Canis_familiaris Locus ODC1
snOPY snoRNA Orthological Gene Database
Canis_familiaris ODC1
Canis_familiaris
ODC1
17
SNORA42
2562..2694
9405
CCAGAGGGTTCACGCTCTAAGGGACAGCAGATTTCCCAGGGTTTGGGGTTTTTTATGTA
TTCATTGTGCCCTCAAAGCGAGGCAATGGCAGCCGCCCTCGGAGACGGCTGCACTGGCGA
CCCGTGGGTAGGGGCAGCGGAGGGGTTCGCTGGCTTGCAGCCCCTCCACGTCCTTCCCCG
AGGCCCTGAGACAAGTCTCCGGCTTAACGCCGCGCGCGGCCTCGCGTGGCCGCCTGCCAC
GGGTCGGGGTCGGGGCACAGCTGACCGGGCCAGGCGCCCACCACCTGCCAGGTGACCCTC
AGCACGCGCGCACCTGCCCCTCCGTGGGTCTGCGCCCGGGCGGGGGGGGCGGGGCCGGAT
GGGGCAGGTCCCGTCCCGGGGACGGCGGGGCCGGAGTCCACCTGGCGGGGTCCACGTGGA
CCTCGGGGCCCCGCGGTCCCCTGCCCCTGCCCCCGGGCACGAGGCATTTACAGCCGGGCG
GGGGCACAGTGCTGCCCGGCGCGGGCGCGGACGCCGGGCATCGGTCCGCCGCGGGCTCCG
CGGTCGTGCGGCGGCCGCTCCCGCCCCGAGGCCGAGGTCCTCCGCGCGCGCGGCCGGCGG
ATGGCGCCGAGGGCCGGGGACCTGCGGCGTCGTGCGCGTGCGCGTGCGCGGCCCGCCGCG
GGGCCGGGAAGGGCGCGAGGCCGCCGGGGAGCCCTGCGGCGTCGTGCGCGTGCGCAAGGC
CGCGGCGGGGGCCGGGCCGAGGGGCGCCGGGAGGCGCTGACGTCGGGTCGCCCGCGCCCC
CCCGCCCCTCCGTCCGGCAGCGGGTTGGCCGCCGCCGCCGCGCTCCGCCCCCTCTTAAGA
GGACGCCCGGACGGAACCGATCGCGGCTGGNNNNNNNNNNNNNNNNNNNNNNGCTGGTTT
GAGCTGGTGCGTCGCCATGACCCCTGCGCGGCGCTATAAGTAGCGGAGCGCCGGCCCGGC
GGCTTTGTCAGTCCCTCAGCGTCCGCCGCCGCCGCCCCTCAGCCAGAGCTCCGGCGCCAC
CTCGGGCCGGCGGTCCTCCGCGGGAGGGAGCGAGGCGGCGGGCGGCCGGCGGACGGGGGA
CGGGGGCGGCGGGGCGGCCGGCGGTCCTGCGCGCTCGGCGGCGGCATCTCCATGGGACTG
GCCCGCGGCGCCCGCGCGCTCTGAGGTGAGGGGGCGCGTCCGGGCGGGGGAGGCAGGGAC
GGGGCCGGCCACGTGTCCCCGCGCGCCGCGCCGCGCCGCAGGCCGGGAGGACCCCGGGGC
CGCGGGGGACACGTGGTCCCGGCGCCGGCCGCGGCTGCCGACCCTGCGGGGCCTGCTGTC
CCCCCGGAAGCGGGGAGCCGAGCCCCGGCCCCGCGAGCGCCCGGCGGCCGGAGGGGACCG
CGGCTCCCGCTTCCGAACCACGTCAGGGGTGCTCGGAGCCGGAAGCTGCCGGGCAGGCCC
GCGGTTTCCTCAACCGCTATTCTTCTTCTTTAAGACTCGCGCGGCAGCAGGTGCAGGAGA
GGTGGGAGCGGGCCCGTGCGGGTCTCGGGCTCCCGTCGCTCGGCCCACTTGGGCTGCGGT
GAGGCGGACCTTCGCCCCTCTCAGTTCTCGTGCAGAGGACGTGACCCGACCTAGAAGTTC
GCCCGAGCGGAGCTAGATGACGGCCGTCCAGGAGCCGTGGCAATGCCTTCTCCACTAGCC
GCGGCTCGGAACGGTCCGGGAAGGGATCTTTGCAGGACTCAGAGGTTTAAGAAAGGCCTA
GACTATTGAGAGCCCAGTTCGGGAGAACAGACCTACACGTAGGAGGCAGCCCTTAAGGGT
TTGCAAAAAAAAAACAAAAAACAAAAAAAAAAAACAATGTATTGTGGTCGTTTGAGATCC
CCCAATAATTGGTGTAAGTGTGGGAAGCAGAACCTCTCAGAAATGTTTGGGGAGGACAGA
ATGTGTTGACTTTATTTAAAGCTAAAAGTGGGCATCATTTCGCTGCCTCGTGACTTTTTT
TTAAGCTGGTCCCTGTCTCTGGCAAAATACTTCGCAATTGGCAGGAAGGGATTTGGTAGC
AGAGGAGCGCTGTCTTGGGTTAACCCGCCCTGACTTTTAAGTCAACTTCGCTGTACAGGG
CACTACAAAGTGGAATGGCTCTGTGTTGCAAGTTATTCAAATGAAGCTTTAAGAGGTACT
TAAGAGCAATTTATTTCAAAGTGGTGACAACTGCCCAAGTTTAAGCTTGAACACTGCCCT
GAAAGCTATTTGACAAGACCCTAACTAACGATCCCGGTCTGTCACTGCACAAGCCTGTGA
TAAGTGTTCATTATATAGACAGGATGGGTTTGCTGTCCCTTTAGTCTCTCGACTTCCCCT
AGAGGTGCTTCAGGCAACGCAGGAGGTTAACTGCGCCAGAAAGTCACACTAGATCAAGTC
TTAAAACAAGTTCTACTAGGGGCGCCCTGCTGGCTCAGGCGGGAGAGCAGGCGGCTCTTG
ATCAGGAGGCTCTAAGTTCGAGCCCCGCGATGGGTGTAGAGATTTAAAAGAAAGTTTTAA
AGTCTTAAAAGTCACACAACATCAAAAGACCAATTCTACCACGCATGGGTTTGGATTTAT
GGCAGGCTCGTCCCCCTGGGCCTCTCATAGTGTCCCATGCCAGAGCAAACCATGGCCCCG
AACCATTGCCTGGCCTCTGCCGTAGGCTGCAGGCACTGAAGTGGGTCGCACAGTGGAAAG
AAAGTCCTGCCTAACAGAAATTAAAAAGGTTATAAAATCAATAATTTTAAGATAACTCAT
TTACCAACGTCACGTGTAACAAAGACCGAGGACAGTGGCTCAGAATGTTACAAGCTTTAT
TTTTGCTTATTCATAATTCCTGTTTGCTTTTTTATTTTTGTTATTCATAAAGTTAGCCAA
AAATCATTTCCATGTGATTATTGTCCTAGCTAAGCAAGGATCAGGGTGCCGGTAAGGACA
GATGAGATTTGCAGAATCACTGACTTGACGCCCAGCCACGCTGGTTTAAGAACGCTGATT
TCTGATCAGATCCCACAACTGTATACATTTTGTTGATGTGGTGATTACTCTCTGGAAAAA
TACATGCGTGGCATGAAAATAAAATAGCATAAAAATTAGCTCGTGAAATTCTTAAGGAAC
TGAGGAGCGCTCAGTAAGGTTAGCCTTAAGACATTTCCATGACATTTCCATCAGTCATTA
AAGATTGTTCCGTTTAAGACTTAGTGACAACAGGAGATAGCAAGGTGTTTATAAGGCATC
TTTCAGAATTACTGAAATGATACTTTAAGGTTCTAAAGAGCTAAAGCTTCTCTGAAATCA
AACTGACCATTAAAAAAATTTCCTGTTTTAAAGAACTAAGTGAAGATTCTGAAATGTGCT
TTCTTTTTCTTTTCTTTTCTTTTTTTTTAAAGATTTTATTTGTTTATGAAAGAGGCAGAG
GGAGAAGCAGGCTGCCTTTGGGGAGCCTGTTGTGGGACTTGATCCCAGGCACCTGGGATT
ACGACCTGAGCCAAAGACAGAAAGGCAGATGCTCAACCACTGAGCCACCGAGGTGCCCCT
GAAACATGCTTCCTATAGGTTTTTTAGCATGAATATTTAAAATGCTTATTTTGCGGTGTT
TAAGTACTACAATGGGATTTTAGCCTGTCACCTTGAGAAAGTTTAGCGTTGAACCTGTGG
TGTCTTTAGATAGTGCAGAGCTTTATGGAATCCTGTGACCTATCCCTGGAATAATGGGAT
TCCCAAATCCAGTGAGTGAGCTATCTACAGAGTGTGTGTAAGTGGCCTTGCTTCCTGTGT
ATGTGCAGTCAGTGCCTGATCTTTCAATTTGATATGTTCCTAAGGTGGACAGCAAATTCT
CTGCCGATCAGGACATTTTCACGGCGGCCCCAGGGACACACGTGTTTTCAGTGGGACTTG
GAATTCCAGAGAATTGGCTTTTGTGAGAAACTGGCAATAATTTCTTTAAATTCCATCTCC
TAGTTTTCTGTGTAAGTATTCGTGGTAGTTTGCAGGTTTTTGTTACGAAGTACTGGGTAT
GGCTATGGCTTCTAAATATCTCCATCCTATTTGCAGTTTGTTAAGTTTTGGGGGAGCATC
GAGAAACCATGAACAACTTTAATAATGCAGAGTTCGACTGCCATTTCCTCGATGAAGGCT
TTACTGCCAAGGATATTCTGGACCAAAAAATTAATGAAGTTTCATCCTCTGTAAGTATCT
TAAGTCCATGCTGGCCATGCAGCTTTGAAAATGCTGGGCAGATGACTGAGAAACTTCATT
GGGGTCCTCAGGAAATGTAATGGAACTCACACGGTTAGGGAATTCAGAATTTATTCGCTG
TGGATCATTCCATATGATAGTGACATTGTGTCCGTGCCCAGGCTAAAAACTTGAGGATCC
GTTGAGACTGGTGGGAATGAGAGTTGAGGCTGCCTGTGGGATGTGAGATTAGGCAGCCAA
CAAGTTCCCTGTACCCACTTTTGCTGTAGGATGATAAGGATGCCTTCTATGTTGCTGACC
TGGGAGACATTCTAAAGAAACATCTGAGATGGTTAAAAGCTCTTCCTCGGGTCACCCCCT
TTTATGCAGTCAAATGCAATGATAGCAGAACCATAGTGAAGACCCTTGCTGCCATCGGAA
CAGGATTTGACTGTGCCAGCAAGGTAAGCAAAAACAGCAGGACTCCAAAATGATCTGAAA
TGGCCCTGGTGCTCCCAACAGGGCAGATCAAAATTGTGTTTCTTCGGCAATAGATAGTAA
TGAAAGTTGAGGGTGGGGGGGGGACTGTGAACTCCAGTGTTACTCGGTTTCCTTCATTGA
TGAACTATATATATATAATATACTCTCATCTTTTTCAGACTGAAATACAATTGGTACAGA
GTCTCGGGGTGCCTCCAGAGAGGATTATCTATGCAAATCCTTGTAAACAAGTGTCTCAGA
TTAAGTACGCTTCAAATAATGGAGTCCAGATGATGACTTTTGATAGTGAAGTTGAATTGA
TGAAAGTTGCCAGGGCACATCCAAAGGCAAAGTGAGTTACTCCTCCATTTAAGGGCAGGG
TCACATATGGGACCTGCATATTGTCAAATTCAGATTTTCAGTTTTGAGATTCCTATGCTT
TAAGTAAAATGTAAAAATGTCCTGGGTCAGGGGCAGAGTAGAAAATCTTAAATCCTCTTG
ATAAATAAAACTGTGTGGGATTCCAACCATGGGGTATCAGAGCCACGGATTTTTATCTTA
ACCATGGCTCTAAGTGGTCTTCTGTCATGGGAAGTTTAATACCATTTTTCTGATTCTAGG
TTGGTTTTGCGGATTGCCACTGATGATTCCAAAGCAGTCTGTCGCCTCAGTGTTAAATTT
GGTGCCACACTCAAAACCAGTAGGCTTCTTTTGGAACGGGCAAGAGAGCTAAATATTGAC
GTCATTGGTGTCAGGTGAGATCTTGGTGGTGGCGTAGAGGCTAAGATACTAGACAATGCA
TGTTTTACAAGTTTTCTCCTGCTGTAAGTAGTAATTTTCAAAAATAGCATATTCTCCTTT
CTTTGCCCCAGCTTCCACGTGGGAAGTGGCTGTACCGATCCTGAGACCTTTGTGCAAGCC
ATCTCTGATGCCCGTTGTGTCTTTGACATGGGAGTGAGTATATAAACTCAAGCATGCTGG
GGAGGAGGCCCAGGGCTGACAGTAACTAGGCTCGGCTCTAGAATTAACCTTTTGCAAAAG
TCATCCCTTATGCCAGAGGATTAAACCCATTTGTTGCATACATTTTCATGACTTGTTATC
AGTCTGCCTGTACCCGATTGACTTCATTTTCTTGACTCTAGGCTGAGGTCGGTTTCAACA
TGTATCTGCTTGATATCGGTGGTGGCTTTCCTGGATCTGAGGATGTAAAGCTTAAATTTG
AAGAGGTAATTTATAACAAAAAACTGTAACAGCTATTTTAGCACGTTCCATTTTGGAGTA
TTTCAGAACTTAAGTGTTTTAACTAATTTCAAAAGAAATCGTACAAACCTAGAAATAGTG
TCTTGGTAGGATATTTTCAGTGAGTTCTGTGTTATTTAAAATTGTATTTTGGGATGTCTG
GGTGGCTCAGTGCTTGAGCGTCTGCCTTTGACTCAGGGTGTGATCCTAGGGTCCGGCAAT
TGAGTCCCAAGTCGAGCTCCCCACGGGGAGCCTGCTTCTCCCTCTGCCTCTCTCTGTGTC
TCTCATGAATAAATAGTCTTTTTTTTTTTTTTTTTTTATGTATTTTAGTGTGCTTTGGCA
TTCCAAACTGAAATGAGTCTCTTGCCCCCACCCAATCGTGTAAAACAGTTGATTACTTTA
GGAAATGTTGCTGTGCAAAGTGTGTGGACCATATGTCGTTACCCCAAGTGTGCTCTTCTA
GATACTGTATTTTCCTTTAAACATTTTAATTACGAAGTTAAATACTTCATATCTCATGAA
GTGGACCCTTATGTGGTGGTTGAATTTATGAAACAGATCACCTTCTTACTGAGATTTTGT
GAGATAGACAAGAATTAAGAGTTTTATCCTGTTGGTGTGAGTTTGATAGGTTAAAGTACT
TGGTACCTTGATATCTCAGTAAGAGGTGATTTATTGTTGGGGAGAATCCTACCCATAACA
TCTTACAAAGGAGGGGAGGTATCCAGAGGGGAATCTAAGTGAAACCACAGGGTTTTTTTT
AGGGAGATGCTGGTTTGTTTTTCTTCTGTGGTTGCTTGATAATAAACCTCCCTGCTGGTG
GCTGCTTTCAACGTTTTTTTATCCTGTCCTGTCACAGCACTGGTTTCTGCTCTTTGCTGT
TAGTTCCCCCTGATAATGACTGTCCTTGTCTGTCTCACTCTTGTAGATCACCAGTGTTAT
CAACCCAGCCCTGGACAAGTACTTCCCGGCTGACTCGGGGGTAAGGGTCATAGCCGAGCC
CGGCAGATACTACGTTGCGTCAGCCTTCACGCTCGCAGTTAACATCATTGCCAAAAAACT
CGTCTTAAAGGAACAGACAGGTTCCGATGGTACGTATAAAGGATGAATCACTGCACACAT
AGTTGTAAGTTGGTACAGAAAGTGGTAATAGAGACTACTCTGCCTTTCTAGATGAAGATG
AGTCGAGTGAACAAACCTTTATGTATTACGTGAACGATGGAGTGTATGGATCATTTAATT
GCATCCTCTATGATCATGCCCACGTGAAGCCCCTTCTGCAGAAGGTACCTTCTGAACATA
GCATATGCAGCAGTTAAGATGTGTGGTCATAATAACAAGGGTAACTAGTTATGTTTCTCT
CTCTTCGAATGTAGAGACCTAAACCAGATGAGAAGTACTATTCCACTAGCATATGGGGAC
CCACGTGTGATGGTCTGGATCGCATTGTTGAGCGCTGCGACTTGCCGGAGATACACGTGG
GCGATTGGATGCTCTTTGAAAACATGGGTGCTTACACTGTTGCTGCTGCTTCTACTTTCA
ATGGATTCCAGAGGCCAACTATCTACTATGTGATGTCGGGGCCAACATGGTTAGTGATGG
CAACACATGTTTATGGTTTAATAAGAACAGATTTCCTCAGGTTTCTGCTGGCTGTTGTCT
GGTTTGTTTGTTTGTTTGTTTGTTTATTTATTTATTTATTTATTTTGTTGTCTGGTTTAA
AAGGAAATTGTCTCGTTTAGATTTAAACACTAGGGGATCCCTGGGTGGCTCAACGGTTTG
GCACCTGCCTTTGGCCCAGGGTGTGGTCCTGGAGTCCCGGGATCGAGTCCCACATCGGGC
TGCCTGCATGTAGCCTGCTTCTCCTTCCTCCTGTGTCTTTACCTCTTTCTCTCTCTGCGT
CTCTCATGAATAAATAAATAAAATATTTAAAAAAAATAGATTTAAACACTAACCACGTTT
TTAAAAATAGTTTCCTTTCTGCCTTAAGAATATATGCTGTCAAAAAAAAAAAAAAAAAAG
AATATATGCTGTCAAATTCAGAAAATACAAATGGAAAGAAAATCCTTCTGGGAATACTGA
TCTGTATTTGGTTTCAGATTTTTGCAAAGGTATAATTATTTCAAAAAAAATTAGTGTATT
TATATATAAGTAGAATAGTTTAATGAATGCACGTGACTTGTGGTTTCCCTGTGACGGAAA
TGATGGTCCTGAAGAAAGGCTTGCTTTAGAAACATTGAGTTGCTTCCTGATGACCTAGTA
ACCAAGGAAGTAAATAGGCTCATGAATAAGTGATTCTTGTGTGAAGCTGCCCAGTTACGG
GGTGACTCAGGGTTTCTGAATATGCTACTTCTGTCCTTCAGGCAACTGATGCAGCAGATC
CAGAACCACGACTTCCCGCCCGAAGTAGAGGAGCAAGACGTCAGCACTCTGCCAGTGTCC
TGTGCTTGGGAGAGCGGGATGAAACGTCCCCCCGCTGCCTGTGCTTCAGCTAGCATTAAC
GTGTAGGTGCCACTCCTGTAGCTGTTAACTTCGAGTTTAGCTTGAATTGTGGGATTTGGG
GGGACCGTTTAACTTAATTACTGCTAGTTTTGAGATGTCTGTAAGTAGGGTTGGCATGAA
TGCAACAGTATGGAAGACTAGGAGATGGGGTCACTTATCTGTGTTCCTATGGAAACTATT
TGAATATTTGTTTTATATGGATTTTTATTCAATTTTCAAACATGCTACTAAGGAGTGCCC
CTCAGCTGCTGAGCAAGCGTTTGTAGCTTGTATGTTGGCAGAATGGGCCAAAAGCTTAGT
GTTGTGACCTGTTTTGAAAATAAAGTATCTTGAAATAATTAGGCATTGGGGAATTTTTAG
TGTGTCCATTCCAAACGGCTCACCTTGAATGTGTTTTGTAAGTGGAGATTGTCCCACCGG
CTGAGAAAATTATCCCAGAGGACTTAGGAGTTGGTGGTTTTCAATATTTTGAAAATCCAT
CAAAATGCCATCATCCTAGTCAACATTTTTATTTCAAGTACATGAGTCTTGTACAGCGTT
TGCTTTGGATTCTCACAGAGCACAGTGAATTTAGCCCACATGTAGGTAGAAGGAAAAGCG
AGGAGGAGACAGGCCATACCCCTGTGCTGCTGTCCCAGCTCAGCCCGCCCCGGGTGTACA
CAGAAGTGGCTGTGATGGAGTGCTCAGGGCCATTTGTTAACTGCCTTGTGTCAGGGCTGG
GGCCCAGGGAAGGCCCATGGAGCCCCCCTGAGCGCTGCCTGCAGGACAGATGTTCCTTCC
CACTTGTCTTCTCTCCTGGACAAGTTGCATAGCTGCAAGTTAGGAATGTGGTACAACATT
TGGCAGTCAACTTATTTTAATAAATTCAACAATAATTATCCTGTGTTGTAGCTCTCTACC
TTCTTTGACTTTGACCACTGGCCTTTTACGTTCCCTTACTCAACTCCTAACCCCACTCCC
CAAAATAGGACATCAGGCTCTCATACTGTGTGTAACCCCGAAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1164, 3824..3970, 4056..4189, 4469..4642, 4838..5010, 5279..5413, 5531..5612, 5801..5884, 6826..6988, 7071..7183, 7274..7488, 8261..8405
4088..4189, 4469..4642, 4838..5010, 5279..5413, 5531..5612, 5801..5884, 6826..6988, 7071..7183, 7274..7488, 8261..8402
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved