccctcggtgtggc
tgggacccgggggctattacctcctcctctggctgatggagatgcccatccccagGTGTG
TGCGTGCAGACAGAGACGGTGCTGCGGCAGGCCATTGCAGAGCGCATCAAGCCAGTGCTG
ATGATGAACAAGATGGACCGGGCTCTTCTGGAGCTGCAGCTGGAGCCTGAGGAGCTCTAC
CAGACCTTCCAGCGCATTGTGGAGAACGTCAACGTCATCATTTCTACGTATGGGGAGGGC
GAGAGCGGTCCCATGGGCAACATCATGgtaagtagcttaactgcctattgaaagtgaggg
ttcctccaccagcttgctgatgtcacacgtctcccaaggtggggaaccacagtccttaac
tcgcactggaagggctctggttgagagggtgctgatcttggggactattgatagcacttc
tgaaaggtttgccaggacctgtagagtgacaaggggcctggatcatttttgtagctattt
catctggcacttggggtgggggggggagctgtggggtagtgggttctgcttgctgtctgt
gctcaccaagtttatgcacaccttttccttgctcctccagaggggatggcgtagagttgg
gccttgtaagtgatgactaaaatttcttcactttgacctgatggctgttgaagaaaactg
acgtctgaggcccatggtgcccagggactcttgtgctttctgtacagctgtttacttccg
ctcatagtgttctctgaccctcacagATCGACCCTGTACTTGGGACCGTTGGCTTTGGGT
CTGGACTCCACGGTTGGGCCTTTACCTTGAAGCAGTTTGCAGAGATGTATGTGGCCAAAT
TTGCTGCCAAGGGCGAGGGCCAGCTGGGGCCTGCTGAGCGGGCCAAGAAAGTGGAGGACA
TGATGAAGAAGCTGTGGGGTGACCGgtgagtactgggggaggtgcagggcactctggtac
ctgtgtgccggggcagggacctgcctgcagtggtgggaacatgactaagggccaccaaac
gtctgtagggtccttctgcccagcttggtttcctcactcacttgggtctcctgtttctcc
aacccatctaccatcgttgagttggtgaaatactcctgtactcctctgccagGTATTTTG
ATCCAGCCAACGGCAAATTCAGCAAGTCAGCCACCAGCCCTGACGGCAAGAAGCTACCGC
GGACGTTTTGCCAGCTCATCTTGGACCCTATTTTCAAGgtgagctgctgagtgtgcttca
tggatgtgcgtcccctgggctgtccttgggcctggtggctcccggaggatctgttacctg
acctaactggctgggcagagctgggttgacaggtgggtgctggaggagggtgaggtttgc
ctggtaggaagcagctgcacatttccagtaacattcctgaacccatcttcctgtttttgt
gacttgtcagGTGTTTGATGCGATCATGAATTTCAAGAAAGAGGAGACCGCAAAGCTGAT
TGAAAAGCTGGACATCAAGCTGGACAGTGAAGACAAAGATAAGGAAGGCAAACCACTTCT
GAAGgtgaatgcggatgtgcctcttggggtgggcctaccagctttgcactgactggagct
ctttgtcatatcttccagtcatgtccccatcaccaacagggtggtcaggggatctgtgtt
gttggcacctccccaggaggggcagctcagaatctaagtgcctctcaccaggaccttggg
catggcattctgagggctttgggccttgcttgacctccctgtcttctcctgtagGCTGTG
ATGCGCCGCTGGCTACCTGCCGGGGATGCTTTGCTGCAGATGATCACCATCCATCTGCCT
TCCCCTGTGACAGCCCAGAAATACCGCTGTGAGCTCTTGTATGAGGGCCCCCCAGACGAC
GAGGCAGCCATGGgtatgtgaggatcacctgcgtcctggggttagattgttgggcagagg
cctaagtatttttgtggctgtggtcaggtggtgatgctcattggcaagtccaggtcacag
ggttctgtgagggtgagctctgagggaatcacatgttttgttttgggaattcctcttcac
agGCATTAAAAGCTGTGACCCCAAAGGCCCTCTCATGATGTACATTTCTAAAATGGTGCC
AACCTCCGACAAAGGTCGGTTCTACGCCTTTGGTCGTGTATTCTCGGGGCTGGTGTCCAC
TGGCCTGAAAGTCAGGATCATGGGGCCCAACTACACCCCTGGGAAGAAGGAGGACCTGTA
CCTGAAGCCCATCCAGAGgtgaggtgcccagcagctcctgggtacgtcccagtctggtcc
atatccaagattatctctttccacagggagggtgacaagacataatgtggtccagagaag
ggtggaggacccttgaagctgagggagggagtgatttgtctgggtgaggcgcactgcgct
agttctgacttggacagacctggccctaaggtcagggtggtggcacgcatctgcagagcc
gtctcgagaggctagtggtagtcaccattccctggctcctggtgtgggtagtgggaagag
tgaacttccatctctccagcttcttgcagccctgattttcattggttctcaggttcccgt
gacagtcctatcagtgctaggttgggtgtggagccctacataggggagtcggggaggagc
aggtggcttctgctttggggtaagagagctgggacttattgtcacaggaactgggctgat
aaggtgaaactagggctagggcctgaggctctgggagttgggttcacatcagcatttcag
gtggatgggatggccacaggctttagaaggaaggggtgttttggggtcatttcgggatct
ggagggttttttttgtcttccctagAACAATCCTGATGATGGGCCGTTATGTTGAGCCTA
TTGAAGATGTGCCTTGTGGGAACATTGTGGGTCTAGTGGGAGTGGACCAGTTCCTGGTGA
AGACTGGCACCATCACCACCTTTGAGCATGCCCACAACATGAGGGTGATGAAGTTCAGCG
TGAGCCCCGTTGTCCGGGTTGCTGTGGAGGCAAAGAATCCAGCTGACCTTCCCAAGCTAG
TGGAGGGTCTGAAACGGCTGGCCAAGTCGGACCCCATGGTGCAGgtaggtgggtgccctg
gcagatgggaacaccgcggtgcaagtggttaatttgtggcttacatagggcttgtcacag
atttacggatattcaaatcttggaaagtctggtgtgtgctgagcatacactttccctggc
agagctactgtgtgacaaggtggtggcttttttctgagaaatctagttaattctttgtat
accagttctatttttatggtttggctgtggagcagattgtgaggttaacgagaatagcaa
aaacacagctcttgctgccttttacgagccctgagttgccacaaaacccatttctggtgg
gtctggtcttctctatctggagggaaacctggagctttatacctgttcctagaatttatt
ggggtctctgagtgtcttggggtccgtgcccagagcctaactcctggcccattgcagTGC
ATCATTGAGGAGTCCGGGGAGCACATCATCGCGGGGGCTGGGGAGCTGCACCTGGAGATC
TGTCTGAAGGACCTGGAGGAGGACCATGCGTGCATTCCCATCAAGgtgaggcctggctct
gggctcagatggctggaggcctgcgttttccagtacagagcaggacaagtagactgcata
gtccacgcttccttgatgtgtttgtcagaaaaatgtgctattattaggaaaccgtttgca
tatgtgttcagaatggttgaggttgcagtgtgagggccctgcttttttttttttcttttt
aagatatttattcatgagagagaggctgagacctaggcagagaagcaggctccatgcagg
gagcctgatgtgggctgaaggcagttgctcaagcactgagccactcaggcatcctggggt
gtgttgttttccatacactaaaagcttggaaacttctaagatacagatcatttaggtttt
tgtagcaagtctcagggtggtttggatttcatttgcttttgcaaggcaccaagctccatc
catgtatatgttacattcatgaatcgaatcaggaagatactgtaaatcttgagtggtcac
tgcttcctggaggctggcctgactttaacaatctttttgcagAAATCTGACCCTGTTGTC
TCCTATCGTGAGACCGTCAGTGAGGAGTCGAATGTGCTCTGCTTGTCCAAGTCCCCCAAC
AAGCACAACCGGCTGTACATGAAGGCACGGCCTTTCCCTGACGGCCTGGCTGAGGACATT
GACAAGGGTGAGGTGTCTGCCCGCCAGGAGCTCAAGCAGCGGGCCCGCTATCTGGCAGAA
AAGTATGAGTGGGATGTGGCTGAGGCCCGCAAGATCTGGTGCTTCGGGCCTGACGGCACT
GGCCCCAACGTCCTCACTGATATCACTAAGGGTGTGCAGTACCTCAACGAGATCAAGGAT
AGCGTGGTAGCTGGCTTCCAGTGGGCCACCAAAGAGgtgagtgggtcgcttgggtgtcta
gctgacagtggatcagtcacctatggtgttctcaggccagggatgctcacagctgttggg
atcttaggatatgtccttagtttactgcgggtgatgtgggggctcttgtcctgccttctg
ggaagggaatgttagggagggtggggttggtggggcaggacccaacaggtctgtttagag
acctggaggcattgtagaagctatgtgatccattctggagggaagggctgcagtgatgac
agtctctgctccttctgcagGGTGCTCTGTGTGAGGAAAACATGCGTGGTGTTCGCTTCG
ATGTCCACGATGTGACCCTGCACGCAGACGCTATCCACCGCGGGGGTGGCCAGATTATCC
CCACTGCCCGGCGCTGCCTCTACGCCAGTGTGCTGACTGCCCAGCCCCGGCTTATGGAGC
CTATCTACCTTGTGGAGATTCAGgtggggaggcttggtcctcttaattctaacaggctct
tttttgcccaacaactgcttataatggccattttttcctgacagTGTCCAGAACAAGTGG
TTGGTGGCATCTATGGTGTCCTGAATAGGAAGCGAGGTCACGTCTTTGAGGAGTCCCAGG
TGGCCGGCACTCCCATGTTTGTTGTGAAGGCCTACCTGCCTGTGAATGAGTCCTTTGgta
agtctcaatatcaatgcatcattcctcgaatgcccacttgattgtggctagatggcttcc
gggcaaacctggtctaggatatgtctgggttttgcctttggcacattctagagtgggtct
gatatttgaatcattgatggaatctgtaaagtgctgccctagcccccacccatttgggcc
attggaacagcagttcagaggagagtgtggcccactcaacaagcagatcccttgaaatgg
tgaatttgcagaagaccaccctgggatgtgtaacttggtgaaatgttatgttcaagggca
gcagagcagttgggctgtagctcagattcatcctgtggatgagcagaggggggaggccca
gggaatggccaacactgcctctcttacaaattagtgttctctgagcaaggcttgggtgag
attccagggttaggtttaatgtctgatccagtttgggttgattaggttctgtgatctctg
tgcctttgttgtcccctgccgcctcctccagggttttgccatggaggtagtgggagttaa
gtctcctgagcctgctagtaagccctgtccctccccacagGCTTCACTGCTGACCTGAGG
TCCAACACCGGTGGCCAGGCCTTCCCCCAGTGCGTATTTGACCACTGGCAGATCCTGCCC
GGGGATCCCTTCGACAACACCAGCCGCCCCAGCCAGGTGGTGGCTGAAACACGCAAGCGT
AAAGGCTTGAAGGAAGGCATCCCTGCCCTGGACAACTTCCTGGACAAATTGTAGGCAGCC
CTCCCCTGCAGCCCACCACCCCAGGTGGGACTCAGCACAGCCCCTGCACCCGGCTGACGA
TCGACCACAGCAACAAGCCCTCGCATTCTCCATGACACCTCGAGACTGTCCAGTGACGCT
CCACCTGACAGGTTCTGGGGCCCACTTAGTGCCATCACTCAACGTGAACACTTGATGCCG
TTTCTTTCAATATTTATTTCAAAATTTCAGAGGCAACAAATGCCCTAGCAGCAGGGACTT
ATTTGGCCGGTGGGGGTGGGGGAGGCGGGATGGGACACTCAACATTTTTTTTTTCCATTT
CAGAAACTCAAATGTCAAAAAAACGCATTAAGAGGTTTATTTGGGTAAATGGCCCGTAGT
GGATTTCCCCCCAGAAAGGGGGAAGGAACGAGCGGGTAGACCTTTCTTTTTGGACAGAAG
CTAGAAGGCAGGAAACTTTGTGCGGTGTCACCGTGAGCACCTCCAGCTGTATTAGTGCCA
TTGGAATAATAAATTTGATATGGTGGTGACTGTGTGTGTCCCTGTGACTTCCTTGGTCCA
GTCAGGCTGCAGTGGGCTCCCCTGTGCCATTCCCCACCATTGGTGATACTGCAATGCAGG
TTAAACCTGACCTTGAAGTACCTTTTTAGAGCCCAGCAGTCCTCCCCTTTGGCACATGGG
GCTAGCTGATGGGATGGCGGAGCCTCATGGACCCATGTGGTACAGAGGGGCAGCCCCTGG
CTGGTGTGGCTTCTGGGTTCTGAAGTGAGCCCTGTCCCAGTGAGGGAAAACCACAGAAGA
AACCATCACCTGCCAGGCAAGTTGTCTTATTCAACCACAATTGGTTATTCAGAAGTTAAA
AGTGGGAATATAAGTGACACACCTATGTAATAGATTTTTATTTTAACCTCAACGTTTTAA
TTCTAGACAGAATGTAGTACTAAGATCTTTCTACttcatgccttttaatcttccttggat
tgaaaaaaacctagctttaacagtgatgccataactgtgatgggagccgaacactatcag
taattaaaaggcgggaaccagggatgatggatgtcctgcattgcacagctctgcccatct
aagttgtactgtgcagtctctgacccctagcatctgccaacaaggtccttttaaagttgg
aaaatgtttaagatttggagggagcactccttggtgggaagcttttgagagcacgaggag
agggagagaagccgattccctgctgagccagaatactgatgtgggtctgagtgtcaggac
ggtggatcagacacttcagcaggctgagccatctaagcgcccttttggaagttgttctta
tttcaaaacctgacattgcttgaagggcacgtgtgttttttgcacttttgtaaacattta
tttttgaataattttatatttacagaaaaggtgcaaagatgttacaaaggtgcgctaatt
gactgtttacttggttttccactaaagtcctttacacagttgcagggtccaatccaggat
acctcactgcatttagttttgcacatttttaacatccagcaatttgtcaaaagataggac
tgtaaattgaagaggagactgttttaagttttaaattctaaattcagggatccctgggtg
gcgcagcggtttggcgcctgcctttggcccagggcgcgatcctggagacccgggatcgaa
tcccacgtcgggctcccggtgcatggagcctgcttctccctctgcctgtgtctctgcctc
tctctctctctctgtgactatcataaataaataaaaattttaaaaaaacaaaaaaaaaaa
aaaacaaaaaaaaaaaaaaaaaaaataaattctaaattcatatgtcacttggggtgtttg
gcttgctaacagcaagtctagttgtgcattttcagctgtaaatttcaaaaggattacatt
tgtaggggctgacc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1077, 2038..2252, 3148..3329, 3415..3626, 4106..4284, 4492..4597, 4810..4923, 5154..5292, 5462..5657, 6265..6523, 6957..7064, 7602..7955, 8240..8422, 8504..8636, 9220..10353
1075..1077, 2038..2252, 3148..3329, 3415..3626, 4106..4284, 4492..4597, 4810..4923, 5154..5292, 5462..5657, 6265..6523, 6957..7064, 7602..7955, 8240..8422, 8504..8636, 9220..9413
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved