Canis_familiaris Locus GNL3
snOPY snoRNA Orthological Gene Database
Canis_familiaris GNL3
Canis_familiaris
GNL3
20
SNORD19, SNORD19, SNORD69
4061..4137, 5010..5084, 6189..6265
8916
TATCACAATAAAACTACGCTTTCGGTAGAAAATTTTAAGAGGTGGAAAATTATTAAAAA
CCAGGAAACGTACAATTTTAAAACCTCGATTTTCCGTGCTGCTGCAGAGAAGACACTTCA
GTATCTAGCCTCTAGTATAAATACAAGTCTCACTCAAATACACACTCAGTCTGAACACAG
TCATCTAGAGAAGGTAAAAAAAAAAAAAAAAAATTTTTTTCACACTAGTTGAGTTTGCGT
CAAGAAACAACAACAACAAAAAAAGGAGGCCCTGACCTGTGAAGAAATGAAAGACTTTCC
GGACCTGTCACTGGTACCGGGACTAGGGAAACGTTGACAGCTTTGAGGCTGTCGGCGACG
AGGGCTCTGCCGGCCGCCGGGGCGGGAAAGAGCGAGCGGGAGCTTCCGGGCCGCGGCGCG
CCTTTGTCCGGCCGGCAGGGCAGGTGCGGCGAGGCTGCCTGGCCGTCCCGACGCCCGCCG
CCGCGCCCCGCCCCGCGCGCCCAGCCCGACCGGCGCGTCCCCACGCCGGGGCGGGGCCTC
CGCCGCTGCTCCCGCCCGCCCGGGCCCACACAAAGGCCCGGCAGCCGGCCGAGAGGGAGC
GGCCCCGCCCGCCCCGGGCCCGGCCTTACCCAGCCGCTCCGCCGCCTGCAGCCCCGGCCG
CGGTCGCCGACCGCCGCGCCCCGCCCCGTGGCCGCCACGGCTGCTGCTATTGCTCCTCCG
GCTGCGGCCGCCGCCGTCGCTCCAGCACCCGCCGCCCTCACCGCCCTCACCCCTCCCGGT
GCCGCCGCAAAACCAGCCCTGCGGCCGCCAAGCGAACCCGGCTCCGCACGACACTGCGTG
CGCGCGCGCGCGAGCGGGCGGCGGCGCGCTTTACGGCGGTAGCGTCGGTGCGTGACGCTC
GGGCTTGGCTGCCTGCGAGTCACACGTGGCCGGGGCGGAGGCGCGTTGTTGCTGCTGCTG
CCGCCGGTTACGCCGCTGCGACCGCCGTTCCCGCTCCCAGTATGAAGCGACCGAGTGAGT
ACGGCCGGGGAGCGGGTGTAGAGGGGCCTGCCTCTGACGGTCGGCGAACCGTCGGGGCGG
TCTTCTGAGGGAGCGGGGGAGCCTGCGGGCAGGCCGCGGCGCGGGTCGGGAGGAGAAGCG
AGTGGGGGAAGGCCGTCGTTAGCCGCCGGCCTGTTGTGCGAAAGGAAGACAGCAGTGAAG
GTCGCTGGGGCGCCTGGGTGGCTCAGTGGGTCAGGTGTCTGCCTTCGGCGTAGGTCACGG
CCCCGGCTTCCCGGGATGGAGCGTGGGCGCCCTGCGGAGCGGGGAGCCTGCCCCTCCCCC
TGCTCGTGTTCTCTCTCTGTCAGATATGTTTTAAGAAATTAAAATCACGCCAGATGGTCC
TGAGTAAACCGTGTCCGTCCGAGCCAAGGTTGCGGGCCCAGCCTCTTCCCTACTCGGCCA
TGTTGAGAGGTCTGAGGCGGGCCGCTGAAATCCGCTGCTCGGTCCTAACTTGTGATTTGC
GGCCTATGACGAGAAGGGGCTGCCATCTGGGGGTCTCCTGCTCTGCTGTGCGGTTTCAGT
CTGTTACGGAAAGAGCGAGAGCAGGGAAGTTGGGCTCTGCTCCAGATTCTTTGAGATTTT
AGAATGGCCTGTGTTTGTAATCCACCACATGTGAGTTTTAGGTTTGAGCGTTAATTGCTA
AGCAGGGAAAGGGACGTGACCCCTGAGCCCGGTCACTAAAAACTAAACGGATCCTTTGTG
TCTAATCCTCTCGTGCTGGGTTTCTTTGTAGAGTTAAAGAAAGCAAGTAAACGCATGACC
TGCCATAAAAGGTATAAAATCCAAAAAAAGGTAAGTGTTCTGCTTGGAACGCCCATGTTC
AATATAACGCTGAACTGATTTCTGTCTGCTCCACCTTTCGGGCACAAGGAGGTTTGGATT
AATGTGATTTCATCTTACAGAATTGAAGTTAATTACACTCCATGGGCACAAGTTCTTAGA
CCTCAGGAGTATAGCTGTGGGAAAGTGCAGTAATTTGGTGATAAGTCTGCAAACTAATCA
ACGTGTTAACCTCTGCAAAGAGTCTCCTGGTGACTGTTTTGCTGTTGTGTACATAAATGT
TTGTTTTCTCTATGGTTACAACTTAATTTTCTTGGCTTATTTTACAGGCATAACTAATTT
TAGCCAGATTGGCTAGTAAATTTTACAAATGGATAAAAATTTTTATTATAATAGGTTCGA
GAGCACCATCGAAAATTGAGGAAGGAGGCCAAAAAGCAAGGTCGCAAAAAGCCTAGAAAA
GACCCAGGAGTTCCAAACAGTGCTCCCTTTAAAGAGGCTCTTCTTCGGGAAGCTGAGCTA
AGGAAACAGCGAGTAAGATATGTTAGCTCAAACTCTGAACAAGTGATGCGTGGGTATGTG
GTTTTTGAAAGTAAAGTAGCACCACATTGGTTTGGCTCACTCATTTCTCTTATGGCTTGG
ATGCAGCTTGAAGAACTAAAAGAGCAGCAGAAACTTGACAGGCAGAAGGAACAGGAAAAG
AAAAGAAAACTTGAAACTAACCCTGGTGTTAAGCCATCTAACTTGGAACCTGTGAAGGAG
GTACGATTAAGTATCTTTATGACTGAGGGCAGCCCCGATGGCACAGCAGTTTAGCGCCGC
CTGCAGTCTAGGGCGTGATCCTGGAGTCCCGGGATCGAGTCCCACGTCAGGCTCTCTGCA
TGGAGCCTGCTTCTCCCTCTACCTGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTCTCCTC
TCTCTCTCTCTCTGTGTCTCTATGAATAAATACTTTTTTTTTAAAAAGATTATCTTTATG
ACTGAGAATTCTGACAGAAGTAAAAACATACCCAGGGCAGGGGATGCCGTGCTTTGGGCA
GAAAGACTATTTTGACTCTTTTTTACTTAGAAATGTCACCTGCAGTGCCCCTAATTAGCC
ATGGAAAATGGAGAAATAGGTACAGCTGAAGTGCTAACTTGGTGTCCTTTTTCCCTTGTC
TTTATCTTGCAGGAATCTGGGCAGTGCAAAGCTAAGGACAAACCCAAGTCAGGCAAACAG
AATCCAAAGAAGTTGTATTGTCAGGAACTTAAAAAGGTATTTTAGTCTAGGTCAGTGTCT
AAAAATGGTAATGAGGTTGAAAAGACTAGAGAGATTCTTTTTTTCTGACACCAGCCCTAT
AAATGTGGAAGTGGAGTTCACTTGAGATGGATGAATCAGCAAGTTGGCATATCCTAGTTT
TAAAAGTTTTTATTCTTTGTTTATTGTGGTTTATCCTATTTAGGGCCTTTTCTGTTTAGC
TGCAGGAAGTATTCTTAAAGTTTAAAATTTTTGCACAGGAACAGTTCCTATAAGCATGAC
TGACAAAAATGGTACTTTGTGTTAAGTAACATGTTGATAGTGGTTTCTAAAATAGATGAA
GATACGTCGGAGCAAGCAGTGTGGGGAAAAAGTACTGTTGAAACCTAAGTGAAGGAAGAC
AAGGCAGTGTCTTGGCGTAGTTGTTCCCCAGAACCCCCATCCTAAATACCCGTTTTCCTA
AGCTCACTTCCCTCCATTAATAGAACAGGACTGCTGGTCAGCATCTCGCGGCAGGGCCAC
AGGGCGTATCACACTACATAATTCATTGTGGAAGGGTTGTATATTCAGACAATGGAGATA
TTTCTACTTTTGAAATCCACTTTGTCAGGAGTCCATAGGCTGCCAAGCAAACCTGTGTTT
TACTTTCCTGTGAGAAATGAACATGTGAACATTCTTCATGCCAAAGTGAGGATCTAAGAT
CTAACTCTGAGTTCACCCTGTTGCTAAGTGGAAAATGCCAGTGTACTTGTGTATGGAGGG
TGTTGCCAGAGCACGGGATATTTCTTTGATAGTTTCTGCTTTGACAGGTGATTGAAGCCT
CAGATGTTGTGCTGGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGGTGTCCCCAGG
CAGAAGAAGCCATTGTCCAGAGTGGACAGAAGAAGCTGGTACTTGTATTAAATAAATCAG
GTGAGCAGAAGAGATGCCTTTTATGTTCCATATGCACTAGCGAGGTATGAGGAAAACATG
TGAGCAGTCTGATTTTCATTGAAGACTGATAAGATCCAACTCTGACCTCAATAAAGCCAG
TGCATATGGTCTTGTTACTAAAAGCAATGCTGGGCAATGGGATTGAGGTATTTTCTATAA
GTGACTAACAGGTTTCTACTTTTCTCTTACTATTTACTACTTTGCCATCTTGTCTTATTT
AAGAGTGTAAGCTTCTCTACTCTGCTTACTTATTAATCTCACATAGGGAGTGATGGTAGT
TTGCCATATTCACCACATCCACATAATGTTCACATATGACAATATTTATATAAAGTGTGC
TTAAAGGAGTATTGGTTTGAACATCAGGGCCAGGAAAGCCCAGAATAGAGATTTCATGAA
GCAGAATGTAAAATAGCATCTGCAGTTACTGTTGGGGCCAGTAAACATGGCTGTTACCTG
AGAGTAAATTCTGGAAACACAGCTCTGCTGTTAAGTTAGGGTCATAATCTACTGGTTGAT
TTAATTCTGAAAAGGTGAGCAGTGCAAAGGGTAACTTAAGAAATATAGGAGGGTAGATAC
CAAACTCTGTCGAGATATAGGCAGTGTAATAGGGAGCTTACTCTCTTCCTATCTTCCATC
TGAATTCTTTTTTATTTTTATTTTTATTTTTATTTTTTTTTTTGAATTCTTTTTTAAAAA
CTGAAGAGACAAACCAGAGTAAAATCCAGTTTACCAAATATTCATATTCATCTCAATAAA
ATAACCAAATTGGAGTATGTGTCTTGTTCCTAATCCCTCTTAGATTTGGTACCAAAGGAG
AATTTAGAAAGCTGGCTAAGTTATTTGAAGAAGGAATTACCAACAGTGGTGTTCAGAGCC
TCAACAAATTTGAAGGACAAGGGCAAGATAATCAAGGTACGCTTTACAGTCAGTGGTGGA
AAGTATGGTTCTTTCAGATTTTGAATGGCTGAAATATGATGAGCATACAAAATCTTGATT
AAAAAATGAGAATTTATAAGATCCAACTCTGATTTCATCCAGAGATAATCTGAAAGATAA
TAGAGTGGTGATTTTAATAGCTGGGCTCTGGAGAGATTGCTTGGGTTTTATCTGGTGGGT
TATCAGAAGTTTAATTATTTGGAATTTTAGCACTTGAAGGTCAGGAAGAGAACTCCCTTC
AGAAATGAAGTCTGTGTTGGGAAAGAAGGCCTTTGGAAGCTTCTTAGAAGTTTTCAGGAG
ACTTGTGGCAAAGCCATTCAGGTGGGAGTAATTGGTGAGTTTCAATTTAACACGCTTTAT
GTCTTAAGTGTCAAGGTTTTATTCATGTTAACAGTGTATGAGGTTGGTGCTCAATAAAGA
GCTTGTTCAAACGTTGGCTTCTTGCCCGTTTAATGAAACACGCTCAAAAACTTTAATTCC
TGCCTATTCCAGTGCTGTGCACTATAAGAAGTTGGCTTCTAAAAGCTCCTGATTATTTGA
ATTAATCATCTTTTCCTGCTCTTTGATTACTTGTGCAAGAAATGAAGACTCTAAGATTGG
TCTTAGTGTTGAAGTGAAGACACTCAGATCCAACTCTGATCTTGCTCCAAATATCGGGCA
AACCTAAAATAAGGCAGTGGAAATTTTATAGTTACCAGTACATAATGCCTTTTGTTCTAT
GGATTTCCCATTTGTAGGTTTCCCAAATGTGGGGAAAAGCAGCATCATCAACAGCTTAAA
ACAGGAACAGATATGTAATGTTGGTGTATCCATGGGGCTTACAAGGTAAATTGAGTTCTT
CCATAATTGTGCTATTTCATTATAGACGATTAAACATTATTTTGTTTTGGATAGCTCAAG
GAAGACCATTTTCTATTTTTTCTTTAGAGGTGTCAGTGCAAGGAAAGGGTTAAGTCAGTG
CTAGGCTTAGGGAAGAATTGATTAGAGCGGAACAGCTCACATCTAGTTTGAAAGGCAAGC
ACATAGATTGAGAGAAGGGGAAGCTGCCTCAGAAGAAGGGATTCTTGAACCCAGTACTGA
ATCGAAGTCAGTTATTTGGAGGGGAAATTTTTATGGCAGAGGAAACAGCATGTGTCTAGG
TCAACCTAGAGGTTATAAATACAGTGTTTTTCTTTAGAAGGGGAGGAGCACTGTTAGAGT
TTCAGATAAAACATGAAGCAAATGATGATAAACTGGATCTGACAGACTGTGCTGAGTTTG
TTCAATCCAACCCTGAGCTTCGTGTTCTTCATCCTTCAGGTAAACCAGTGCTCCCCTCGA
TTACTATCCCTCTTTTTCCAGGTACATGCAGGTTGTCACCCTGGACAAACAAATCACAGT
TGTAGACAGTCCAAGTTTCATTGTGTCTCCAGTTAACTCTGCCAGTGCACTTGCTCTGAG
AAGTCCAGCAAGTATTGAAGTGTTGAAACCAGTGGAGGCTGCTAGTGCCATCTTGTCCCA
GGCTGATGCTCGACAGGTATAAGAACCCAGTTCCCTTGAGCTCCATGTTCTCTTTCATCA
TAAACATTTTTAAGTAGGAGGTTTTCAAGGTTTTTGTTTTTTTTTTTAATACTATATCAG
ATGAATAATGTCAGTTTTTCTTTTTTAAGGTAGTACTGAAATTTACTGTTCCAGACTTTA
AGAATCCTCTGGACTTTTTTACATCACTTGCTCAGAGAAGAGGACTGCACCAAAAAGGTG
GAAGCCCAAATTTAGAAGGTGCTGCCAAACTGATATGGTCAGAGTGGACAGGGTAAGACT
TTTTTCTGTTGGCATTTTGAGGATCACATGGAATGAAGGAACTAATTATTTACAAATCTT
GTTTTTAAATCTAGTGCCTCCTTAGGTTACTACTGTCATCCCCCTACATCCTGGACTCCT
CCTCCACATTTTAGTGAGGCCATAATGAGAGACATGAAACAGGGCCTTAACCTGGAAGAA
CTGGAAAAGAACAATGCACACAGCATACACAGTAAGCAAGTCTTGTGTTTACTGTCTTCA
TTGGCTGAGAGGCCAATAAAAGGTCTGTTTACATGACCTGTGTTCCTTCCCTAGTCATCA
GGGGCCCTCGTTTAGCCAGTAGCATCCTTTTCCAGTCTTCGGGTCTGACAAATGGAATAA
TAGAGGAAAAGGACATACCAGAAGAACTGCCAAAACAGAAAGAGAAAAAACAGGAGGAGG
GGGAGGACTGTGATGATCTTGACAGCGACCAGGATGGTGTTGAAGAATCAGCTAGTATAA
GTATGTTGCATGTGAGTGGCTTAATCTAAAGTAAATTTTCAATGTTTAACAAATGGGAAG
GGGCTGAAGAGACAAAGTAAACAGTTCATAACAGACTACAAGAAACCTTTCAAGATTTAG
GTATTTAAGGCTTGAAGTCAATAGTCTTAATTTTGTCTGCCCTATCATGTGTACCTTCAG
AGTCTTTTTCCAGTTATTTAATTTCTTAATGAGCAGATAAGGGCTACTAATTATGTACTA
TTTCTCTTTGTCCCACAGGAAAAGAGTTCAGAGATGTCCAGGGCAGAAGAGGCCTGGGAG
GCACCACCTGAGGAATCTCAAGCAGGTGGGGCATCTTGGGTGGAGGGATTTACTAACAAA
GCAACATGGTGTGGAATTGCCTTTTTTTTTTTAACCTCACTTTTTATTTCCTCCAATATA
GATGGGTCAGCACCACCTTACATCTCAGATAAAATGGCTGAAGAGGAAGATGATGCTTAT
GACTTCAGTACAGACTATGTATAACAACTTCTCCCCTTTATAAGGTGGTTTTTTAACATT
TTTGAGCTACTAAGCTGTAACAATGTATGATGTACCAGTTACAGTGTGATGTAAAATGTA
AATTTTGTGAATATCATGTTCAATTTAAAGAATAAGGCAATTTAGAAGGTGTCTAAATTT
TGTAAGACAATTTCTTTCTTATACAATGAACGGATAGAAGTATAATTACTTGGAAGCAAA
AAAATGAGATACCTATTGAAAAATGTAGGTTTCACTTTATTAACAGATCAGACCACAGGT
TAAGGTTACAAAATTAAAACCAAGCAGCAGTGTTGAACTAGCTGTACCAATCCTGTCAGT
CCATTTACCTCTGGTCATTCAGCACGGTAGTAAGCAAACACTTGTTGATAAGGCAGATGG
AGACATTTATAGTCTATCTGGGAAGCCAACTGATAGACGGGGTAGTCTGTCCTCTTTACC
CAGCTGAAACATCCCTCTTTCCATGGGTTGCTGCAGATAGGCTTTGAAGCCTTGCAACTG
TTACTGCCCACACATACTGTCTTCCAGGATTTCCTGAGAAATGCTTACAGCATAAATTAT
GTTTTATTTTATATTTGAGATCTCCATATGTCTTCGGATCAAGCTGAATTTGCCTGTTGG
GTCTGGAATATACCATTTTTCCCAGATCTCAGAATAGGAAGCAGTTCTTCCCCATGGCTT
AAAGTGACCATTCCAGTGGAGTAACTTGGCAGCCTTTACAAACTGGGGTGAATATCGTTT
TCCAGCACTGGAACCTTACATTGAGAGAAAAAAAAGCCAAATGTTTGTACTAGTGCCAGT
ACCAATCAGAAATAACTGTACATCAAACTGCAGAAAACTTTTTTTTTAATTTTTTTTTAA
TTTTTTATTTATTTATGATAGTCACACACACAGAGAGAGAGAGGCAGAGACATAGGCAGA
GGGAGAAGCAGGCTCCATGCACCGGGAGCCCGACGTGGGATTTGATCCCGGGTCTCCAGG
ATCACGCCCTGGGCCAAAGGCAGGCGCTAAACCACTGCGCCACCCAGGGATCCCTAAACT
GCAGAAAACTTAAAGGAAACTGGATATATTTCATCTTGAGCATAGTTTTTCAGACGAGTA
AATCTTTAATCCTTAATTCTTTTAATTTTTTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1771..1829, 2214..2351, 2466..2579, 3012..3095, 3887..4019, 4843..4955, 5190..5313, 5717..5804, 6321..6495, 6629..6771, 6848..6990, 7074..7255, 7518..7584, 7681..7916
1001..1013, 1771..1829, 2214..2351, 2466..2579, 3012..3095, 3887..4019, 4843..4955, 5190..5313, 5717..5804, 6321..6495, 6629..6771, 6848..6990, 7074..7255, 7518..7584, 7681..7760
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved