Canis_familiaris Locus RANBP1
snOPY snoRNA Orthological Gene Database
Canis_familiaris RANBP1
Canis_familiaris
RANBP1
26
SNORA77
7725..7850
9612
GAAGATCTCCGAGGTGAACAAGTCGTCCCTGATGTAGCTGTAGAGCCCGGGCTGAGGCG
CGGCCCCCGCGGCCGCCCCGGGCGCCCCTTCCTGCTCCTGCGCTTCCTCCCGGGGGGCCG
GGGCCGCAGGGCTGCCCCGGGCACCGCCGCCGTCCGGGCCGCAGCCGTCCACGGGCACAG
GGCGCTGTGCAGGGGCAGACGGGCCTCGGGGTGAGGACCGGCCCCAGGGCCTGGGCGCCG
CCCACGAGCCCCCCGTTAAGGCACCCGGCGCCCCGGCTCGCCCCTCCCCCCGGCTCCCAA
CTTGCCCCCGCCCCACGTTGTCTCCTAGCGGCTTCCCGCCCGGCCTCCCATCACGATCTC
CCTTCACTTTACCTCGTCGCCGAGCTCGTCACTCACCGTCCGGTCCATCCGCGTCGCGCC
CGGGGCCCCCGCGAGGGCCACCTCCGCCTCCGGGCCCTGGGCCTGGCAGAAGGGAGGCAG
GCGCTCCGAGGGCGGCCGCAACGCCGCGAGGCCGCTTCCCGGCTCCGCCCAGGGCGGGGG
CGGGACTCGAACCCTCGCCGCTCGGGTTCGCGTCCCCGACGTGGGGTACGCCGCCCGCCC
GCCAGGGGCCCGTGCCGGCCGCTCGCCTGGTTGGCCGCTCTCCCGTGAGCCAGCGCGTGC
CGCCGAGGCCGCGCGTCTCTATCATCTCGACTTCCGGTGATGTCATCGCCACGCGCCAGC
TCGGATCCCCTGGCCCTTAGCGAGCCCGAGGGGCGCGCGCCACCGCGGGGCGGAAGTGCG
CGCGAGGGCCGCCGGGAGCGCACGTCCCCTGGCTGCCGGGCTGGCCGGGCATGCGCCGGG
GGCGTTTTGGCGGGAAGCGCGGGGCGGGCAGGACAATGAGACTGTCCGCCGTGTGAGCCA
ATAAAGCTGCGCTGGTTTTGAATCGCGTCGCGTTTCCCGCCGCCGAGGTCAGGGGTCGGG
GTTCGGGTCGCGGGGCGGAGGGAAGAGCGGGAGGGCGGGAGGCGCCGGCGCCAGACGCGG
AGGGAAGGAGCTACGACCAGCCGCCGAGAGGCCGCGGAGCCAGCGACGACCGAGCCCGCC
GAGCCGCCGCCGCCGCCGCCGCCGCGCCCCCATGGCGGCCGCCAAGGTGCGGCCGGGCTC
GGGCGGGGACCGGGTGGGGGCCGGGAGGCCGAGGCCGCTGCCGGCGGCCACGTGGGCGGC
CCGCGCCGCCGCCGCCAACCCCCGCCGGCTTGCGGGCTCCGTGCCTTGCGGAGCCTCGGC
GGCGCGTGGTCGGAGCTTCGGGGAGCGCGGCCTGGGGCCCGCGGGGCCTGGGGGCGCGGG
CTCGGGGGCTGCCGGGCGCCCGCGTGACCTTGGGGCGGGCCCCGCCGAGGCCGGGGCGCT
CCATCGGGGCGGGGGGCGGCCCGCCGACCAGGCTAAGTGGTCTCCGCTCGATATGCAGCT
CGCATGAGACCCAGGCGGGGGCCCGGCTTCCGCGGCTCGGCACACTTGCAGGCTTCCCAC
CGGAACCGAGCGTCCCTCCCGCCGCCGCCTGCGCAGCACTTCATTCATTCTGTGCTCACG
CCCTGAACGGCCGCAGGCCGCGGGGGCGCGGTATGGTTCCAGCCGGGTGGACCGGCCTGG
CCGCGCGACCCGGGGGCGGCGGCTGCTCCGGGGACCGCGGGCCTCTGCCCGGGCGAGCTG
GCCGACCGCGGAAGGCAGCTTTTCGTATTTGCTGTTCCGGCCCGGGACGGGTAGTAAAGC
CCCCCGGGTTCTTACGGACTGCAGATCGCCAAGCCACGTGTTTTGTGAGACTTGAACCTA
AAACGGGCTCTTCTGCGGCCTGTAGTTTTCTATTTGTATGATTTCTGTCGATGCATCAAC
TTTGGGATGTAAGATAAAACTGCCGGCAGGACGTGCATTTCACGTAAACTCTAGGAGTTG
GTAGCCACTTTCACCCCCTTCTGCTAAACAAGAGCACGGGGTTTTTTTTTGGTTTTTTTT
TTTCCCTTCAACCAGTAAACGTTGGTGAAAGGGTGACAGGCTCCATGAGGCTCTCTTCCA
CCATTGTGCCTTTTAATCTTCATCTAGTGCTGTCCTTATCCAGGTTTTACAGGTGAGGAG
ACAGGTGGGAAGTGATGAGGCAGTGCCTCTGGCCAGTAGGCCGCCCACCTTGAGGGGCCC
CAGCCACACTGCACACACGTGCCTGATGCCTCTGCGGAGGGCGTGGAAGTTCAGCATCTT
CCTGCACTCTTGAATGGGGGTGCCAGCCTTGTGTGAAAGACTGTGGGCTTAACCTCTTGC
TCTGGGATGAGGCCATTCACTAGGAGGGATTGCCCACTGCGGGCACAGCTGAGCTCTGGG
TGGGGGCCAGGCTCCGGAGCCAGCAGAGTCACTTCTCTGCACCTCCCTCCACAGGACACC
CATGAGGACCATGACACCTCCACCGAGAATGCAGATGAGTCCAACCACGACCCCCAGTTC
GAACCTATAGTTTCTCTTCCTGAGCAAGAAATTAAAACGCTGGAAGAAGATGAAGAAGAG
CTTTTTAAGATGTAAGTAAGCTCACGTTGCTCCAGACCTTGGTATCTTTAGTGTAAGATT
GAGTTTATGGTTTTTATGGCCATCAGGGTCTTGGCCTGGCTTGTAATTGGACTGAGACTG
AGGAAAGGGCTTGGTTGGGATTGTGCAATAACTAATCCTATGTGGAAATCAAAAAGCTAT
TGGACGACTCTTCACTTGGTGCCCCTTCTTCTGGTGGCCAGTCCTGTGGAGAGCACAGGT
GCTCCCTGGTGTCCTGTTCCTGCTGCTCTGTCCACAAAGGGGCATCGCCACAGTCCTCTG
TCCTTGCCACCTTACAGGCTTGCTGCCTTTAGAGGTTTCCAACTGCACCTTTCATCTGGT
TGAACAGGGAGTCTCTGCCATTGTTATCATTTCTTCTTTTGCGCTACAGACTTTGGCATC
CTGAAGTTTGTGAACTCCCAAATCAGTGTTTTTATGCACAAAATGACACTTGAAATTACA
AATGAAAGGGGATGGTGTTACACTTACCAAAATCATTTTCTAAAAAATCATTGTACATGT
GTTTTTTGGCGCCTTCAGTAAGAAGCTACAAAGGCAGGTGTCATTTTTAAGTAGCACTGG
CACCAGCCATTTGTTGAGATGTCTGTGACAAAATCAGCGCGCTGCTGAGACTGACCTGTT
GCCTGTGCTCAGCATCACACGGAACGCTAGGTTCTGTTTCAAGTTAACGGAAATAGGCTG
GAGTGCTTTTCCTGTCCAAGCTTACGGAGCTCCCCCACTTTTCAGATTCTATCCAAAAAG
CCAGTTGAGGGTTCAAGTGCTTTCCTGACTCCTCCCTCTAAGGAAGGCAGATTGGGAAGA
CCAGCCTCTTCCCACTACTCTGAAAGGCCTGGGAAAGGAGAGTCACATATATCCCTTTGA
TCTCAAGAGAGTGGTGGGTCTGTCCCAGAAGACGCTGGATCTCCACATGTGTGCTTTGCC
CAGAAATGGTGCCACAGCCAGGGACTGTTCCCTCCCAGGGGTGAGGACTGCTGCTGGTGC
TGTCACACACACACTCACCCCCCGCTCTGGCCCTCCTGCCCACACTGGACTGAGAACTGC
TCCTGGCAGTCCTGAACATAGGCCCTTCCTGAGGGAGGTGAGGCCAGCAGGTCAGGCCTT
TACGTCTGGGCCCTTGGGCGTCAGGTGAAAGCTCTGGTGGCATCCTTTTGAGGGCAGTTA
TTTCCCTTAACAGAATTGAGTTTGGGAAAGAGAGCAGGGTGTTGTGCAGGAAATGGACCA
GCAAGGCTGGGGTCCTAGGGGGAAGGAAATGGAGCCTGAAGTCCTAAGGGCAGGACTGTT
GGGCTCACCACGGGGGCTTTGCTGCCCGGTGGGACGGGGCTTTGGCTGGGCCCAATGTGA
GGTACTATTCTGGGCAGGAGGGCAGGGTGTTGGACCAGAGCTTGGTGGCCTGAGTAGAGG
TCTACAGCCCCCTCTCTGTGTTGGGGGGCCAGGGAAAGAGGGCATCTCACAGCAGGGGGA
AGGGCTGGCCCTGTGGACGACAGGGGTCCTCGACCTCTCTCTGTTTCAGTGCTACCCCTG
TGGCCCTATGGGACACCAGGGGCTGCCCTGCAGTGTGATCACAGGCAAGCCTAGCGTACT
TGGGGAGGGGGGTGTCTTTGCTGAGAAGTTGGGTCTTTCTGTTGGAAATCTCTTTTCTCT
TTGATTATTCCAAGTAAAACCTGGGAATTGATTGTTGACTTGCTCTTTTGTTAGTTTTTA
AACTAACAGTCCTAGAGGTACCAAGAAAGGAAAGGGTGTCTATGGTGGTGCTAGAAACAG
CCATTTGTTCAATGCACAGAAAACAAGTGTTCTTTCCCAGCAAACATTTGGCTGTGTATT
CCCCTCTCTGTGCACATCTAAGCCCTCTCTTAATGGCTTTTCTTGAAGGCGGGCAAAGCT
ATTCCGATTCGCTTCAGAGAACGATCTCCCAGAATGGAAGGAACGAGGCACTGGTGACGT
CAAGCTTCTGAAGCATAAGGAGAAAGGGACCATTCGTCTCCTTATGAGGAGGGACAAGAC
CCTGAAGATATGCGCCAACCACTACAGTAGGTGACCTTTTCGGGGAGAGTTTTCACTCTG
AGTCCCACATAAGGACGCCTTCAAGTCTTCGGGCAGGCTGCCTTCGGTGCCACACGGGAG
CCTGGGGGCACACTGTGACATGGGGCACGTATTCGCATTGTGTTCAGGACTTAAAGTGGG
AAATGAGGTGTTCCAACACTCTCTGAACTCAGAGCAGACCTACAGAAAAACTTAAGGCAT
ATACGCTGTGGAGTCCAGGCAGATAGGACATGGTGGGGTGGACACAGCCCCATTGTGGGC
TCGGGACCATGGAGGGTCTGCCCCAGGAATGGGTGGCGTGAGGACAGCTGTTGCTGTATT
TGACATGCTCCATAGGAAGCTTTCCCACTCTTTGTTTTTAAAGTTCTTATTCATTTACTT
GACAGAGCATGCTCACACAAGCAGGGGGAGAGGGAGAAGCAGCTCTCCACTGAGCAGGGA
GCTTGACATCAGGCCTGGACCTGGACCCGAAGGCAGGCTTAACCGACTGAGCCACCCAGG
GGCCCTTACCTTCCCACTCTTTGATGTGTTTTGTCCCTGCAGGGTGTCCTTGGAGGAGGA
CACAGAAGGGAAAAGGGGTGAGGGGAGGAGGTGGCTACCTTATCCTTAGGTGCCTGTGAG
ATGGAGCAGGTAGGGGGTGGTGACAGGTTGAGGCCTTTGGACAGGTGTGATGCATCAGCC
CTGGACTCCTCATGGTGGGAGTGGGTTCCGGGAAAAGCCATAGCAGGCCTGGCCTGTGAA
GAGATGACAGTAAGTTCTGGCCATATCAGTCACTTGGCTGCTGGGTTGTCCTGCAGTGCC
CTGTGTCTTTGGAAGCAGTCACGTTTTGGGCTCCATTGCCATTCAGTGCCATGTCTGTGT
TACTGGGGAGAATGCGTGTCTGGCAGGGCAGGGCCCCTCATATGGGCATACAGGGTGACC
AGGCGGGAACCGGAGCAAAACAGCCCTTGAGGATGATGTGGAAGGATGAGCGGGTTTACA
GAGACTCGAGGGATGGTAGGGAGGGGCCTTCGTGCCCTTCCCTTTTTTTTTTTTTTAATA
AATATTTTATTTGTTTGAGAGAAAGAGAGCACAAGCAGTGGAGGGGGCAGAGGGGCAGAG
GGAGGGAGAAGTGGAGTCCCCGCTGAGCCTGATGTGGTGCTTAATTCCAGGACCCTGGGA
TCATGACCTGAGCTGCAGGCAGACGCTTAATAGCCTAAGCCACCCAGGTGCCTCTTTTAT
GCTGCTTGGGCCGCTTGGATGTCCTCTAATGAACCCCACCGCTCCTGCCTGTCTGCCCTG
GCCCTTGACTTCCATTTCAATTTGAATTTCTCCCCAGGGGTCTTCGGACACCCTGTGCTG
CTTTCAGAGCCTCGTCAGGTCACTAGGTTGTTTCCGCATTGTAGGTGGGAGTTCTGGACC
CGATACATACCATAGACCCTTGATGTAGCAGGTGGGTAGTGGCAGGAGGAGGCAGTGGCA
CTTCTGAGCTCTCTACAGCTCAAGGGCTCTCCAGATATCTACATGGAGATGGTGTGACTT
CCCGGTTAGATGGTCTGTGTGCTCGGGGCTGGGCAGGGGCACACCTGTGGGTGCGGCATT
GGGGGTGCTCTTGTTCTTCACACAGTCTGTCTCCCCTTTCCTCCTTGGGGCTGTGCAAAG
CCTGAGGACACTGGGGTGGCTGTGCTTATTCCAGGTCACAGCTTTGATTTCCATGATGTA
TGAGCATGTCGCAAGGCCCACAGTGTCCACTTCTGGGGGCCTCACCCCCCAAGGTCCCTG
GACAACGTCAGAGTGGTTGCCCTGGTCCAATCCTAACCCCTCACCACCCTGCGTACAGTT
TTTGTCCCCCATCTCCCATTGGGCCAGATGGTGCGACTGAGCGTGGACACAGTCACAGGA
TGGGTGCTCCACAGGAAGGGCTAAGTGTGAGTGGCTCTGCTGGCATTAGAGCCTTGTTCT
AATGGAATTAGAGACCCTTGCTGAGGTGTTACTGTGTCAGGGAGCAGGCCACCCCGTTTC
CAGATCAGGAGAGTCCTGGTTCTAAGTGAATATGAGGTGTTTGCAAAGAAACTTGTTTGA
ATAAGATCCATATCCCATGGGACTTTGTTTAAGCCTGGTTGGTGGACCCCAAAGCAGGAC
CTTGCATTGGCAACCAGGGCCTTTTGTGGTGGGGTGACCTTGAGGCAGTTGACAGGATCC
TCACACGGCTCCTCTTCTCCAGTCACACCGATGATGGAACTGAAGCCGAACGCGGGCAGC
GACCGTGCCTGGGTCTGGAACACCCACGCTGACTTTGCCGACGAGTGCCCCAAGCCAGAG
CTGCTGGCCATCCGCTTCCTAAATGCTGAGAGTAAGCAGAAGGGCACCAGGCCCCGGGGA
CTATCTGACTGCGGCTGCCTGTCTGTCCGCATAGCTTTGTGGGGAGAACTGATAGCACCT
GGGAGGTGTGTGGTAAGGACTGGTCCCACCTTGCTGTCTTGTGCTGCCTCGGAGGAGGGA
CATAAGCCCTGCAGTTGAGCCGTGCGTTGTCAAGGCCTCACCCAGGCTCTGAGGCCACGA
GCAGGGTCTTTTCCCTTTTAACCTCAGGGGGCTGGGCATCCAGTCTACCTGGGGCAGGCG
TCCCCTTCCCAGAGTCTGCTGGCAGCATGGGTCCAGGCTGACCTCTCCTCGGCTTAGCCG
TCTTTCCAGCCCTGGATCATCAGAGGTGCACAGTGGGCCTTGTCTAGCAGCTACTCTGTC
ATGAGTGGAGAGTTGAGTGTTGGGCAGAGCCCTGCCCCATGGTTGTGCACGGCCATCAGA
ACCGTGTGTTGCTCTGCCCAAATTGTCATGGAGTCAGATGGAGGGAGACAACCCAATATA
GCCACCAGTCTCAGGAGGGACTGGAGAATAGTTAACTGCTTGGTCCGGGTAAGAGTGAGC
CCAGGGCTATGTCCTTAAATCAGAATTGGCTATGGGATGAGCCGTATGTGACTTTTGATG
CTTCGTACCCCCCAGGACCTGTTCACTGTTTAGGGATCTTAGGAAGTCTCGCCTCTTCTT
TCTGCAGATGCACAGAAATTCAAAACAAAGTTTGAAGAATGCAGGAAAGAGATAGAAGAG
AGAGAAAAGAAAGGTGACATGGTGTCGTGGGTAGGGGACTTCCTTGCAGACTCACTCTGC
ATCCGGCTGCAGCCCCAGGCGGGTGCTTTTTCCGTCTGCCACAGAAACATCCCGGGGTGC
TGTGACCACCTCGTCCTGTCAAGGGTGATACAGCCGTCTGGGAACACAGGGTGCCTCTTG
GGGAGTGAGCTGGCCATCAGGGCCCCAAGCATGTGCTCCCCGGCCTGGCCTCACAGCCCC
CAGGCTGGCAGCTGAGTCATGATGTCTGGCTGGCTAGAGCCTGTGGCCAGAGGGGCCTCA
AGAGGTCCTCACAGTCGCCTGGTCACTTGGGGCCCAACGATGGCTGCCGTAGCAGGTGAC
CCGACATAACTGAGCTCCCTGACTGCCATCCCAGGCATGAGCTCTTCCTCGTTAGTGTGA
CCCTGGAGGCTGGCTTGGCTGGCACACTGTGAAGTGACCTGTCCTGCGGCCTCCGCCCGG
GACCACAGGAGGTGGGCGGGCTGGGCTGGGCACTGCTTCTCGGTCTTCTTACTGCGTCCC
CCTATGTCTTAGCAGGGTCGGGCAAAAATGATGATGCCGAGAAGGTGACTGAGAAGCTAG
AAGCTCTCTCGGTGAAGGAGGAGAGCAAGGAGTCAGAAGATACCGAGAGCAAGGCTGGAG
CGGAGGAGGAGCAATAAGCCGCCTCCCCTTGTTTTCTCTTCCTTCCGTTCTTTTCCTCCT
TTTTTCTTTTTTTAAATTTTGCCCTGCCCCTTCTTTTCAGTTTGTTTTTATTCTGTTTTG
TTTTTACAAGGGACTTTATATAAAGAACTGAATTCCAACATTCAGGTTGTTTTTTTCTAA
GTTTTTGCCCTATTGAAGAAGACTTCAGAAAATCCATTCCCCAGTCATGAAAATGTACTG
TGCTCACTTTCTTTTCCATAGTGGAAACACTTATTTATAGTCATCAAAAATAGCGAATAA
ACGACACATTTGAAACCTGCACGGAGGGAAGGACCGTGTGTGCGCCGGCCCGTCCTGGGA
GCAGTGTGGGCGCCCCCTGGCTCTGGGCCGTGGGGGCAGCAGCGCGGGTCCCACCCTCTA
CCACTGGCTCCTCCACCATGGGCTTGGGGGTTGGCCCCTGGGGCCGTGCTGTGTCTGAGG
TGGGGCACGTGTGCTTGTGGCCAGGAATAGGTAGGCATTTTGGTTTTTGCCTCTGGGGGA
GGGAAAGGAAGACTATCAGAGTACCCTGACTGCCCTGGTGGAGGGAAAGGCCGGTCCCAT
AGCACACTTGTCTGGTGCAGTGTGTGAGTGCAGGATTGGCCCACGGCCCTCCTTGGATAC
CCTGCTGCCATCCTCAGAAGAAACTCCTGCCCGCTCACTCGTGGCATGTCCATCTGGGTG
GAATTGTGGCCATCTACAATAGCTTTAAATAAAGGGACGTTTTTAAGAACGCAAATGGGT
TACTGCCATTTGGAGGTTCGTTTTGTAAAACAAATTGTGTCTCAGTGTTGTCCCAAGTGG
GGGAGAAGCGTTTTTGGTGCACCGACAGGCTTCTCAAGGCGCATGGTGACACATGGTAAC
TTGTCCTGGGAGGCCAAAGGAGCAGCGGAATGTGGCCATGCTGCCCTCCAGTGGGAGGAC
GAGCAAGTTATGACCTGGCCCTGGAGTTGGGATACTCCTCTCGTTCGGCTGCTGGCCATT
AACACCTGCCGGGGGTACTTTACAGTGTGGCCAGTTTACTTGCCAGCCCCTACTCTGTCC
GACCTCCCAGTGTGCTGGGACCTGGGTCTGGTTCCATCCCTTGGGATGTTGTTCCCTCTG
GGGGATGTACTTCCAAAGGAAGCGGCTCTTTTTTAAAAAAGCCACACTGAAGAGTTCACT
GGCCAGCATTGTGTCATGGCAGCCTTAGTCCTCTAGAGGCACAGGTCTGGGTCCTCTCGA
AGTCCCAATGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 2394..2530, 4428..4585, 6802..6930, 7627..7692, 8232..8263, 8601..8612
1111..1125, 2394..2530, 4428..4585, 6802..6930, 7627..7692, 8232..8263, 8601..8612
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved