Canis_familiaris Locus ENSCAFG00000017917
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000017917
Canis_familiaris
ENSCAFG00000017917
20
SNORD105
1927..2013
5616
GGACTGACAGAAGGGAGAGAGTCCAAGAGACAGAGAAGGGGAGAGAGACCTGGGGGGAT
GGACAGAGACAGGGCGAATCAGGAAGACGGATGAGAAGAGAGAAATGGGGGTAGAGACAG
GAGAGAGCGAAACTTGAAAGCGATGAGAGGCCATTGATGGCAGAGACAAAGTTGGGGCAG
GGGGGAGAGAGAGAAAGGAAGAAGACCGGGGAGGACGGGAGGGAAGGCCGGAGGGAGAAG
AGGGGAAGGAACTGGAGGGAGAGACAGGAGGGGGGAAGCAAGCGGGGGAGGGGAAGCGGA
TGGGGGAGAGAGACATTGGGGGCATCCCTTTCCCCCACCCCAAGGTTCTGGGGAAGAAGC
CAGGGGCCTGAGGCCAAGACTGGGGCTTCGAGCGGAAACCGGGAGGGGGTGAGTTATTCA
CAAAGCGCCCGCCTTGCCCTAAGTTTCCAGAAGGTGATGCGGAGTTTCCATCTCTCAGCC
GCAGGCAGGGCCTCCGGGGAAGACAGCTGGCCCTCAGGAGCTGGGGCCCACGTGCCTAAC
TGCCATGCTCTGCCCTTTTCTCGGGTGCTCCCCCAAGTGCCTGGTGCTGGTGCGCCAAGC
GTTGTGCATACATCATCTTTTTAAATTCGCGGGTCAGAGGGGAAACGATCACCATCCTCG
CTTTGGGATGCTTGCGGGGGCCCTGGCGCGGATCAAGCGGCTCTCATATTCGCCCAGCCG
CAGTCATGGGTCGAGGCAGGATTCGAACCCACGGTTCCTTTCTCAGAAGCCCGCGCTGCT
CCCCTGACACCCCAGCCCCTCCCGGTTGCCGTAGAAACAAGCACCAGGTGTCTCCATAGC
AACTCCTCCAAGGAGTGCTGCCCGCCGCCACCTGGTGCGCATGCCCGCCCGGTGACGCCG
CCGCGCGTGCCGCCTCACGTGACCTCCTCGCCGGCGCCGGAAGTGAGCGGCGCGGCGCCG
GAAGCAGCAGGCGGAAGGGTGCAGCTGGAGGGGCCGGCGGCATGGGGCAGTCCGGGCGGG
TGAGGCGCGGCGGCCGGGACTGGGGGGCGAGGCGCGAGGGGGCCGAGGGGACCTGGGGGG
GGGGCCGTGGCGTTGACCGCTCTCCTTTCGCCCCCGCAGTCCCGGCACCAGAAGCGTGCG
CGCGCCCAGGCGCAGCTCCGCAACCTCGAGGCCTACGCCGCGCAGCCGCACTCGTTCGTG
TTCGCTCGGGGCCGCGCGGGTCGCGGCGTCCGGCAGCTCAGCCTGGATCTGCGCCGGGTC
ATGGAGCCGCTGACCGCCACCCGCCTGCAGGTCTGCGTCACCCGGCGCGCCTCCGTCAGC
CATGGGCCCTGTCTTGGCGGCCGCGGAGTGGCTCCAGTCTCCTTGGCTCGAGAAAGGGAC
CCTTACGGGGAGCAGCGTCCCTGCGGCTCAGGGATTTGTGGGGCAGCAGCGAGAGCGCGC
GCAGATGAACGCACTCCGCTGGGGGCTTGGCTGCACGCCTAGGGCTGGTGGTTAGGGGCC
TCGAGCTAGCAAAGCTAGGGTGGAAACTTGGCCTCTCTCAAAGGCCTGGAGGAAGCTAGT
TAACGTCTCAGGGATCAGTCGCCTCATCTGCAGATTGGGCGATGCAGTGTTCAACGGATA
AATTCAAGCCTGATTAGCTTTAGAGGTCGGGAGCGTTTCACTCTCTTCTCTTTCTTGGAG
AAATTAAATGCAAGAAAGGCCATAACAGCCTCAGCTTGTAGTCTTTGCTCAAGAGGAGAT
GTTCATGATCCATCCTATTTGTTTTTTGCAATTCCCAGATACGAAAGAAAAACACCCTGA
AGGATTGTGTGGCAGTGGCCGGGCCTCTTGGGGTCACCCATTTCCTGATCTTGAGTAAAA
CAGAAACGAACATCTACTTTGTGAGTTAATACCTGGGAAGCCCTGATTTTCTCCCTGACC
TCCTGCTCTCCCAGCTCTCATGATGAACCCATATGCCTCTGAGCTGCCATGATTCTGGCT
TCAAAGTAAACGCTCTGAAGAGATGGAGCAGAGGTTCCCACTCCCTGCCCCCCCTAGCTG
GATGCCTCCACTCTTCACCAACTCTTTTTTTCTGTAGAAGCTGATGCGCCTCCCAGGAGG
CCCCACCTTGACCTTCCGGATCAACAAGGTATGGATTGGAGATGGTAGGGGGGGTGTTGG
GTAGGGGATGGGTTTGGGGTGGTGCCGACCACATGTGGCTGCCAGGCACCCACTTCCCAC
CCTGTCCTGCAGTATACGTTAGTGCGAGATGTAGTCTCCTCGTTGCGCCGACACCGCATG
CATGAACAGCAGTTTGCCCACCCACCTCTCCTGGTGCTCAACAGTTTCGGCCCCCATGGC
ATGCACGTGAAGCTCATGGCCACCATGTTCCAGAACCTGTTTCCCTCCATCAATGTGCAT
AAGGTGGGATGGGCCTGGTGTGGTGGGAGATGAGGGTGGACGGGGCATCTGGGACAATAG
GTACCACACATAGGCCCTTGGGTTGTTTGTTCAGTCCTCACCTCTTGGCACTGAGGCTGA
GAGCTCCGGGTTCTGAGGTCCAGTTTCACTCATGTGTTCTGTGATTCTAGGGTAAGAGGC
TCTTTTAGGAGTTGCATTACTCAAAAAAAAAAAAAAAAGGAGTTGCATTACTCTTTGGAG
GACAGAAAATGATGCTGATGGTCCTTTATTTCTGAAGTGTGGCAGGTGTTGTGACTCCAT
TTTGTAGACAGAGAGACAGGCAGACAGAAGTGAATTGTAGTTTGATGTCAGTTACAGGGA
GCAGGACTGGATATTTTAACTTGTCTGGCTCCAGAGCCCCAGCTCCTAACCCCCAGCACT
AGCAGGTCTCAAATTAGGCTGTTAGGTGCCAATCATCGGGGAGTCTGGTGTAGACCGCTT
CAGTGGGCCTAAGAACCAGGATTTCTAGCCAGTGCCTGAACCAGCCCATGAGTCCCCACA
GTGCTAGCAGCACCCCACACCCCCTTGCTGGGAGATTTCTGGAGTATAGCCGTGGGCTTG
GTGTGGCTCCACACAGGGAAGTCTGTGGGTGGTTCATGTGGTGCTTTGCCCCACCTCTTC
CTTCCAGGTGAACCTAAACACCATCAAGCGCTGCCTTCTCATCAACTACAATCCCGACTC
CCAGGAGCTAGATTTCCGTCATTAGTGAGTATTGGGAGGTGGTGGGGGTGGAGGAGGGGT
GACTTTCATGTGCGGCTGATGACAGTGTTCCAGCTGAGGGTCTGTGATTGCTCAGTCTCA
AAGTAAACGCTCTGACGCACTGTGGGAATGGGTAGGCAGAGCTGACCTCCTCCAGTCTCA
CAACTTCTAACACCCTTCTCACGCCCTGGTTCCTGCAGTAGCATCAAAGTTGTTCCAGTG
GGTGCAAGTCGAGGGATGAAGAAGCTTCTGCAGGAGAAGTTTCCCAACATGAGCCGTCTG
CAGGACATCAGCGAGCTGTTGGCTACGTAAGGAGTGCACTGGGTGGGAGATCACTGAAGT
CCTGGGTACCCTGGAGCTGTTTTAGGAGCCTGAGATCCCCCGCTGACCTTGGTGTGTCCT
CTGCACAGGGGCGCTGGGCTGTCCGAGAGTGAGGCAGAGCCTGATGGTGAGCACAACATC
ACTGAGCTGCCCCAGGCTGTCGCAGGGCGTGGCAACATGCGGGCACAGCAAAGCGCTGTG
CGGCTCACAGAGGTGAGGCCCAGCCCTGGGGCAGGCCCAGTGGCAGAAGTGACTCCTCTG
GCAGCCCCCAGCTCTGAGGAAGAACTGACTTTTTGCCCTTGTTTCTCCAGATTGGGCCTC
GGATGACGCTACAGCTCATCAAGATCCAGGAGGGTGTGGGAGAGGGGAACGTGCTGTTCC
ACAGTTTCGGTGAGGATGGGGCTGGGGAACCATGGGCTGGAGGTCTAAGGCCCTTGCAGG
TGGGTCTCAAAATACACTTGGGTCTCGGTGACCTGTGTCATCTTCCTCAGTGCACAAGAC
CGAGGAGGAGCTGCAGGCCATCCTGGCAGCCAAGGAGGAGAAGCTGCGGCTGAAGGCCCA
GAGGCAGGACCAGCAGGCTCAGAACGTCCAGCGCAAGCGGGAGCAGCGAGAGGCACACAA
GTGTGTGGCCGTGGGCTGTGTGGGTGAGGCAGGGTTGCAGGTGCAGGCTGCCCCCCTCAC
TGGCACCCCTTTCCAGGAAGAAGAGCCTGGCAGGCATGAAGCGGACGCGGGCAGAGGCCA
GTGGGGATAGCGATGCTGAGGACCCTGGTGCCCCCCCGGAGACAGAGGGGGCTGGCCAGC
AGGAGGAAGAGGAGGACGAAGCTGAGTATTTCCGCCAGGCAGTGGGAGAGGAGCCCGATG
AGGGTATGTGGCAGGGGATTACTGCAGCCAGGCACCTTGGGCTTGTCTTTGCCCTGGTGG
CCTCGACACAGTCTCTTCCCCACAGACATGTTCCCGAAAGCAGCCAAACGCGGACAGTTC
ACCGGGCCCCCAGGCAAGAAGCCACGAGGAAAAGAGCGGAGGCCAGATGGAGGCACTTAC
CACAGGCCTTCAAAGGCCAAGGGCAAGCCCCAGCGGGACCAGGCCAAGCTGGGACGGAGA
GGAGCTGTCCGGGACCGCAGGCGAGGCCAAGCTCGACCACCTAAGAAAGTAGTCTGAGGC
CAAGCTGGAGCAGCGGATGGAATACCCCAAATTGGGGCCCAAAGACCTGCTTTGGACTTC
CACCTGGGTCTCCAGGAGCAGCCCTTGGTTTCCTTTCATAAAGGAGCAGTTTCCCCGACC
TAAGTCTGAGTCTGTATTTGGAACGGGGAGATCTCGAGTCCTGTGGTGCAAAGCCCAGAG
AGGCTCGGGAATTGGACTGGGTTCTGCCCCTAACCTAGTGTCCCTTCCCCCATGCTGAGT
AGTGGAAGTGCAGGGCCGCTTTCACAGGTGAAGGTGCTGGGCAGAACTGGTCCTGGGCCT
CCCCAGCACCCCCGCCCAGGGTTACTTGCAAGCCTGTAACTGGTTGGCCCTGGAGAGCGA
GATGTGAAGAGGAAGGAAACCCCAGGGTGGCGGCGAGGGCGGGGGAGTGAGGCAGCCGAG
GCCTGTACAGGCTGTGGGTGGGGCTGCTGGTGGGAGGGAAGGAGGGTGGAGCTGCAGGGA
AGGGAGGGGCGAGCCAGTGCTGGTAACACTGGGCTCTGGGACTAGCACAGCGTGGGCCGT
GAACCTAGAGGCAGGGCGTGCGGGCCATGGCCGCCACCACTTCAGGTGAGGAGCGAACGC
TGCTGGGTCGGTTGGGCCAGGCAGGTGTCCTGGGCCCTGTGGTTCAGCTCAGGACCGAGG
GGGCTGGCTCCGAGGAGGTGGAGGGGAGTGAGTTAATCGTGTCTGGACGGGGACTTCCTC
CCAGAGCAGAGATGGGATGGGGAGGCAGAAGTGTGGTCAGGGAAGCAGTCTGGGGCGGGG
GAAGGGCACGGGCATCTGGAGCCTGCTGGCAGACCGGGCGCAGGCAGTCCACCTGAAGCC
GAGGCGGAGTTGGTACAGAGAAGGGGGTCCGTGCAGATCTGCTCTTGCACACTGCTGCGT
CCCAGGCCTTACTCTGGGCACCAGGACACCAGCGGCAGGGCACTCCCTGCCCTCAGGAGA
TGTTCTCTTGGAGATGGACACACAGGCTTTGCAGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1119..1289, 1778..1879, 2077..2127, 2232..2402, 3067..3143, 3338..3445, 3548..3671, 3770..3848, 3950..4079, 4156..4322, 4405..4616
1001..1018, 1119..1289, 1778..1879, 2077..2127, 2232..2402, 3067..3143, 3338..3445, 3548..3671, 3770..3848, 3950..4079, 4156..4322, 4405..4613
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved