Canis_familiaris Locus PTCD3
snOPY snoRNA Orthological Gene Database
Canis_familiaris PTCD3
Canis_familiaris
PTCD3
17
SNORD94
28868..29002
31933
aataaagttctgaggatgtggtcaagactgccaaatgctatgatgatcaaaatgaggac
ttaggagagtctccttgatttagtaagtaggcagagaatatagagggtcctagcaaaaag
ttgtcgctttcagagtcttgaaggataaccattttgactaaatacgtgtttaactacatc
agggacgttacaacgccacaaacgctggttaattaccaaagaaatcgatgaaccctaacg
ctgcaacctaggaacctccttctccccaatgcaagctctaacctggcaccaaagggtcct
aggcagggcacgccgactcaagacgttcctggaactacgcgtcccaagaggcaacgcgcc
cgaccatcagcgactcagaggataaactgagcgcaagacctttcgggaacagtagtttac
ggcgccgcctgaacagaccgactcagcaagcttcccaccaactccttacttgagttcctc
ggccgaatacatcccgaaggaaatgccctgcagcctccgccagggcatgttctttgagcc
caacatcttacaggtaagtttcgagttctgacacccagagagaggttctaatcagcaccg
gcaacttaactcaaactcaagcacgcagccaccatgtgatttataacgcgtttgcgcgcg
agaaaagctcgccgggatgagatttacgtggacgagaccacttccaccgtgtgtgtgggg
gggagtaatttgatgactttcgcttgccctcttattttgaaaatactgaggatatatgtc
attaaaataagagtttctgaaaatttcttagaggaaaacgaggccttttgagcctttaac
ttctgtaaaaaagtctttcaagccacgagcttttcacctaattcttgattgcttttgtct
tgttccgtctcagccaatagccgagctattccccgccccctctgggtaatcctgaaggtc
gaggtcaggctttcccaggatgctacgcgaagaagccaaagATGGCGGCAGCAGCGACCA
GTCGCTGGCTGGGGTTCCGCTGCAGGCTTTGCCTGAAGCTGAGGGGTCAGCGGGCAAGTC
CGTGTGGACAGATTCCCTGCTGCAGgtacgagatgcttggagaatccctgagaaagaggc
ccctggccgacttcctccaatgtgtccgcttttctctgggagctggggaactaggtacga
tggaggcagatgcgcacgcgcaattccgcgaccgcgtgcttatccccgcacgcggtgctg
gagtcctggaaataagggcttgaggttcttcggttagggagttgtttattgggtggcttg
cttatcctagagttaagaactgtcagcaggattaggatcctgctctcgtggagcttgcgt
tttagtggatgtggctattagcaaccccgtctcaagttttaaaaatagaaaaatagctcc
ctctgcctgtgtctctgcctctctttctctctcatgaataaataaataaaatcttaaaaa
agaaaaataggtgcccttactcattttcaccaagcagggggaactcggaagatttcccaa
attaaaggcattttatgagggccactgcgtgctggatgttgtggggatggttagccaaag
aaagtatccaggtcttcataaaaacaaggaagtctaaaagtttggagcatagcctttggg
ttgctgttgattgtcacgtttctttaattggataataggttttctcttttgtagactgga
gctagtaatcatccaaacaaacaaacaaaaaatggtgaggagtaagtaaactgtatgact
tattgtatacatttagtgtgcaatcccttcactcaagtcctcaaaaaaatggaggaaatg
ctccagccttaacgctgctgtctatcccagtctttttcctggtagtgccgctgttgacat
ttttctactcatttcctttgcctgacagcagtatctcttcctctgctttcacccacaaga
ctacagtggtcctaatgttgggagaaacagatagcataatttgaaacagtggatccctct
caggttgatacttaggagagaaatactgttttaaaaatgatatttgagaccagataccag
taaaggaagtacatttttttctaattacattttggtgattttaggaatggtactaatgcc
gtgtaggaaggaaatgcacaagataatagtgtacgtgactgatatttttactgtgttcct
tagtacgatcaaaacatttaaaaattcagtcatgggtcagtgggtctgtattttggatga
aaaataaggtcagcaatttcaagtttaaattacttggacgtatatatttggcaaattcct
gattgttgaatgaagtgggataaaaggctatggttatcttagcttaattcatcgtaattg
ttataagtgggttagtcttatcattaggatgttattcatatggaatgaggagctcattaa
attgcccctcttgacctcaatattttagattaccaaggttgaaagtatcatttcaaatca
gctgcttcagtggttcacatgctattgaaattttttccctgattttatttaatgagattg
cctgatttaaaaatattgaccggggacacttgggtggctcagcagttaagcgtctgcctt
cggccaaggccgtgatcctggagtctgaggatcgagtccctcattgggctcccgacatgg
agcctgcttctccctctgcctgtgtctctgcctctctctgtctgtgtctctcatgaataa
ataaataaaatcttaaaaaaaaaaatgttgaccatattgtgtccatatcttctatctatt
ttgtaatggttttgaactttctcttcaggccatgtcttctcagtgtatattgacatgaat
tattcagtcattttgatccatgacaattggaaaattagggttcaaaatgcacataggtgg
agatgaggtgggaacttcattaatgagtattattttaggacttttattttttgcagATTT
TATTCTGGAAGTGCAACCCTCCCAAAGGTTGAAGGAACTAATATAACAGgtatataaaaa
tatattgaaacaatttcatttttgtgttaatacatttcacttacttgtagtagtggtagt
attgggaaactgatttacttttgttttatttttcaaattaagGGATTGAAGAAGTGGTCA
TTCCAAGAAAGAAAACTTGgtgagtattcagtgttcattcagcaagtggttgggtgcaaa
acatttgtaggtaaggagccgaagacatgaagagcagtagagagcatttcacggaacaga
acagcttatgggagaaaaacttgggagttgaaaacataaagagggtggagagtagtgagt
gaatagggcatgagatttacatagggttaaaagatctgaattaagtttggataagtagtt
aaatgataatggttaattatgaacatccttattagaaggattttttttttttttaaagaa
tattcttacaaggttggaagaccagacataagtattatccttacagtctttaataaagta
aaacaaaacagtgtggacagagtttagcttctttttagctcactagatacatccttgaat
aaattgtcttatttaggagttgttgaatatgtgagaagtgaaacttctctctagaattct
tatagtactgattttgaagaccctcaaaaagccaggtcttctctaagtaggacccaaaga
ctaggttattttagaaaagaaaaattttaaattacagaattaattattgtgggggagtat
gctaaaaacaagaagaaaataaaattgccaacaattactctaattagagccaagcttctt
ggtctattccgtagtaaaatgtggacaatgacagcaccagcctcagaggattaaaggagc
atttgaacagtgtcttccacacagttctcagaagatcactattttaaggttttggggttt
aacctttttttgcataaattacagttgacccttgaataacagacttgaactgcttggatc
cattatgtttttccatgaacacagtagagtattatgaatgtattcttaaaaaaaattttt
tttttactttaagaatacagtgtgtaacgcttaagaggaacaattgattaatgcatattt
tgtaggttatcagaaaggctttagtcaacagtaggctattgaatttgggaagagttaaaa
agttgtatacagaggggtgcctgagtggctcaattaggcagctgtccttggctcaggtca
tgctctcagggtcttgggatcaggtcccgagtcgagttgggctttctgcttgacagggag
cctgcttcttttttctccctctgcctgtgcttctgcctgcctttgtatgtgtgtgtgtgc
ataatttctctctctctcaaatcttaaaaaaagttatacatggatttttgactgtgcaga
ggactgggggctgtttggaaccccttgttcaagggtcagctgtatacatatagtttgaga
gaactgatttgtatctatgaatggcattcatgtccaaagcactttaccaacccactgtgc
atctgtccctgaggaaggtactacagggaaaatggaatatctggaggttgtggtcaagtg
gcttatgatatacttgagtcatgtgcatattttattttatattttacttcttatacttac
atgtgtacaaatcttatacacacagctagaagcatagaggatatgatatagtcagtaatg
gttgtattacacaaatcaagggagttttattgaaaatgtggaaaatgacctgtgccttaa
atgagtaagattattttattagcatcagaatcacctaggaattttgtttaaaatgtattt
ctctgtaggtaattcttgtgaaccctaaagtatgagaccagataaaggaacagtaaggta
gagtggcacatcaccatgaaatatctgctggtaggaagaggccaagcaggcagttctgtg
agaaatgttctcttagaatagggaaataagatagctgatacagagcactggccattaaac
tgaggcctgcttatttatagcccaggagccaagaatggtttttacatttttttttttttt
aatgcttgaaaaaggccaaaagatgttcatggccatgagaaaatcacatgaaattcaaaa
tcttttggagcttggcctcatttgttaacattgtggctactttttttttttttttttttt
aaggttttatttatttatttgacagaacacaagcagaggtcataggcaggcagaggaaga
gggagaagcaagctctcagctgaacagagagcccgatgtgggtcttgatcccaggacgtt
gggatcatggcctgagctgaaggcaaatgcttaactgagccacccaggtgccccatctgt
gtctactttatgctacactagtgtaacatacaacagagtccctgtgacactattcatttc
tttatagagaaagtgataatttctatactctggaattgaggcttttagacctggcagaag
ccattagggctaaaattcctgttgccttattttaaacatgtatcaccatttaaggatgtg
atttcctagatcactcaggtgccaaagaagatgttagcaaattacacaggttccttgtga
gttttcataaatgaatgtaatatattaaaggcagtgttgtgaaagcgtgaatctatgtag
taatgttaggggtgataggaaatctagttataatcaatgcataggtaactgggttcctaa
aagaaggagatctaaaacttgatagaggggcacctgagtggctcagttggataagcatct
gactattaatctcagggtccggagttcaagccccacattaaaaaaaaaaaaaaaaaaaaa
acttactagattggtacagagaaggtgtggagaaatggacgcctcaaataacatttgttg
atagagcagtcaattggaataatactttaggggaaagtttgcagaatcttaatttaaaat
gtgtatactggggcacctggatggctcagtggttgagcatctgcctttggctcagggcgt
ggtcccaggatggagttctgcatcaggctccctatgggaagcctgcttctctttctgcct
atatctctgtctctctgtgtctctcatgaataaataaaatctttaaaaataaaaataaaa
tgtgtataccttgttggttagccattctggaggaacactagcataaatccaaagagacat
gaatgagaatgttttttaccacttggaaatactaacaaattgaaacagtctgagtgccca
taggtaaataagtcgataataagtggttatcatttaaagaaacttattagatttatatgt
agtaacatgggtaatacaatcaaacttatgtaagcagatgaatagaatggcagtatgtgt
ttttttatggctgtgtttgtgtgtgtgtgtgtgaaagtatgttaaaagttctggaaatac
aaaaaacaaacttgtggtgcctggctgactcagtagagcatgcaattctcaatctcggtt
gtaagtttgagccccacattggtgtagagaattaaataccaaactcacagttagggggga
aggagggtcaccagatgacaccataatctgtaatattctagtttattttttagggataat
atatccattgatactgatttttaaaataaagaactagcaagtaatgtgaatgtcataatt
tttttgtcagttcagtaggttaagaagatatgttcacttgataagacttatatgctaata
taagctttagtgagaaaatgtccagagatgaggatttctttgtcctgattaaattacata
aatgtgactttaaaagtggatagaaaacaccatgggttttatacacatcaggaaattatt
cagtcatgatgtaatataaaatcccgtgtatgttcttctttttgagatgttgagtgttct
gttaaaatttgtttagaaaaatacttttggtttattaagtttacttctcttttggaaatg
aaacacataaaatgtagcaagaataaaactatttggaaccaaattatcttgatttgtcta
ttcagtgaaatctccttttccagcagttcaagtctctacccatagcatagtggccagctg
gcctggaatttttataaaggctatatagttgagaggtctaaatgagaagagttcatcaga
atcatctgggaattcagtaagaaagtatgtgacagttatccgtggaacttggaggatttg
attcagaaagtccggagtgcagccgaggatttattctatatagctgagttaagagtcact
gctttaaacaaaaaaagccgccacttcacataacagaagagcccagaaagtgcaataagg
aatgcataggaaaatggggtgtctgtttaagccccacactgagtatagagattatctaaa
aatcttaaaaaaaagaatgcataggaaaatggatagggcaagttaagattcaggatagac
acagacatctttataagataggaatggaaattgctaggcctttggaggtagtatgaggga
ccatgccagagaggatgggcaaagtatagtaggaacatatacgacccacctttaggaaag
aatgggactgtttgctcattttctagcttcttgttgttctagtgatcttgagaaataaga
actggctttagttaagagctaaactttttttattggctgatccatactgagagtagaatc
acttgttcattttgtgggtataaaaaaatccctatgccctcttcggcagcacatctacta
aaaattggaacgagaaatcccttacatgggttaacgtatgattcttgttcttagGGATAA
AGTGGCTGTTCTTCAAGCACTTGCATCCACAGTGAGTAGGgtaagtaggaatttcaggtt
ttttttttttaagatttcatttattcattcatgagagacagacacacacagagagaggca
gagacacaggcagagggagaagcaggcttcacgcagggagcccgatgtgggacttgatcc
agggactccaggaccatgccctgggccaaaggcaggcgctaacctgctgagccacccagg
gatccccagaatttcaggtttttgttgcagatcttgccagtttcttagaaataatgtaat
ccagtccattcatgagacaaatggagaaagtttttaaagaaactggctttaggctagtta
ggaagttaactccttgttttagccctatgtcttttatctccaaactccgtgtttttatct
taaatccgtaatctttaaacttaatcccctgaagagcttgttgaaatgcatggccctgga
ggatggtttagatccaatactgtaatgcaggtgatgtgtagaccaactttgagagatagt
gtatctgccatgctgtaaataatacagtgatttagaatgtgggtcctggagccagtgttt
tgtttcatatctgagtaactagctttgtgacttgcatcaaaaagttactttatctctgga
tgcttctgtatgtttatctataaaatgggaattaattattattacaactattttagtgaa
atatttgtcaataacttgctgtcttgacaatttaagaacggagtttgtaatctaacagat
aaactgaaaccttagtaaatgcctcagaaatggaactttttctttttttcttaagttaag
taatctttacatccaacatggggctcaaactcacaaccccaagattaagagtcacatgct
gtaccaactgagccagccaagtgccctggaaaagggaacttctggctgattgtatttttc
atcatgtgaaagctatttcttttttttttttttttttttaagatttatttattcattaga
gacacagagagagagaggcagacaggtatgcagagggagaagcaggctccatgtagggaa
cttgatgtgggactccatccagggactccaggatcacacccagggctgaaggtggcgcta
aaccgctgagccacccaggctacctgaaagctgtatttttaatttcaactacaaggataa
tgtctaaaataattaagacgttaactgccacaatgtctgtgtggatactaatcttcttta
aggccattatcacagatttccagaactgttttctattgtagatgttaaacttaaggagta
aaaaataataataataataaaataaacttaaggagtattgggtcaaatatgccctggtat
atcctagcagtttctcagaaggggtttttaaaatactgcatctccatgctagtaatacat
tgagatcttcagcagtttacttacctctaactaggcatctgaaatgtaaactagagtaat
ggccctctgagactttctcaggttgtttttgttttttgttttttaatgagaatggcattc
gagtcagagaagttgtagatttatgtgtgcatttgtctgatttgtctgggtttgggcctt
taagacgcaaggtatagtaatttattcgttcagtaactgcatattctacccttctgatgc
ttaccaggcactgtgctggatgtaaagacaatccttgcacagttcctagagagggaacat
ggaggagcactgggaagagggtacataacccaggctgggaaaggacttcccagaggagct
gataattggattccttctaggaacgtgagcggcaaggatactatgatgggaaggagcatt
cccgttagaggcagcaccatgagcaaaggtacaaaggcatagaatgagtagttggtatgg
taggaatcaaggatttggtgggtggagaaatgagaaatatgaggcaagatgattaaacac
aatgctggggactcaggtcctccgaagaattttaagcagtgttatgaaaatcagatttta
gaaaagacagccatgtggagatgggaaacgttggaactttagagtaaagatgttaaaact
accatgtccaaacccaaacctcgctatctcctcagtggcacctctgttgttctagttgct
caaatcaaaacctaaggagttatctgtgattcgttttttctctcttgctgcatattagta
aatcctttgtttcttccttcaagatagatgtgcatggaatcccaagaccactctgaggtg
cagtgatttgctaggacaactcccagtactcaacatatagtcctacagctactatttaat
ataggaaaaggacacaaagcaaagttggacaagggaaaaggcacatagggtgaaatccag
aagaaaccaggtacaagtttctaaagagtcttttcccagtggagtcacacaggatatgcc
tgattcctccagcggagttgacacacatgtgtagtatctgccgtgaaagctctttggaga
ctcggcccagaggttttttttttggtgtctagccatgaaggcaccctgtacctggcacat
accaatattccagactttcagaaggaaggcagaagttcaccataaaccacactgtacaga
cagtctcgacacaatgagccattctcattggtactggggatggtgggaaccctcccaaaa
ccagattttccagggcagccttgcaagtaggcctttctaaggatagcagtctcaggcctg
ataactctgcacagtatcagactctgcactcttgtcatcacaacatgatcactgtagtca
tctaagtcaccattatctcttactaccctggattaaacacagcaggccctgtctcttcac
tgccctagctccccacagacagctcgcatttcagcagcccaagtgatcctaataaaatgt
tggatcacatcacacttttgctcagaactcgagtggcttctcatttgtcataattgggat
aaaaagtaggtgagagctcctaaggccctccgatgatctccccactcccacgttacctct
ctgacggcatctcttgtcaaccttctgggtgccctacccgagcctcctgcctaattctgt
ttccccgcaggtagacctctgcttcagggctctaatgtttgctgttcttctgcctggact
gcttcccctgagatactcaacattatttactccctcatctgcttgaatctttgcttcagt
atcactttttcagtgaggccttccctgactaccccatttgggtcatagatctctttgaca
ctttcttgtccctttttctacttcattttgctgcatagcagttacatctttttaattcat
tgtgtattgtttatttttactttctggaggttttttcccccctactagactgcaagcttt
atagggaggggataattctgttgtctccctggtaactagaataatgagtgcctggcacat
aggaagtgctttgtaaaaaataaggaagacactgaattatggctgtggcagttgcgatag
ggacagtggagttggtaggggaagataaggaactagcattggttgcatctgatgataggt
aagtggaatggaagaggccctaaacaggtatctaacaagggtggtacagaggatcagagc
caggcactagttcaagtgtaatcagggagcaggtagtccaaggcagctaacctagaactg
ctacctctggtttatcattacatgactgctgcatcttagtgaagtggtataaccagataa
aatgagtctccaatgagtgtgaagggaaagaggttttgaaagggcagcaggaggctgaga
cccaaaaaaaatcctacctccaggccttcggtatgagcagctaccccttgagagctgcag
ggaaacgatcccttggagagtccaagtcagacagggcaccaaggggataggagagattct
ggatatagggtgcgtttttcctatggaacaatggtcccagaaggcccaggaaaggaggtt
ccaagggagagagtagaggaatagagaaagtaatttggggacacttttcagtgagtggta
ctgaagagttgattttgctcagagttctctagaacaatgtgaaaaaatgtatcaaacctc
caacatcaggacgcaggagaagctgctactgtttgctccttccaagagggcacagtagga
tcctccatttggaggagggactcttggatgggtagtggccaggctttgaaggaaacccta
gttcaggacactggtgcccagactggttaattagataatctttcatttaaataagcagta
gttcctggtagcaccctcatatcttaagagtcagtaataggggtttgagcccttgtttgc
tttaagttgtgtgtaatgacagcagagtcttagagagctgagagtacagtataggtgttt
ctctcaccacagacacacacttctgcaagtgttacatatgtaattaaaatttcttttaca
gagtttttagttatcaaaactcaaggtcttaattaaaatataaagagatttctttgtctt
cacagGACCCCACAGCTGCCCCTTACGCATTTCAGGATGATCCTTACCTCATACCAGCAT
CCTCTATGGAATCTgtgagtgttatcatgtagcttttctagtattatgttttatcttggt
tgtttgggtacaagcatggatggatatagaattttacttaggtgtaaaaacttttgaaaa
gttaacagatgctgttaactgttagagataactctttagactctgaatcctttgctactt
ttttcatagttttagagcgaggctgtggaaaagatttgggatttaattcttagggctctt
tcacactgaagcagtccactcggtttcagtgcactggttttgtataccacaagctgtgta
tgaccaaaaatgtcacactcagtagcagaggtgcacatgcggtggtgtgtaatttagctt
ctaattgggtttctatgtaatattgcattctttttgagggggtggataatacttgctgag
ggtgtaattctgatcttttgagtcagtttatatctaaatccttttctttatatagCGTTT
GTTTTTACTGGCAAAGAAGTCTGGAGAGAACGCAGCAAAGTTTATTATTAATTTACATCC
CAAATATTTTCAGAAGGACATAGCTGAACCTCATATACCGgtaaggagaggtaattgtga
tttttcaggtattactatgtaaatgtatattaaaccaagttttcatggctaatatttgag
tagccagttgaatgtcctcagtatttgtttgaagtctgctgatgtgtatagttacctttt
tttttttttttttaagattttatttatttattcatgatagtcacagaggagagagagaga
ggcagaaacacaggcagagggagaagcaggctccatgcacccggagcccgacatgggatt
cgatcccgggtctccaggatcgcgccctgggccaaaggcaggcgccaaaccgcggtgcca
cccagggatcccttgtgtatagttatctttgcttacagtagtaacttttttttcttttac
tgctatacgtatttggtcctcatcctgttttccccatttgacttctgtaacaccagaatc
ttcaatctttacccctgtgattgttctttttagtttctttgagtagcttttctgtccatc
cctcatgttggtgtctccagaggtttccgtgctcagtcattgtctcgttcctgtctgcag
tcttcctgtttcagcagccctcatgttccatttggcattcttctatatctggcccactat
ccctctgctttgatagcccaatgtcctggtttcccttcagagcctgtcaacccttctgcc
tttgactatgaattccagactctatttccagccacctctgtgtcatgtagtcatgaggtg
tgagtgtcatgcagcacatgctgagtgttacccattgtgcttggtgctgtcattatagtg
gcaagtggaacagaggcacccctgccctctggggtttattagtgaaaatagtagcctcag
gctcatatcccagactcctttcttcccaaaatgcctgcagccaagcacagcctcctgctt
ctcaagcggcaactcccagtgacaaaattggaggtctgcgattgtgcaggtgacagtgcc
ggttgtcctctgcaggacaatggcagtgatggaatggtcagttgctggcccacccacacc
cctggatgtttctaactagctgttactcttcggtgcttattagctcgcttctgcttgaag
cctcccgtgggtccctgcttccttggcaggcagcaatgtcacacatcccggatctcccat
tattgatgttcacactgcactgtaaatcttttcttcttttcctctctgataaatggggag
aaccctgaaggtagaggatgattttcatctctgtgtctcccatgccttgctctgtgtctg
gcagaaaatggccggcattcaataaatattaaaataaactggttaggtaaaatcagtgta
ccctggtgatggtaaatgttcagagagtaaaagaagtatgagcgatgaaaagtttctgcc
cttacaaccaggtatactcttgacacgaaacaagatagggacaaaaggagaagggatagt
tttgacaggcgacaaagttaagttcaacttgaagttgggggagttagttggaaactggat
tctttagatatggcttaaatatttatttatatatatatatatatgcttttcagtcaaact
agaaaatagctaaatggttttgtctcagataccggaggtagtctcttttttgttttaaat
tgtattccctacaaagatgtacacgtggcgcatgaaacaggaattgggacagtgaagttt
tgttttggtgtgttgttggacagagtttagtcctgctcagctattgtccctttacctgtt
tgtggtaactagccatcttcttttcttagTGTTTAATGCCCGAGTACTTTGAACCTCAGA
TTGAAGATATAAGCGAAGCAGCCTTGAAGGAAAGAATCAAGCTCAAAAAAGTCAAAGCCT
CTGTGGACATGTTTGATCAACTCTTGCAAGCAGgtgactcagttcatttaaagctcctct
gggaacatgggctttggaagtgggctgtggatgcgtgatcctgctggtcatgagtaaaag
ttagaaggatctctgcctaatgttgtgttcctacttttaagagtttagtagttaaaaaaa
aaaaaaaaaaagtttaatagtatttcaagttctgcttcagccttacttttgaattataag
ctagatggagttggaccttagtttcctgtgctcctgggttgtattgtgtagcagatagag
aaattatagaaccattcttccttggcttccatttttaaccctaggcatatacgtactgta
ttcacatttcttgtactccttgtgtttagaggcataaactggtaaaaaaaggaatattta
aaaaggaaagaacactaacctgagttactgagatactgattctaaatctaatgtgaatta
actctgtagccttggaaagatcacagttctgcagcacttctgtctctcaaattctctggc
tctctgaatttaatctgggtgaacatctagtgatatagatctaaattgcatggcttgtaa
actaccaggagaggaatatacctatagtagcatcaaaggcagcaggactgtaagttcatg
gaccacagaatgctcttcagtgatttaggataacaatcaaccagacataaaagagatagg
aactggactgagtaattcttgaacacattcttgaacacaagaagcctttacagcaagctg
tgtttgacttgggaattttagtgtgtggtctgctctggtattggatgtactaatgaattg
ctgatgtgtgttataatttacggatgcctttccctctgcttgttgaatatgataagtctg
cattcaggttcttagtgctcagctctgtcttcctctggttttacacactgtgcttatgca
cgtgcagacattaagtaagcggttctgaagaccgtgtgtcagacccacagctcagagtaa
cagaagaagacaacatgccatgggggaggttagaagaagttttaccttcaagacctcaat
aagtaccaaagcctttgcatggcatttcacataatttgattctgtagtaccttaggaatt
gctgtgttttataatcattttataaaggaaactgattaaatttccagttttaagatagta
tgatccagtccagttaccctccggagcttctctccattctgctgtgctcttttcagaggt
tttaaatttcctaatgggcatttttaatgtcagtatattttcagaaaaatgcaggtactt
tattttgcaaatactatatctcatactgcctgtttcctttttttcttagtatcaagatgg
gagcataatgtttttgagtaacagtttttaagagctactataattagacacttgtgctag
tatttctaggcaagtattccagtgagggcccagatccaagtggaataattctgcttgcat
atgtaaaattggaactgggccagggaaacttaagtggcagtaatttgcactcagagtgtt
gggtttggagacaatagttaaaaccttgagtttcttgggggttatgagtatgtacaaagt
gagcacagggtcaggctttgtcttgtgttttagtccctcatgtcaggccacacggttgct
aggtattgtgtttgcatctcttcagatgtttctgttgacatggagtgtatgctcatccat
tcttagagtgctgaaggatacaaaatatgtagccaagaaagctctagcttgtagaaaaag
tgaagaattttaatccagtaagcttccgttctttaatgtttcaaggattctttccctttc
ttctcctccccacagGAACCACTGTATCTTTGGAAACAAGTAACAGTCTCTTGGACTTAC
TGTGTTATTATGGTGACCGGGAGCCCTCAACTGATAATCATTTTCAGCAAAGTGGAAAAT
CAGAGGAGCTGgtaagcttaaaaatattttgactttgcctaccacatgcagtcaaaacgt
tgagcagaaacattaggcaagcccctctgttgttgttactcagagtgaccagatgatagg
taaggaacagggaaagattccatggccccagccccctcaaaaatgcatacatatgtgggc
agcaagtagtgagcacactgttggggctctagaacagtactgtgccaagagctggcctgt
agataagaagtcctatcttaattactcaacccaggagttgtagaaaaagatcccacatac
atctttggatcatgtgaacaaaggttatgtacatcattttcataatatattcatacttgt
aaaaatttgaaagacagactggatgtccagtgtcatgtaattgaattatgctgtgtggtg
atagagaggactagcataggtctattcatctgtggaaagatgcatcatatattgctaagt
gagaagataggccagatgataatattccatctttataaaatattttcatattgcataagg
gaaaatgaaaaattaagtgctttttcttccatttttgtctggttttcctccactaaatgt
ggattgtttatatatgaaatcattaagtcttttcaaatgtataggcatatatgttgtttc
tgtgtggttcaagcacagtcagctcaagccaggctgtgtttgagtttccagttcctccct
ctgggctaggctgtgcaggcgactggcttcatctctcttccagcctgtcagttcttgctt
taagtgctagctttactttcatctctaagtgagctgatgtctgctgaaaaaagtatccct
ttttttaggtgaacatttactgggttttttcttcatcttctattggctctgtatttcttt
tattttttcgaggtttcctttgcctttctgatttcaagtattctaactaggagggtgcat
tctgttgtcattttttgttgatgatgattcatttcagGAAGAGGACACAGGAGAAAATGA
TAAGAAATCTAAGAAGGCTGATGATCAGTTTGGAGTCACATGGAGgtaggttataaatca
ttagaacttggtagtactgttctttatggggcgtggcatgctccccatcacccccttaag
aagatacgctcctgaagttttctaaaattgaatttgtttctagtgtacagtacaaatgtc
accattggtattcctctgcatttagagctcatttcataagtttacttccaaccagcagta
cagggttgacacttcactcttttcctccctaccacccatttcatttcatgtcaccttcac
atagtattgattccttgggtagtttgaccagtggtcctactgtccaatttatacctccct
ttctgaaagtctggatatttttgtgagaacacacatgccctagaatatagttctaaatta
aggctgctggccagcaggcagaaatgctcagcatttccagacaaaaggtgaataacgttt
aacatttgagaatttaactgaatagaaacgtctggtaaaagatatttcacatggatgtat
ggagaaggaaagctaccattaagatctgaagtcttttgtgaagtgaaaaattgagtagaa
tcaaagattaaatttcttgtagtttttcataatttcgcatgctggttaagaatatgggct
ttgccatatcatcctgactcaaatcccagttctgatttctgagacctctttataagagac
agaatcaagatacagcatagtctgtaaaacatcgttatgtttattgattggttgattgat
taaaagaagatgcaccagagtgtgatgtgtacacacactaggatatgaaagagagacgct
agagaaactacttgtccgtggtggcctctggggagttgtatatggttgagagagggtggg
gaaactccactgtgtgcccggtgtacactttgctttttgttctgtattgtgagtatctat
taatgtttttgtaaaaattttcagtcctgattctgtcacttaactgccaggctctgaacc
acttgaggttttcgagccttggtttttctcacttttcagaacgataaacatgtctctctt
cctctctggattgtgagagttgtgtgtataaagtgcttggcacattgtgaactctcagta
gattgtggtagccgttggtttttcctattacccctggttcacatttattcttactgtgtc
tagGGCAAAAAACAATGCTGAGAGAATCTTTGCTCTAATCCCAGAAAAAAACTCCTATTC
CTACTGCACAATGATCCGAGGAATGGTGAAGgtaacgttttatatttttatctttaattt
ccactaaatcaggatttttcatccttagattgattgacaattgggccagataatttgttg
tcatgagggctctccattgtattgtagaatgtttagtagctccctatcctctacctactg
catgtcagtactacatcttccccaacccccagttgtgacaactagaaatagctccaggaa
ttaccaaatgtcacctgggatgcagaattgctgcagtagagtataaatttcatgagaact
gggaccttgtctgtttcgtttgctattgtattccgaaaccctaaaccctaaaacagtaga
tgtacaaatatttcttaagtgaacatgtttgacaatgctgagtttttgtattttctctct
cccagCACCGAGCTCTTGTGCAGGCATTAAACTTGTATGCTGAATTATTAAACAACAGAC
TCAAGGgtaagtgtgtttgtagagaattttcctctttccttttctttccttaagaatctg
taacatctttgaatctacagaatatttggatcttcctcacctttgggctcacttttaatc
ttttcttgtggtattggtggtagaagctggaggagagatcagagcagggagtgattgtct
agttttgtgaacatatattaatgagctaggagccacatgtgcattactgcttcgttaaac
tgagccatttaggaattcagcccaaattttgttaaggttttttcctcttttacagCTGAT
GTGTACACCTTCAATGCACTGATTGAAGCAACAGCATTGAATATGAATGAGAAATCAGAG
GACAAATGGAATAATATACTGgtaaggaggaaccctcatttttgttttctagtgggtctg
aaatatcttttcctagaaatacaggggatggagaccacacttattgagcattttcatggc
agatactatgacactggacactcagcagttgcatgtttacaccctcccagcaaccctata
gttaaattatctgcatgtgagaagaaaaagttgcttgaccagagtctgtgactaaaattc
aaaaagacttcggttgctctgttgatttctcatagttttattacaaaaataatgcatatt
tcctgaaacctttatatcaagtaaagtttgaaaaaaaattatattcagtggattgaggta
attaaagaatagaaatgtttttatgtttttacactgtacggtttgtgtgtttttgtacca
tactgctcattttagaggaaaacacccccattcattctaatctgttcttctgctttacta
ggcagggagtgaagacagacaccttgatcaagtgaggtggggtgactgaatggagtgact
tctgtaaaaggcaaagtcactggtcctgctgataattcttttttttttttaagcttttat
ttatttattcatgagagacacacagagagagagaggcaggctccatgcagggaaccggat
atgggactcgatcctgggtctccaggatcatgccctgggccaaaggcaacgctaaaccgc
tgggccacccaggctgccagataattcttaaattagggatatatttattaactttagact
tagccagagtgccaaattcttttttagtgtgtaatattagttaatttacccacccaggtg
taaataagacctacttcttttgattcaactagGAGCTCCTAAAACAAATGGCTGCACAGA
AGGTGAAACCAAATCTGCAAACATTTAATACTATTCTGAAATGCCTCCGAAGATTTCAGG
CATTTGGAAGATTGCCAGCCTTACAGACCTTTCGTGAAATGAAAGCCATCGGAATAGgtg
agtatgtatcctggtgtccgtcactggaggctgagacactgctgaaccaagggcttagat
ccagatgagcaaaaaagaaatggtgaactctttttgctttttaagtaatgtgttgagaat
tcctgatctgccatttggcacacttaattacatgcatttactaaagatgggagctccttt
atcgtcatgtgttttatagcaaattacaatgtttttttaatattttgggtactttcctgt
ggatttcttcatcctggggagaactatttacttaagagttagttttaaatcccatgatat
ttcctagcctaattaggtatttgaacccaactgtgctactgtgtttatagttttcagtaa
tttttaaaagttgtttgggaatcagttcatttcagtatacttagtgttcttgagtgaagg
atcatagtactttataatatttagtaatgatacgtcaaggcttgcttgcatgtgtgtcaa
ggctttctataagagattctttatatttttccacttaacattaatcaaaatgagctagta
aaggtctttgttcagaggaatagtaatgtattctcttaaatagcatgttcagtgtgtttt
tttaagtcagtgtgcctcagtaaactgtttttggatagccgggtttgacttgtttcttat
ttttttctatccacctggtaatttagAACCCTCGCTGGCAACATACCACCATGTTATCCA
GTTGTTTTATCACCATGgtatgtatgacattgtgtattaacttatgtagaaagctgaccc
agctctcttatgtttatgtgagtatttgctgtaggcttcttttgctctatatgattttca
gaatagagaactcccaaattaacgttatcctgtagcctgggcagaaagttacccttgaag
gtagtaaccttgtttgttacggaaaacttcagctggaggggacggggccattaaatgtac
tgttggtatacgattacaaatggtcagaaggtatgttattctggagttcttttgcctctc
cagagctgtgctttccactaaaatagccattagtcacacatgcctatttaattaaaatta
aatggtatttaagactccttcattgcattagtgccaggtggccacgtgtggctactggct
actgtattcagtgatacagcaacagaacatttccatttttaaggaaattactggacagtg
ctgctccgtggtaaccttaaccttattttgaagccttgtgggagaactttttagctctgt
ttgtcacctactttaggtcagccagatcctattggagctgtgctctgttgaacagacttt
ggagcaaggcacatctgagttgaaatttcacctctgtcatttaccagctatgccaaagga
actcgataccttacctgagtaaataccgtcggactgtaatgattaaatgaactgtgtcca
gtgtcttggaagacatatagtaagcactcatagtctgtcagttcttatccatttggccca
acctgagaaagaaccagtggtgggttcagaaatgaccgctccagtccttctctactgcag
tagactttatagatataaaacagaagaacttgattgtccgtgttttggtaggctaatttt
acaaaatccacatcctcatctatagggaagagttttatcttttagggtagggggaaagag
gtaaacaatttccacagtaattggatcttcttctgaaattttactcagtcttgacgttgt
agtgaaactggtgcttctgaccccaaagcctgttgcatttttctctattgtcacacatca
ctttgatttcgtttctaaccaaagtctgtggtcctgtttcctaaataacactcggaaaca
tgggggcaggctcagaggaggagtgtcagtttgccttacaggtatgtgagctagctacct
gcagttgacaacgtctaggtagttattcaaaagaaagcctaaagattgaaaggatacata
taaagtaaattattatgtaactaataaaatgattaggaatgctagcaaatgggaatacgt
ttaaggaaattctaggaatacatctatactgtcattaaaactaatcacttgaaaagtgga
taagatacagagcggatttggatgaataaggtgtaaggaattgtataggtgcattttcta
cctattagtacccacttcatgtgatttttaagaggattgcctatatccattaatcctaca
gttttctttttctggccttttcatcttgattatacttcaaagcaacacaaatgattcgca
aaaaacatgtttgtttttctaagtatgcaggtttggttgtgtgcttgtctcccactttgg
tgaaagtcaagcttaagacaagactagggagggagggaaagtcccctgggagcacataga
caaagagccagaactgctccagatcgtatgcacagttctgctgtgtactgtgcctctgct
cctttagagagcatgcatccccgccggctctctactgggtagtatgccgagggtggaggg
agaagtgtggagccttggactgcgtgccatgtgggtgggtggtgttacagaaggggacga
ctgataaaacctcattgctctctcattctgcagAAAACCCTTCAAAAGGATCATCCCGCA
TCATCTATGATATTATGAATGAAATAACAGGACAGAAATTTACCCCAAAGGACCCAGATG
ACGgtatgcacagaaattgcttgtgtgaaacaaaaagcctgctttcctgattgccagtta
ttagaggctttatgatgaggacagagtttaatgtagcttttcttatgggtgattattctg
tggaagtcaaaatatgtgtagcacattgctgtatgcttcctctcctctagaatttttatt
cctttaggtttaacttaccattaacaattctattgctaggatttttattaatgctgctca
cttgaaaatatattttatccattgtaactgagactttgtgaacttttattttcagATATG
TTTTTTCAGTCGGCCATGAGAGTTgtaagtactattttcttgcttgacttttgtttttct
ttttccttttatccacttaaattaatctgtaactggagccagggtgggtggggttccctg
attctctctttctcttttatttatgtttttactacaaattttctttttttcctcttaaac
tttatactaactcacatagcatcccttaccctttgtttattctgtatattgtcttttttc
acacttttgttcaataaggtttcagagtatttcatatttgcttattaatgactttttgaa
atggcaaagggctgttttgaattttggtttttcattttgtgctaaccagaagtagtttaa
aaccgttttaggatggatcagcatattgttccctaaggataattgctttccaaaagttta
gtctatatccttgcaggttttttattctactattcaaacacacacagccagacacatttc
catgatattttatttgttgacaacatagtatttcatgggagggagggactacaatttact
taaaagtctgtgagtgcattttggaattacttcctgggttttgtagaacagtgttgctga
agtgagcactccatctgtcttttatgcacgtgactaggtgttttcataggattgatttct
acaggcatcaaaatcactttattttaaatttcatttcaaattttaaattggggtgggttt
gttttcccctcaatattacaactcatttgctgtcaaccagtaatacattgaatcagcatg
aatatttccacaaataactattttttttagtgatcaagccactgtttggctgataaactt
gagtgatgcttattactgcttgcaaattttcagTGCTCATTTCTCAGAGATCTAGAACTT
GCTTATCAAGTACATGGCCTTTTAAACACTGGAGACAACTGGAAATTCATTGGACCAGAT
CATCGGCGTAATTTCTATTAgtaagtgtgctagaaatgtatccttttgcattattggaac
ctctttaagcaatcacttagtcaattctgcaagtgggagactatggggtagcactcccat
gtcacctctgcaggcagcatgtccgtaacttgcagtacatgttaattgagcacttggaaa
ttcaagcagtggtaaaacagatttgccagactgagatgtctgatgtgtatcttttaggct
ctttttctttgtaacactttaaatgtatatatcttttttctctgcaccctatattatatt
tttgaatgtataacagggtggatccctaacaatttcagtataatctctttgttttttgtc
tttgtaaggttttgtttatttgagagagagtgagggatagagaaggggcagggggagcag
cagagggagagggaaaagcagactccctgctgagcagggaacccaatgtggggctcagta
ctgggactccaggatcatgacccaagccaaaggcagacactgaaccaaataagccacaca
ggcactccagcctcttgtttttaaagatgaaaatacagagatgaagcccaaagagactcc
tttaatgagtctgacttcaggtaattaaaaacaaataagaacttaaggaggcagcctatt
aataggcatgtgatgattgtctattgtgtgtccatatccttgcttcacattgcatgcttt
taaaatgaaggtgttgtcactgcttgccatggcctgagagcatactgaggaggcaatcat
gaatcgctagttgtggataagaagttatttaattgggaattccagagagcatagttagca
cctcccaggtcaagcattggcccacataacttgacattgtaacttataaattgattttaa
attctgtgtaacatatcattatataagctgtgctgtaacattctattgttaggcatctga
gactaaagctaccttttctctccattacagTTCTAAGTTTTTCAGTTTGCTTTGTCTCAT
GGAACAAATTGATGTCACTTTGAAGTGGTATAAGGACCTGGTACCTTCCgtaagatgatt
cattacttatcattgtaaatgtgtttggtgtctttactgattaacattttaaaaatatgt
ttgtatttctcttaatcagGTATTCTTTCCCCGTTCCCAAACTTTGATAGATCTTCTCCA
AGCATTGGATGTGGCCAACCGACTAGAAGTGATTCCTCAAATTTGGAAAGgttggtttca
gcatgtttgttcaggcccatctcacttcattgtcctacatttggttaacaaacacgttaa
cattgttagggatggaaatttctaattttcactaaattgaatctattagttaaggtttgc
ttcatggttgctggctcacagtgcatattggactatgtgagtaaaaatgcattgaacatg
acctaaattagttcctttgtgacaggaaaaggtagacttttgtgcatttgttgtatgata
tgacaaagggaagatcagtgctaattacatacacaccctaaatcaattctggtctccatc
cctgaagcctttgttagtcctctacatcatgctgctcttcatgactcagttgttaaccag
tcagtgatacttaggtctctaagaaataggcgtgattatgggtttctgtgtataaactgg
ctatagaagatgctgtatctctttttctatatgactgagcacgacttgagtttctgtcag
cttcaagtttccatgtctgaacaatgagacaagcaccctgatctactatctcatgagatt
gtagtgactgttaacatacaacgtcattgacaattaccaagtgccataaaacaggtgtct
tatcatatcgagcctggtagctgcccgagagtaattgactgggagcaggttactgccttt
cattgctccttcgtcccttttttttttttttttttttttttaatattttaattacttact
catgagagagacacaggcagagggagaagcaggctccttgcggggagcccgaagtggaac
tcgattccagaacccccaagatcacttcctgagccaaaggcagacactcaaccactgagc
cacccaggtgcccttccatccattcttaacacgaattatcctgctggttttcttggagtc
tggaataaataatgtcagcaacttcctttcacccaccaaaaactatgacagtggacaagg
tcagtgaaagagttttggttttatgtgacaatgatcatttctttgttctttttctgtttc
aagATAGTAAAGAATATGGTCACACTTTTCGCAGTGACCTCAAAGAAGAGATTCTGATGC
TCATGGCGAGGGATCAGCACCCACCAGAGgtagggtatatccagattcaagtcctgttac
agtgtgagatgtgtgctagtcagtattttctccaacattgtggacccagagagggtaatt
cccttggtttcttctagggaaactgaattctgccacctaaacccagatttaaattctgta
tctaaacatatgtagcaagtagcagaatcccgtttctaaagtccctttcattcctcaggt
ccaaaagcaagtttctttctggcttgacagtaatagctttttgaaaaaaatcctatctaa
aaggaaaatccatcttgtatttgaaagatgtggccagtttgcaaatcacttaccccaggc
cagggcgcattcttccttgattactcgtcactccacatgtgagtggcaaactgcattgct
ctaagatgtcagtgcttctttggagtctcctgaacctgattctcataaaaccaaccaggc
agttctgctgactctcagagcctctcagCTTCAGGTGGCGTTTGCAGACTGTGCCGCAGA
TATCAAATCCACTTACGAGAGCCAGGATGCCAGACAGACTGCTCCTGATTGGCCAGCCAA
CTCTCTGAACTGTATAGCTGTCCTCTTTTTAAGGGCTGGGAGAACCCAGGAAGCCTGgtg
agtacaaaaccacaagtgtaaattagaagcatttgtacttgaatctcagagaacattttg
cctggtcacaagttttctaatttgactgtataatgagttttctatgggaactgcaagtga
caactgaaaaggaaacttttggaagaccagtatggtatatacattgtatttaagagatga
cgccatctagtgagctaattctctttctgacctgttttatatattcatggccaaatagtc
acttacctgttcacttaactggaatgttcaaagaaagttattttttaatatgttttgggc
atttgacttatccatgtatttcactcaatgcttaaaatgcaggctgtgcccttgggactt
gtggaaattggcatttacaaacatggccttgactaaaaccatctttgtttcactgtatag
ctgtgttaggtgttttcatcagcaccccattcacatactaattcttaagaatgtgtttgt
gaatggagcccttacatgcattcctttttccaaaagcagagaagttaacaaaagaatact
ttgtaggagtagtcctgataagagtggtatggctgtattttgttctgggtagaaatatgt
gttctaacagtaagtggggtacttgtatatggcattttcaacacaaagtgttgatttgaa
cggaggattgtcagcccaaaatgtggctgttcactatcttgaggaaaaagctggtgaatg
aaggcattgccgcctaaacttgtcttaggagtgtgaatcacacatatagcctgctgcact
gctggtgacaaaaacctttgatgctcaaatttttaaactcctgttgacacacacttgtta
tgaatcaggctgtgatgattggcgcaggggtacggacctcagctgagtcatgggagctga
atgtatgtgtttctcctttgtcttgcatgtggcaggatgctggggagcacttacaggaga
cttgcctcaatctgagcctgctcttcacaacgtaattctaggatactgatctcattctgg
gattgtgagagaggaaagagatcccactcagttgcatccctctcttccagctacccacag
ggtgtcgtcttttttcctgggaggactgaagtgatcctctagaagaggatacaccacccc
ccccaccacccccaataatcctcaacagatttgcttgggaaatttgaaatgtacctacat
gaagttaggaaagagggaactgaaccgctactatctgctcaccttctgtttattatcttt
cttgtatctcgtcttgaacagGAAAATGTTGGGGCTTTTCAGGAAGCACAATAAGATCCC
TGGgtaagttgaagttaacaggtctgcctcggtatatccaggaaataggtgcatggtttt
aactcttaccatggggtgattgggatttttttttttttttttacatactttagtcacagt
gattgagcattcttctgctaggcaaatggacagttgcttccaccatctagggtatcctag
attaaggaagcactgtgtttaatctgcttggtgattgcagcacactggggatacattcaa
cagatccttagtgaaggcatactgaaccagtgttccttatatttctttggcccattaaag
ttagtcttctgggcagcccaggttgctcagtggtttagcgccgccttcagcccagggcct
gatcctagagacgcgggatcgagtccttcattgggctctctgcatgaagcctgcttctcc
ctctgcctgtgtctctgccccccaccccctctgtctctcaggaataaataaataaaatct
tttaaaaataaataagtaaatctttgaagggattcaggggttgttggggaatgttgactt
tttgtctttcttttacagAAATAAGTTGCTGAATGAGTTTATGGATTCTGCAAAAGCATC
CAACAGTCCTGCCCAGGCCATTGAGGTAGTGAAGCTGGCAGGTGCCTTCAGCTTGCCTAT
TTGTGAAGGCCTCACCCAGAGAGTGATGGCTGACTTTGCAATCAGCCAGGAACAAAAgta
agtcctgaatggataacataaagtgataaaaatggagcagaccatttgtctacccattca
atgtttatagctttttgcctcctgaatttttttctttgcgaaaaatcaggatgcattaat
ttagttagttatttcatttgtcacatacatcagagaggcctatagttttggctcttgaaa
ccttttcccctttcattatagttcagtgcagctgcagagtcccctcccacaagactgaaa
tgcagtgtaaccctcgtttattttccttacagGGAAGCCCTGGGAAACCTAACGTCACTG
ACCAGTGACAGCGACAGCGACAGTGACAGTGACATCAGTGAAGGCATATAAAAGTGGGTG
AATCAGGAGCAGCTATGGCCTAGCATAGCTATTGTAATTACACTTGAGAATTGACATCTC
TGTTCAACCATATTGTGAAGAGAACAAGAGAATTCAGACTTCAACTTTTAAGAACAATAG
ATACCAGAGGGACTACTTAAATTCCGAATTTGATACTTACTAAGCCACCCATTTAAACAG
AAGCCGACCTACCATTTTCATTTCTTTGGACACAGCTCCTGGTTTCAGCATAAGCTTTGT
ACCTACAGTGTTTGTTGGCCAACTTCACTGTTGCCCTTTGTGGTTTGCCCTCCCATCATG
GACTTGGCCTTCATTGGCTGATTTGCAACCTTAGAAAAGGACGTGTCTAAAGGAGGTTTG
CACATGTATCTCCATTGATACTAGATCAGTATACCAATTTTAGGGATATTTAGAGGTGAG
AAATTTGCCATTGTTTAATCATTTCTAGGATGCGGAGTTTTAAGCTACATGTATGGGAAA
ATGAGGGCTGTAAATAAACACTAGGTAATGTGCAttgagcgcaatttttttttttttttt
tttagcgcacttctcttactttgacatagcctgtttcccctgagccctgggatttctaca
agtgcttcatctcccttgcttcccccttttttgccatcacctttagttgtgctctactga
aagtggtctaaagtgaggactgctaatcaagaatctctagtctggtatttctcttaccac
cagaactttgaaacagtattggaagttaacaggaacctgcatggtttattaggaccattc
ttaacccttcaccagggcttccacaagctgcttttgctcatacctggtcccagattaact
gagagaccccatgagttccccacagatgaacagcttcaaccttaccctgccagggttggc
atttatgagcaattttgtactgttgtctgttccgtttacattttccatccattctatcta
ggcctagatccattcgtgcatcttcagaaatctaagtattggttcatgttgtgtcctaga
ttgtgtttaagacatttaattcaaggacaaagggggcagggaaatgacagcaaataacta
cttaagcattcatgtgcattattccttgacatatcaaagtgaacaaaaggaccattaaga
aaggttagctttgggcagccctgtggctcagcggtttagagctgccttcagcccagggcc
agaccctggggacccgggatcgagtcctgagttgggctccctgaatggagcctgcttctc
cctctgcctgtgtctctgcctctccctctctctctgtggatctctcatgattaaataaag
atcttttaataaataaaagaaaggttagcctttgattttggtttacaacttccagggaga
acctggcttcctggaggcttctcttctctgtgctccttcccatctcacctatacatgcct
cgctctcttggccaagtactcactcactgcaatccctacaaatgtgtggcacacttctcc
ccttgccagccccc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1104, 2996..3048, 3162..3198, 7854..7899, 12425..12493, 12955..13059, 14849..14972, 16815..16930, 17917..17984, 19143..19230, 19625..19685, 19975..20060, 20912..21056, 21746..21796, 23673..23762, 24055..24083, 24933..25039, 26010..26088, 26179..26269, 27303..27388, 27868..28016, 29301..29342, 29898..30056, 30332..30933
1001..1104, 2996..3048, 3162..3198, 7854..7899, 12425..12493, 12955..13059, 14849..14972, 16815..16930, 17917..17984, 19143..19230, 19625..19685, 19975..20060, 20912..21056, 21746..21796, 23673..23762, 24055..24083, 24933..25039, 26010..26088, 26179..26269, 27303..27388, 27868..28016, 29301..29342, 29898..30056, 30332..30410
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved