Canis_familiaris Locus ENSCAFG00000015122
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000015122
Canis_familiaris
ENSCAFG00000015122
20
SNORA68
3626..3759
5399
CTAATCCACAAAATCAAGTGACTAGAACCAGAAATGCAAACGGAGAAAATTAATGTAAC
AAACTCTATAAATACATACTTGTCCTCTTCTATTTTCTCAGATTCTTTAACAGCTGTACA
ACTTTAAGTAACAATTATAACAATGTATCGTTATGTTTGTAACATATATGGATGTAATAC
GTATAAGAATAATAGCACAATAGCAACAATAATGAGACAAAAGGAGAAAGAGGAAATAAT
CTATATAGAAGTGACATTTCCAAATCTCATTAAAATTAAGGTATGTGGGTGGAGCACGGG
ACTCGACCTTCAGGTTGTGAGTTCAAACCAGCCTTGGGTGCCGAGGTTACTTAAAAAATA
AAATCTTGGGATCCCTGGGTGGCTCAGTGGTTTGGCGCCTGCCTTTGGCCCAGGACGTGA
TCCTGGAGTCCCGGGATCGAGCCCCACATCGGGATCCCTGCTTGGAGCCTGCTTCTCCCT
CTGCCTGTGTCTCTGCCTCTCTCTCTGTCTCTCATGAATAAATAAATAAGATCTTTAAAA
AATAATAAAAATAAATAAAATCTTAAAAGAAAAAATATTAAATATACATAGCAAAAGATC
ATTAAAGGAATTAAAACAGTGCACTAGGAAATAGTCACTTCGTGCAATATAAAGCAGTAA
GGAAATAAATTCTACACAGGACCATACCCGGGGAGTGGCACTCTCTGCCACCCAGACCTC
CCCGGGTGCCTACAATTCCCGGCATGCCTCATGCGACGCTCCCCCACGGCCAAGGTGGAA
AGGGAGGGGCTAATGGAGCTACCTCCTGTGAGTTGTAGTCTTGCTGCGAAGGAAGGAGGG
GCTGTGGAAGGTTGGTGGATCTGGAGCCAATGAAAAAGCACATCTTGCTGAGCGTCGGAT
CGAGAAGCCAATGGGCGTGCGGCTTGTGGGAGGCGGGACTTCCGGCAACGAAGTCTTGGT
GAGCGGCTGCGCGAGGACATCTACTTCCTTTTTGGTGTGGCGGCGAGAGCAGAGAGTACG
CTATGAAGGCCTCGGGCACGGTAAGGCGAGCGCGCGGCGGGCTGGGGGGCCGGGGAGTGC
AGTGCGGATCGAATCGGGGGCCCCGGCCAGCGGTGTAGGTCGCGTAGGGGAAGCACACTC
TTGACTGGGTCCCGCGCCCTCGCGCGCCATCGCTCTCGGGTGCAAGCCAACATGGCGGCC
ATTGCGGGCACCGCGTGGGGAGGCTTGTGCCGTGGGCCCGGCCCGCTGAGGAATCGCGGG
GGCCGGGGAGGCCGGGTCTCCTTTCCAGGGGAAGGGACAGGTTACGCGGCTTGGACGCTC
TAGTCACGGGACCTCGAGTTTTCAAGCCTCGGTTTTCCCGTTTGCAAAGTGGAATGGTGG
GAGGACGTAGTAGTATTTCTTTCCTACTGGCGGGGCTGTGAAAAGGTAGAAGGAAACTGT
AAACTCGAGCTGACACGGGGAGTGAGAGCCTTATGGCTGTGGCAAGTGCTGGGTAAAATC
CTAGGGCGCTGTGGTGCAGAGATGGAAGAGCAAGCCCTCGGGAGAAAACAGGGCGGGCCC
TGTACAGCTCCCCAGCCTCAGTTTCCATCTGGGAAAGAGGCCAGCTGCATAGGTCCGTTC
CTGAGCGGGTGGTATTTAGGGCTAGCTTTTTCTCATATTGATAAAACGTTGGCAAGTCCG
TTACAAAGATGGGTTCTTGGCACTATGTCACGGGGTTTGGCCTTGGCGGATTTTTTTTGT
CTTTGCATCCGTGTAAACAGAGTTTCCACTGGGAAATCCAAACCATTTTTATTGTTGCTG
GGAATACAGAGGCAGCTGCAGGTCCCATAGCAGCAGGACTGGGAAGGGAACTGGGTTCTT
GTCCTGGTTCTGCCTGGTGTGGGCTGTCAGATCCCAGGCTGGTCACTGTCTTTGGGTCCC
AGAGCTAAAGAGGACTTTGGGAAGATGTGAGCTGCAAAGATGTGTGGAGAAAGGAGGTTG
CAGATCTAGACTGCAGCTATTTTCACGAATATAAATGGAAAGGGAAGGACAGTGAGATTG
ACAGCCTTGCCCAGCTTTCCTGAGTCCAGGCAGAGGATACTTAGCCATCTTAGTTCATCT
TCCCCACCCTCAGTACCTATTCTGGGAAGTCTGGAACGGTGGGGCATGATCCAGTCACCC
AGATTCCTCATGGATGCCCTGGGATGGGGCATCCTGTTGTCACTTTGGGGATGCAGTTCT
CACCTGGGCTTGGGGAAGGGAGTAAGGTGAATCTTGACAGTTGTGGCAGGGCTCTGGGTC
AGGCCCCACCTCACCTCTGTTTCTGTTTCAGCTGCGAGAGTACAAGGTGGTAGGGCGCTG
TCTGCCCACCCCTAAATGTCGTACTCCGCCCCTGTATCGGATGCGAATCTTTGCACCTAA
TCATGTTGTCGCCAAGTCCCGCTTCTGGTACTTTGTGTCTCAACTGAAGAAGATGAAGAA
GTCTTCTGGAGAAATTGTCTACTGTGGACAGGTACAGGATGTCTGAGACTGGGGGGTTAG
GGGGAGCTGGAGTGGATTTATACCTTCTTGTGAGGGGCATTTCTCACCCCACAGAGTTCA
TAACCCCTGGCTTGTTCACATGCCCTAATTAAGCCCTAGTTTGGAATGTAATGGATACCT
CTTGTTTTTTTTCCTAATGAGAGAGCCCAAGGCCCAGGAAGCTGTGCCTTGGCATGCTTG
GATACTTTGGTTGAGGCCAGCACCTTCGCTGGGCCTCACGTATAAAGTGCGGAGAGATGC
TGTCACCTGGGTACATTTGCAGTGATAGGCACTGGACTCTGTATATCATACGCTGCACTG
GGTGGCAGCTGCTTTTTGGCCCAGATAGGTCTGAGAGAGTAGTTTTGGGAGGAGTTGAGT
TGATGGTCTCCATGGGAGAAGTATGCTAGCCTGGACTGTTCCGTACACCCTGCTGTTGCC
ATGGGGTTTGTCTAGTACAGCAGATTTCTTTCATATGCTCTCAGATTCAAGGACTGGGAA
ACAGACGCAAGAGAGGCCTGGGGCTGGGCTTTCTTTGGGAACAGCAAGGGCACAGGATCA
GTGAGTTGGACCTGGGTCGGAGCCCACTCACCACCCTGGCCTCCGCTATTGTCTTTGGCA
TCTAGGTGTTCGAGAAATCTCCCTTGCGGGTGAAGAACTTCGGCATCTGGCTGCGCTATG
ATTCACGCAGTGGCACCCACAACATGTACCGGGAATACCGGGATCTGACCACCGCAGGCG
CCGTCACCCAGTGCTGTGAGCCATGGGGCCTGTGCCCAGTCCCTCCTTAGACTCCTGTTG
CAGCCATCTGCAGCCCATTGGGCCTGCGCTCCCCTCTTCCCCAGACTGAGGCAGGACAAA
TGCAAGAGGCTTCTGGGATTGGAGGGCGGGGATTCCTGGGGGTGGTGATGGGGGATGCAG
AGGAGGTGTTTGTGTAGGGAGCAAGAGTAGAGAGGATGCTCCAGGTACATCTTTTTCTGG
AACCTGGCAGCAGGCGAACCTGTGGAGTTGATGACTTGTGTAGACATAATTCCCACCCAG
AGTCTAGCCCGGGCCCTGTCAGTCAGGATCTGGTGCTAGTGGCCCCAGGCACACATAGAA
CAAGTTAACCTGCCAGGGCCCAGACCCCAGCACCTCAACCCAAGAACTGCTGTTTCTCAT
AGCAGCGGTTTAAACAGAGGTGCTAACAGCAAAGTGGATCTCGTCGCCTTTGGGGGGCTG
TGGCTGTGCTCCTCAAAGTGAATTTGGAGGTTCTACACCCCTGATAATGCCAGCACCTGC
TAGAGTCAGAGGTTATAACCACCTGGTCCCTAAGTTGGGGTACTTCTAGGCCAGCACTCA
ATGGGAGGTTTCAGGAATGCCCAGATGTTGGGGTACACATTTGCCCTGCCTCCCTCCCTG
CAGACCGAGACATGGGTGCCCGACACCGTGCCCGGGCCCACTCTATCCAGATCATGAAGG
TGGAGGAGATTGCAGCCAGCAAGTGCCGCCGGCCAGCGGTCAAGCAGTTCCACGTGAGTG
CTCTGAGGGCCCTGTTGGGTAAGGTGGGTGGGCAGGGGGATGACACACATTCCCTTGGAA
CATGGAGCTGGCCCAGCTGCTCCCCTATCCCCTAGCCTTGGGAGCTGCAGGGAGGGACTG
GGTTTGACGCAGGAGCCCAGTGGGGGGTGGCCACACTTCAGTGGCCCTGGAAGACAAGGT
TGAGAGGCTTTTACCTCCCTCACCCACCTCTCCTTACCACAGGACTCCAAGATCAAGTTC
CCACTGCCCCATCGGGTCTTGCGTCGTCAGCACAAGCCACGCTTCACCACCAAGAGGCCC
AACACCTTCTTTTAGATGCAGAGCGTGCCGGTGCCCAAGTCTGCTCAAATAAACTCCTCG
GGTAAAACCAAGGCGCTCAGACACATTTGTTTTCTTTGTACACCCTGCAGAACTCAAAAG
GGCACAGCCAAGCTGTGAGTTCTCTGCCCTGGGAGGGCTTCTCCTCTCTTGAAGTGGGGC
CCAGACACCTGGTTTCTCCAGAATGGGAGCCTCCAAGAATGGCAGAGGCCACACCCCCCC
AAATGCTCTCTCTCCTGCCTACTTGGCTCCCCAGGGCTGTTAGCAGGATCCTAGAGCCAG
AGGGCCCGGTTTTCCGCCCTATCAGGTGGCTCTCTGCTGTGATCTTTGTCTTGCAGGCCA
CAAGATTTGGTCCCTAAACCTGTCCTTCCTTGTTAGATAACAAGCTTTGGCTTCCCATAC
CACAACCACCATGTCTTTGGTGAGATGTGGGCAGTCCGGTGCCTGGAAGGAATCAGGATT
ATAGGGTTGGTTCATGCCACATGCAGATTTTCCTCTCCAGGTTCAGAACCCTGGTCTTTG
AGTCCAGGATACTCAGGCCAGACATGAGGGGGCGCCAGAGAGGACCAACAGCTTGCTGTG
CTATGGCTGTTGTCCTTCACTAGGTGGGGCCCCCTTGAAGGACACCCTGATCCTGCCCAA
GAAGGTCAAGGTCTCACTGTGGGTCTCTGTCTCCAAGAAACCACTTGAGGCTCGAGGGAA
TTCCAGGCATGAAGCTAATCCCACCCTGGCTGAACCCCCTCAATCAGGACGCTGAGGCAC
AGCTAGGAGCACAGATCTTGGGAAGCATCAGTCCTCAGTGCATGAACTTGGGCAACCCTG
GTCTGCTGAATGAGTCTTCATCAGAAAGTTAGGGGGCTCAGCAGATTTATTCACTTGATA
CTTGGGAGAGTCAACTGTAGGCACTGGGGGGCAAAGGTCAGTCAGAGATGTGACTTCTCT
TCCAGAGAGCCATGGAATAGATCAAGAAGCCAGAGCACAAAAAGGCAGTGTGGGGTAGGG
GCCAGGGCAGCAATCAGGCCTGCAGTATTGCAGGCAAGGGTACAGCTTCCCTTCCCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 2311..2490, 3125..3254, 3903..4012, 4242..4399
1022..1039, 2311..2490, 3125..3254, 3903..4012, 4242..4331
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved