Canis_familiaris Locus RPL32
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPL32
Canis_familiaris
RPL32
20
SNORA7
2256..2395
7840
CCTGCTCTGCATCCCATCTGACTCCCCGAGCCTGCAGGATAAGCAGGATTCATGAGGTG
TGGTATAGTTACATGCACAAATGGGTTCTAGACTCAACCTTATTGCTGACCAGCTGTGTG
ATCTCAGACAAGACATTTCACATTTCCACTCCTCTGGGTCTCCTTAAACTCCCCTACCCT
TTACAGTCAAAATCTCACGAAGGAGTTGTCAACACTTTCTTCCCTTCTCACTTCTCATCC
AGGGAACAACACAATCCAGTGTAGTTTCTGTCCCCATCTGTCCCCTGGAACTCTCAAGAT
CAGTGATGACATCTGTATTGTGTTCAAATTGTGGAATCAAGGCGCATTTTTTTTAATCCT
GAAATGTGATTTATTACAATAATCTTAAAAACGAAATCTAAGTAAGACAATACCAAGAAC
AATTTAAAACTAAGCAGGTGAAAAAACTAAACTAAACTAAGCAGGTGAGCCTAATGCTTA
GAAGTGTGGATTTTTGGATCGAAGCCCCAGACTTCACTTTCTACAGCTGTAAAATGGGGA
AAAGAATAGAAGTACTACCTCACAGAACTGTGGGAAGGACAGTAAAATCCATGGAATGAC
AGCTCTTGGGGGTCTCATTGCTATTTCACTTTATACACTCACGCGAAGGAATTAGGAAGT
CTCTGTTTCGTTCCCTCCTGGCCACTAGGAGGCGCACTCAGTAGCAGGAGAAACGCGGGC
GGAAATAATCCAAAAACTGGATCATTCTCGGGAGGAATGGCTTCAGTTTCTGGCGGAAGT
GTACGCCCTCCACCAGGTCTTAGAGGCTCAGAAAAAATTCCAAATTTTCTACGTAGTCCC
AACAGCAGGTCTGACAAACTTTCAGTACTACTCCCAAATATTAATCTCTAGGAAAACAAA
GTTATCTCTGGACTTTTTTCCGTATTATTTCCCTGAAGTGTCCTTCTTTTCTTTGAGGGA
CCAAGACCCGGAAGCGCTCTTTTTTTCCCCTGCCAGGACCCAGAGGTTAAGTCCCATCAG
GCCTCGCGCGCCACCTTCCCCTCTCTTCCTCGGCGCCGCCTGCGGAGGTGGCAGCCATCG
ATCGCTGGGTGAGTTTTAATCTCTAGCCATCCGCGTGTGTGCGGTGTTCGTCGGGTCCTG
TCGCTTCCTGGTCAGGCGGCCTGCCCTTCCGAGCTGCAGTCCTGGTGGGCTTTGTCCCTG
TCGGTGGGCTGGGGTGCGTTCAGGAGCAGAGCGCAGCGGCCCAGCCGTTGGCGGAGGTTG
GCCTCCCAGGGCCCCTTGCCGTGCCCCGGAGCCGCCTGACGTCTCTGAGGGTCGCGGGCA
GCTTGTCAGAGCCCTGGGAGTGAGGGCCGTTGTTCGTGTCTGGCCTAGGGGGTCTTGTGG
GGGCCGTGGAGCGACCGAGGGCTGCGGCGTGTGACCGGGACACTCGAGTCCCCTTGGCCC
GGGATGGGTGCCGCGCCGCGTGCATTTTCTATTTCCGCCGACCGACGCTCCCGTGCAGTT
CTGTGGTCTCGGGGCTGCCGCTGCGGCCAGACCGCCACACGGACAACCGGCACGCGAGCT
GAGAGCCGCTTGGTTCGCGTTGACAGGAAAGCCAGTAGCGAGCGGGTCGGGTCTCTGGGA
ATATAAAGCCGCGTGGTCGTCCTCGAGGAGGTAATGCTGCGGGCCCGGGTGCGCTCGTTT
ACCGGCCACAGAGGCGGTGACGGGAACGCGGTGCGCTGCCGCTTTGAGGAAGGTTTTTAT
TTATTTTTTTAAAGATTTTACTTATTAATGAGAGAGAGAGAGAGGCAGAGACACAGGCAG
AGGGAGACGCAGGCTCCATGCAGGGAGCGCGGGTCTCCGGGATCACGCCCTGGGCCGAAG
GCGGCGCTAAACCGCTGAGCCACCCGGGCTGCCCATTGAGGAAGGTTTTTAATCGATCCT
CGGATGATCTCCAGGTAAGACGGAGAGTTCGGGGGGCCTAGGAACATCTTACAAGGGCAT
CGTGGTTTTGTAGGTCCCCTGAGGGGGAAACCCAGGTTCCTCTACACACCTCGGGCGCCC
CGTGTGCCGTATAGCGTTCCCATTTTACGGGGAGGGAACAAAGACTCCAGTGCGTGTAGG
TTGCCCAAGCTCTGCGTAACTGATCGGAACTGGACCGTGCGCGGCTCGTGGAAGTGGGAT
TTGCTGCCCTGTGGCAGCCGAGAGCGTGTGAGGGACAGTCCGTCTCAGATCAGCTGCTAG
CAGGCATCCTTGACTTCAGCGGGGGCGGTGACCCCTGACCTCCCAGGATCGCGTCTGGAG
AGTGGTTGGTATTCTGCCAGCTTCGGAGGCGGGAGGGACAGCAAGCCTGGCAGAGGTACC
CATTCCATTCCCAGTTGGCTCAGTAGCTGGTGATTGGAAGACACTCTGCAACAGCATTCA
AGCCTTGAGCCGGGAAACCTCCTTCCGGGACTGCTTGACACCGTCTCTGCCTCTCTCTTG
AAGGCATCATGGCTGCCCTCAGACCTCTGGTGAAGCCCAAGATCGTTAAAAAGAGGACCA
AGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAAGGTGCATACATATGGTA
CCGGGATGGAAGTGTTCGTTGGGGGGTGGGGTGGGAGGGTTGTTCCTAAATGGGCTGTCG
GATTTCTGGCATCACCTGGTCAGATCACCTTTGGCAGGTGGACCAGTCTGGTTGGTGGTA
GAGCTCTCTAGAAGCCAGCTCTCCAAGTATGTCTTACTGGCACTCGGTCACTTGATTAAA
TGATTAGGGGCACTTGGCTATTTTCAGGCATCTATCTAGAGGCTTGAATCATTTTAGGTG
GCCTTAGGAGGCTGTTAGAAGTAGATCCTTATTTTATGATGAGAAAAGTTAACATCTTAA
GTGCAGTGATGAAACCTATGCCATTCAGTTTTGTTTTGTTTTAAGATTTTCTTTATTCAT
GAGAGACAGGGGGAGGAGAAATAGGCTCCATGCAGGGAGGGCAATGCAGGACTCCATCCC
GGGACTCCTCAGGGACTCCTGAGCCAAAGGCAGCCACTCAACCACTGAGCCACCCAGGCG
TCCCTGCCACTCAGTCTTAACAGTACACAATCCCTTCATGTTCTGTCAGTTTGTAGTCTA
TTCCTCTGTTTATTAGGAGTGTGAATGTGAGTCTTATTCCTGGTAGTCAAAGGCAGAAGC
CCTATTATTTTCCACCAAGAAAAATCGAAAGATGTAGTGAAATACTTAAGGACAGCTACT
ATTTGGTATATTTACTTTTCATTGAGTCCCCTTTTCCTTTCAAAAGGAAGAGTTGTTAGC
AAAGAAACTAACCCTCCCATGTTTATTTCAGCGCAACTGGCGGAAACCCAGAGGCATTGA
CAATAGGGTACGCAGAAGATTCAAGGGCCAAATCTTGATGCCCAACATTGGTTACGGGAG
CAACAAGAAAACAAAGCACATGCTGCCCAGTGGCTTCCGGAAGTTCCTAGTCCACAACGT
CAAGGAGCTTGAAGTGCTGCTGATGTGCAACAAGTGAGTTGGGTCCCACCTCTGGGTTTA
GGAATCAGTCTGCATCTGAGCATTTTTAGTAGGGACTCTAGACTTCATAGAATACATTTG
GAAGAGGTGTGTTTTTCTCTCAGGAGCTTAAAGAATGGTTGTTGGGGCTTTGAAATGTTT
CCTTTGCTGGAGCAGGGTAAGGGAACTTGTCCTGAAAAGTGTAGACACCCAAGACCTGCA
AAGAGAAGGACTTTGCCTAACAATAAAAACACTGTGGTATTTACTGTCAGTTTTTTGCAG
AATGTTGCTTTATGTAGAAGTGGGGGGGGGGGTATCAGACCTAAGGAGCACCTTTATGCT
GTGTCTTCCTTCAGAAAGCTATAGGAATATAGACGAGTTGCCTGATCAGAGCTCTGTGAT
CTGAGGTGGAGGGAAGGAAGAAGACTTGGCAGAGGGTGACTTGCACAAAGTTGTAGAGAT
GCAAGAGTGTATGGAGGGTTCACATCATTACTTCCAAGTATTTTGAGAAGACAATTTATG
AGCTCTGTGTGAGAAACTTGTAGTCTGCTTGGGTCAAAACTATGTCAATGGGATGAGAAA
ACATTTAACACAGAAAGTGATTTAGTTGCTTTGAGTCTGGGTTAGAGGGAATGGTGTTTT
TTGGTTAAGCAGAGGACAATTTGCTTTGCTTCTATTAAACAGAAACTGAAGACTTGTGTT
TTCCTAATTAGGACTTGGAAAGGGTGACTAATTGTAGCATCTGTGTGTGTGCTTACAAAG
ATCTTTTATCTATAGCAGTTGTAGACACAAGTAATAGAAATAAACGAAGCCATTATTCTC
TCTTTGGTTGAGTTCTCTAGGTTGGGAATTTAACTGGATGTTAAAATGCTGGGGAATTTC
CTTAGGAAATTCTTGGATGAGCATAGGAATTAGGGGTGGCTACCTGTTAGGTGGATCAGA
ATTGTGACAGAAAGATGCAGTCCCCGTTGGGTAGCAGAAATGCTGCTGTGCAGATGTTGC
TGGTTGCCAAAAAGATTACTAGCTTGGCAGTTTGTGTCAGGAGCCATAGAAATATTTGGA
ATCTGTGACCTTTAATCCACAAGTTCATTTCTGGATATTTATCCCTAAATGAAAAGCAGG
GAAACTTTGTGAAACTGATAATTGCAGCAGTAACTGAATTGTTGAAATATAATTTGTGAA
TGGTGAGATTGCGAGCACTGGGTGAATGTTACATGTACATTTAAAATGATTGTTATGTGT
GGAAAATGCCCAGGTAGAAACTAAAGTATTTAAGATGATATGTATAGTGACTGGAGTGTT
AAATACACATGTGGACAAGGACCTGAGGAGTTTTTGAGAAAAAAGATTTCAATGTTAGAA
AACAGATTATATCAGACTATTTCAAAGTATAGCTACTTTGAGCTTGAGTGGACTCTTATG
GAAGACAAAAAAGTTCTTTGAGTTGCTTGTCTCACTGTTAGGCTATTTTGCTAGAGTTGT
TTTTGTTTTTGTTTTGTTTTGAGACTTTATTTATTCATGAGAGACACAGGCAGAGGGAGA
AGCAGGCTCCATGCAGGGAGCCTCATGTGGGACATGATCCCGGGTCTCCAGGATCAGGCC
CTGGACTGAAGGCGGTGCTAAACCGCTGAGCCACCCAGGCTGCCCATTTTGCTAGAGTTC
TTAAAAAGAACTATGTACGTCCATGGCCTTAGTCATTCCTTACAGCTTGCTTTCTCTCTT
TGCTGAAATTCCGCCAGGGGTAGAGTGCCCTTTTTTATTTTAAGATTTTATTTTGGGGGC
TACTGGCTGGCTTAGTAGAGCAAGTGACTTTTGATCTCAGAGTTGTGAGTTCAAGCCCCA
CGTTGGACATGGAGCTTACTTAAAAAGTAAATAAATACAAATTTTGTTTTTAATTTTTTT
TTTTAATTTTTATTTATTTATGATAGTCACAGAGAGAGAGAGAGGCAGAAGACATAGGCA
GAGGGAGAAGCAGGCTCCATGCACCGGGAGCCCGAAGTGGGATTCGATCCCGGGTCTCCA
GAATCGCGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCTTGT
TTTTAATTTTTACATAATCTCTGTGCCCAGCATGGAGCTTGAGCTTGGGACCCTGAGCTA
GGAGTCGCATGCTCTACTGAGTGAGCCAGCCAGGTGCCCCTAGATCATCATCTTAATCTT
TGATGGTGTCAAAAATTACTTCTTCCCTGAAATGTGCTCATTAGGCCAACTTGTTACCAA
ACCACACCAAACTGCCTGGTGCAGCTATGAGGAATGAGGTTAGAACAGTATATGGCACCC
AGATATTCAGGAAATAAGTATACCTACTTGCTGGATGACTTCAGTCAATCTTCTCAATTG
AATTTTGTCTGCAGCAGACCAGTAAAATGTTAATGTCTGGGGCAGGAAACCTTTGGTTTA
ATCAGACTGTTGGATTCCGCTCTTGGTTACTTAGAGAGTTTAAAAACTTCATGGGCAAGT
CCAAGCTCCCTGAGACTGTGTTGGGCCGGTTGACTGAAAGGATTGGGAGAGAACCTTTGA
ACTTGAAATCTGGGACTGAGCCATCCTAGCCGTGTCCCATTTCTAAATACCTAACTTGGG
AATTCACTTCCACCTGTAAGGGTCATGGTTTGTAAGATGGAGGCAATACCTGGATTACAA
GGCTGCTGTTAGGATTAAATGAGAGGGGACCATGAGAGTGCTTCTGTCACTGCCAGGGAA
AACTTTTTTTTTTTTTTTTTTTTTTTTTAATATTTTTTCTTTATTTACTTATGATAGTCA
CAGAGAGAGAGAGGCAGAGACATAGGCAGAGGGAGAAGCAGGCTCCATGCACCGGGAGCC
CGATGTGGGATTCGATCCCGGGTCTCCAGGATCGCGCCCTGGGCCAAAGGCAGGCGCCAA
ACCGCTGCGCCACCCAGGGATCCCTGCCAGGGAAAACTTTAATAAGAGCCTTACTGCTGG
TACCATGGAATAGGAATTTGGGATTTGGGACTGTGTGGGTCTTGTATTAGCTTTGCCAGC
GCCATTGTTTCTCTGCTGTGGCTCTAGAGGTGATGTGACCAAAAACCACTGCCCTCCCAG
GGAAACTCCGTGTATGCTCACATCTGGCTTGCTCCTTACTCACTAACTGCTTCTCTTCCA
GATCTTACTGTGCAGAGATTGCTCACAATGTATCCTCCAAGAACCGCAAAGCCATCGTGG
AAAGAGCAGCCCAGCTGGCCATCAGAGTCACCAATCCCAATGCCAGGCTGCGTAGCGAAG
AAAATGAATAAACAGCTTATGTGCGCGTCATATTTGTGTTAATAAAACCATAAAACTACC
ATCTGGCATTTCCCTCTTTGAATTTACTTTTTAGTTTCTTAACTGACACCTCCTGGAAAT
TATTCTTTTCCCAATTAATGCTCTGAGGAATATTCCAGTTGGAGGGGATTTATAAAGGAT
ACTTGATTCTTCATAGGGCACAGGCATCTGGCTCCCAGAGCAACCTTGTCAGCACCTAAA
GAGTTTTCTGAAGGTGTAGGGTCCTTAACATGACCGTTGGGCCTCTATCAGTATTCAGGA
TTTAACAAACTGCCTTTTCAACTATAGCCCTAAACCTGAGGCCACGATAGCTAGAATTTA
ACTGTGAATTACAGGCATCTCTAGAGACACCGAGGTTTGGTTTCAGACTACTGATAAAGC
AAGTCAAACATTTAAACATACAAAAGTTAACGTTTACACACTGTGCAGTAGCATGTCTAC
ACAATGCATCCCTTTAAAAATAAGTTTATTGCAAAAAAATGCTAAACATCTTTCTGTGAG
TTGTAATCTTGGCTGGTGAAAAGTCTTGCCTCTATGTTGATGGCTGCTGACTGATCAGGG
TGGTGGTTGCTGAAGGCTGGGATGGCTGTGGTGATTTCTTAAAATTAAGACCATAAAGTT
TACTGCATTGACTGAGTCAAGAATGATTACTCTGTGGCATGCAATACTGTTAGACAATAC
TACCCAGAGAACTTTCAAAATTGGGAGTCCATCCCCTCAGACCCTGCCCCTGCTTTATTA
AGTTGATGTAATATTCTTCAGTTAAACAATCTTTACCAGCATCTTCACCAGTAGATTCCA
TCTCAAACTTTTGTTCATAAGAACTCCATTTAAAGTTTCCTCATGAGATTGCAGCAGTTC
ACTTACATCTTCAGGCACTAATAGTAACATCAGAGATCACAGATCACCATAACAAGTATA
ATGAAAAAGTAAAATATTCAGAATTAACAAAACAACAGGAAGTAAGCAAATGGTGTTGGT
AGACTTGGCTCCACACAGTTGCCACAAACCTTCCATTTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1087, 2463..2563, 3331..3512, 6661..6840
2468..2563, 3331..3512, 6661..6787
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved