Canis_familiaris Locus ENSCAFG00000024929
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000024929
Canis_familiaris
ENSCAFG00000024929
26
SNORA49
2360..2490
16018
GGGTTTATTTTGCCCTGCCTTGTCTTGATCACTGTGGCTGTGCAGCAGGACAGTGTTGG
GCAGTGTTCTTCCTCCAGCTGTGTTCTCGTTCAGTGCTCTGTGAGCATTTCTGGTCTGTG
GCTTTTCCACATCAGCCTTAGGTTTGGTATGTTGCTAATCTACAGAATAACTGGCTAAGA
TTGGGATTCGGATTGCGCCAAATCTTTAGTTAGATTGGGAACAGACACATTGACCATGTG
GACTCTTGGGATCAGTGAATGTGGAGTTGTTCTCCATTTATTCAGTGCTTTAATTTTGTA
CACCAGAGTTTACATGCAGTTGGTAGCAAGTCAGGGAAACCCAGCTTGAGCTGACCTCTG
GAGTGAGGTTCTTCTGGTGTGGGTGGCGTCCAGAGGTCTGGAGGTGGTGTCACATGGCTA
TAATGGCCCATCTGAGTGGTCATTGTGTTCCTCTCAGCTGGGCCTCTTCCTGCTAAGTCT
GGCTTCCCTCCTGGTGGCATGGTTGGCTATACCAGTTCTGGGGTTCACACATTCTCCCCC
CAGACCATCATGGTGACAAAGCACCTGCACCCTCAGATTCCCATCAGAACATATGCACTT
CATAGGGAATGGGCATCTGTGCCCTTTCCTGCACTCTGGACGGGGCGGGGAGGGTGCCCC
GTGCTGGTTGTTTCCATCCGGGTGGCCCTCAGTAGCCAGCATTGGTGAGACCCACTCCCA
TAGTTGCTGTGACCGATGGTGTGGGCCAGCAGCCACATCGCCCATGTGGTAATTGTAATT
AGGCATCCTGGCTCCTCTGGCAACTCTGCCTTTGGAAGGTTCTGCCTACTTCCTTCTTAA
GCCTTTGCTTCCTGGGATAGAGGTGCTGCTGGTGGAGATGCCGTGGGCAGTGCGTGTGAC
ATAGGTGCTTTCTTCTCAGGGTGGTATGTGTGATCCCTCCGGTGGTGGCTGCACCCCCTT
CCTTGTGGGTGGCGAGGCCGCCATCCCTCTATAGCCACAGGATGAGGATCTTGAGGCACT
GCCTGAAAGAGCACATAGCTCCCTACGCACAGCAGTTGCAGCGGATGACGGCCCTACGCT
CCCTACGATTTCCTGAGCTCAGATTGGTCCAGTTTGACTCAGGTACGACAGGGACCCCCA
TCTGCACTGGCCTTGAGATTGCCTCTCCTTGCTCAGGTTACAAGACACTTGATGTTGTTC
ATTCCATAGGAAAGCTCGAAGCTTTAGCCATCTTACTTCAGAAGTTGAAATCCGAAGGAC
GTCGAGTGCTGATCTTGTCACAGATGGTTCTCATGCTGGATATTTTAGAAATGTTCTTGA
ACTTCCATTATCTCACATACATCAGGATCGATGAAAATGCCAACAGTGAGCAACGGCAGG
TAAGGAAGAGGTTTCCTTTGTTACAGTTGATGTTCAGTGTTGTTCATGTGAGTCACCTCT
TTCTGCCCTGGTTTCTCAGAACTGTGTAAGTGCAGGGCTGTGGCGGTCCTTCCAGACAAG
GGGAGGAGCTACTCCACGTCCCCGGGCTCTAACAGGTCTTCGGTTTGTGTGTCCTGTTAC
TGGGGCGTGCGCAGCTGGCTGCTGTCTCCACATTGAGCTTGGTGGCCTGCGGCCATGAGG
AACAGGTCGGTGTGCTTCAGATGCAGCCAGGGCGGGTGGGGGGATAGGGGGGAGAGTGAG
CACAGTCCACGTGAGGCGCCTTGCAAGAAACATAAGTTCACACAGCATGCCCCTTTGTCA
TTTGTCAGATTGGCTAATGGTGTATTGCTTTGGTCAGCACAGCAAGACAGGTGTTCTCAC
ACATTGCTAGCAGGTGTGAAGCTGCACAGCTTTCTAGGAGATGGGTTGATAAGTGTGGGT
CATGGATGTGCACAGGCTTGAGTGACTGTGCATGGAGGGCTCAGCATGTCTGCAGCACCT
CTGCTCCTCCCTGGAACAGCACATGCGTCCAGCAGCAGAATATGTCCATAGGTTATGCGT
GTACCATGCTGCTTGGTGGCACTGTCCCAAGTGTCTGTGGGCTGAACTACGAGGTGGTCA
TCAGAGCATTTGGGACAGGATTAGGAACACAGCAGAACGCTCCCATGCCGGAAGCAGGCT
GCCAGAGTGTAGACCGTGTCAGCCTCTTGGTGTGATCCCACACACGTGTGACTTTTCACC
CGAGTACATACGCACGGAGAAGGGCCTGGAAAGAGATGCAGCACAGGGCTAACAAAATTT
TCTGGGTAGTGATGTAATAGGTTGCGTGTGGACTCTCTGGGAAGAAAAGGGGCAGTGTCA
CAGTCTGGTTTGGTGCTGAAATTATTGCAGAGGGCAGTGTTCACAGGAGGCTGAGAGCCT
CTCTCCAGCCTGTTTCCCTGCTCCCTCAGCCTTACTCCCGGGCCTTTTGCTGTGAAGTGC
CCCGGCATTGCCTGAGGGTACAGGACCGAGCACACGTCCCTCCCCAGGAAGACTCTGTGT
TCTCGTGGGGCCTACGAGTTGAGCTGACAGTCCATGTCAGGTGGAGTCTGACATTTTCCT
TTTGTCTCTGTGGCCTGCAATGTGCAGAGCGTGTGGGGATGTCTGTGATCAGTAAGCGAG
TGATGGTACGGATGCGTGCATAAAAGCCAGGACAGCTGGACGTTTGTTCGTAACTGGGAG
CTGTCCCAGGGTTTACCAGAGGAGCTAACCCGAGGGATTTCCTTCATCTCAGGAACTGAT
GAGGAGTTTCAACAGAGACAGGAGGATTTTCTGCGCCATTCTGTCAACCCATAGCCGTGC
CACAGGCGTGAGCCTGGTGGAGGCTGATGCCGTGGTGTTCTATGACAATGACCTGAACCC
CGTGATGGATGCCAAGGCCCAGGAGTGGTGCGAACGGATTGGGAGGCGCAAGGATGTCCA
CATATACAGGTGAGAGTGGTGGGTGTGACAGTGAGTCCACGGAGGCACCACATGAAACTC
AATATACGCTGCAATTTGTTCCAGAAGTTCCTGCTGTGTCGTTTGTTTTTTCTGAGGCAG
ACTTCTGTTCTTGCTTCTGGCCCAACATTTGCTTGGTTTATAATTAGTTTGCTTGAAATT
GTGATCAAGTTATGTTGCTTAGACATAACTTGCTGTGCATCTGACGCATATCTCTTGTGC
CTCTTTTAGAGGACCTGCCCCTTCAAAAGGGCAGTTTATGTTTCAGAGTGTCTCAGTTAC
TATCAGATAGAAGTTGTCTGTTAGTAAGATGATGACTGAAAGAACTCAAATCTGTGTGCA
CTGCCTTCAGATACAAACTAGCTGGCCCTGTACGTAGCTGAGAAAGTGGAGGAGGCTCTC
CTGTGTATTTCTGAGCTTCCAGAAGTATTGACTATAGTAGTGTAATAACCGTGGGTTTCT
GGTGTGTGCTAGCACTTGATGGTCCCTGTTTGGTACCCGACCACCTGTGTGCTGGTGTGT
GTGCAGTGCTGGCAGCTGGGAGAGCCTGTGTATGTGACCATTCACTCCTTCCACTGAGGC
GGAGTCCTCCAAAGGCCGACTTTAAGTAGCTGTATTACTGCCTTTCTGAGGTTCACGGAG
CAGGTAATACGTTTATAGAGAAGTATCCCTCAGAGATAGCAATTGGTAATATTTTGCTGT
ATATCTTTCCAGGCGTCTTTCTAATTTTTTAGACGGCTCATGCTGAAAGTCTTATTTGTT
AATCCCTTTTTCTTTCAATGGTATGTGGAGAGTGTGTCTTGTTACCAGTAGCTGTAAGTC
TAGTGTGCCATGTAAGTTGTATGAGCAACGTTTTCCTCAGTGATCCTTTCAGCAGTTGTG
AGCCAGAAATGGGAAAACTATTTTATTCTCAGCAACTATGATCCACAAACACTCAGGAAC
AGTCTTGGCAGTAAAGGTACAGGATGTGTAGGAAACGAGGATAAAATTGTGCAAAACATA
GTGAGACCTGAGTAGGAGGCTGTGCTGTGTTCTCGGGACGGGAAGACCTGGTACGTAGAA
ATGTGCTTTCCCCCAAAGCGATGTTAATATGTAGAATGGTTTTAACGAAAGCCATAATTG
TGGGTATTTGTGTAGGTGTACCTGTGTACACTTGTGATTGGAAAAAGTGGTTTTTACTCT
TTTTTTTTTTTTTAAGATTTTATTTATTTGAGAGAGTGAGCGTACACACAAGCATGAGTG
GAGGAAGAGAGAGAAGCAGGCTCTCTGCTGAACAGGGACCCGATGTGGGGCTCTGACGTG
AGGCTTGCTCCCAGGACCCTGGGATCATGACCTGAGCTGAAGGCAGATGCTCAACTGATA
GCCATCCAGGCGCTCCTGGATAAAGTGGTTTTTAAAAGTGTATTTGGAGTGAAGGGTAGC
TGATAATGGCCGACAGAAATACTGACAAGAGTTGCAGCAGAGAGGCTCGGGGGAAGGCAT
GTGAGGATCTGCCATCAGAGGGAGAGCAGTGACCAGTTGGGTGGGCTTCCAGCTTCATTG
GAGTGCAGGTAATTTAGCGTGTGGTGCCAGCACAGCAGACCATGAGGAAGAGCTAAGGTC
AGAGTGCTGTGCCCTCGTTATGGCCAGAATGCCGGCCCTAGGTTAAGCATGCAGGTATAG
AAACAAATCAGCGGTCTTGGTGTAGTTTTGAAGAGATGATACCTGTGGCTTGAAGGCATC
ACTTTAGCCAGGCAGAAAGCTTGGAGGGAAGGCAAGGCAGACATATCTGACTGCAATAAA
ATGAAAATTTAAGTTTTGGTTTGCAAAAAGAAACCAAAAGCAAAGCTGATGCACAAATAA
TAGATTGGGAAGATTATTTGCAGTTCTCACAACGAACAGAGGGTCAGATAGCTCTTACAA
GTTGAGGAGAAAGATAGATGAGCCCTTCTTTGAGAAAGGTGGAAGGAAGCTGAGAATCTG
AATAGGCCATCCCACCTGCTCACACTTGTGGTACACCCAGGCTTGGTAGGTAAAGGGTAG
GAGGCTGCATGTGTAGTGGCCTTGCTTAGATACTGGGACACGGGACAGCGGCAGCCACAG
CTGCTGGTGGTGCCAGTGGTGTTGGCCAAGGGAGCTCCTACCCCTAACTGGGGATGTGAG
TGTGGCATTATTTTGACATCAATTTAGTGGAGTCTGCTGAACTGAAAACTATGCCTGTCC
TTTGTCCCCAGCACTACCCTCTGTGGGGCCCAGCCCATGGTATCCCTGGTTCCTGTAGCT
TGTTTACAAGGCACAAAGCAGGAACCAGAGAGTTCCCATGCTTGGGGTGAGGTATTGCCA
TACCTTGGGCATCGAGCAGCCACTGAAACCATTTGGGGGAGTAGGAGTCTCTGCAGCACA
CCACTCAGTAAGAAAGCAAAATGCAGGTGCAGCCCCGGTGGTGCAGCGGTTTAGCGCTGC
CTGCAGCCCGGGGTGTGATCCTGGAGACCCAGGATCGAGTCCCACATCGGGCTTCCTTCA
TGGAGCCTCCTTCTCCCTCTGCCTCTCTCTTCGCTCTCTCTGAATGAATAAATAAATAAA
TCTTAAAAAAAAAAAAAAAAAAAAAAGAAAGCAAAATGCAGATAAGTGTGTGGTGAAGCA
GATGCTGTCCACCATTATGTTTAAGCGTGACCATTTGAAAATGAGGGGTATGTTGTGTGT
GCGTTGCAGGCTGTCAGCACTGGGGACAGCAGCTGCTCCACATAGGGAGTCCTCCTGGAG
GACCCAGTAGGACATTTATAGGTGGGGACCAGTGGAGGGAAAGATGGCAGAATCGATCAT
GGCCACAGAGGCATGGGACAGGGTGCAGTAAGGGAAGGTGGCGGTGGCTAGAGCTAGAGT
GGGAGAGGTGGCCCTGACCGCCATGGAGGGGAGTGCCCCATGTATACATAGCCTCGTGGC
TCCTGCCCAAGGGTCCAGGGTGCTGTGCCACCAGGCCCTTGCCCCCTGACTGCTCATGGC
ATCGTGCCCCCCAGGTGACCTAGCTGTCATTGTACATGACATGTCTGTTTTGTAGGCTTG
TGAGTGGTAACTCCATTGAAGAGAAGCTGTTGAAAAATGGAACCAAAGACTTGATCCGGG
AAGTAGCTGCTCAGGGCAATGACTACTCCATGGCGTTCCTGACACAGGTACTTGTCAATG
GTGTGCAGTCCTCAAGGTTGCTGTGTGGTGATGGGGATGGGGGTGGGTAAAGGGGCCACG
CAGTTTAATGCACGCAGATGAGGAGTGGCTTGGTGGTTTCCCTGGTGTTGCAGTTTGATG
GTCAGGTCAGCACTGACCTGTTTCTGGCTAGACACTGATGTGCATTTTGTGTGCAGCGGA
CCATCCAGGAGCTGTTTGAGGTGTGCTCTCCAACAGATGACGCCGGCTTTCCAGTGAAGG
CAGAGGAATTTGTGGTCCTTTCTCAAGAGCCTTCTGCCACAGAAATCATTGCACCCAAAA
TTGCAAGACCTTTCATTGAGGTGAGGACAGATTGCTGGCCCTGGAGGTCATAGAGGATTT
GCCACACCTGCTATAGGTCCTGAGCTCCCTGCTTGCTGTGCAGGCCCCTATTGCTCCACC
CTGGCACACCCCTCCTGCCTGCTTTCATTCTGTTACGGGCATTCTCGTCTGGACAAGCAG
GTAAAGGAGCAGTGGAAAGTCCGGGGGCCCCAGGCACCTGCTGCCCAGTTCAGCAGTCAT
CCCTGTCTTCATTGGTTCTTCCTGAGCCCCACTGCCTCCCCTGAGCCATAGCTGGCAACT
AGCGGTTTGGAGTGCCTCGTCTGTCCTATGACCTACTTTGCCCACCCTGCCCTACCCTGC
CCGTCCCCATGGTTCACCGTCTCAGCTCCTGTCAGAGAGGAGCCCTGTGGGCAGCCCCGA
TGGTGCAGCGGTTTAGCGCCGCCTGCAGCCCAGGGCGTGATCCTGGAGACCCTGGATCAA
GTCCCACGTCAGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCT
CTCTCTCTGTGTCTCTCATGAATAAATAAATAAAATCTTTAAAAAAAAAAAAAAAAGAGA
GGAGCCCTGTGTGTGAGTGTAAAATGCACGCCCAATTCTGAGAACAGTACAAAGGAGAAC
ATAAATGATCTTGTTAATATTTTATGTTGGTTACTTGTTGAAATAATGATTGGATATATT
GGGTTAAATAAAATACTGCCTTTTATACTTTATAACACGTGAGAGATGTTGGAGTACTCA
CATGGCTTGTGTGCTGCTCCTTTTGGGTAGTGCTGCTGTGTAGACACACTGTAGACCCAC
TCTTGGGGAGTGGCCTAGCTGCAGCTCCCCCCAGGACTTCCCCCTTCACTTTGGCCCACC
TCACAGGGTTGCCCCCTCCTTCCCCTCCTTCCTGGGTGTCGGTTTCTGGGCTCTTGGCTG
TGGAGGGACCCTCATGTTCTGGGCCTCTTCCCATGCCCTTGCCCATGGTAGAAGGCTTCC
CTGGCTCCCCTGCAGTGCTGCTCACCCCCTTCCCTGTCCTCACACTCTTGTTGAAGAGGA
CTTGCCTGTAGCCTTGGCTGTTTTAAAAGTTCTCATTTGGTGGAACAGTAATAAATGTGT
ATGATAAAACTTTCAAGAATTTATAATGAAGAGCAAGTGTCCCACACCAGACCCTCCTTC
TCTGCTAGGGACCACCCGTTAATGTGGGTCCTCATGCCTCCTTCCAGAAGTTTCCTGTGT
ATGATGTCCCCGGTCCCCCCCCCCCACACACACACACACAGAGATACCTTATGGTTCTTT
CTGCATCTGGAGGGACAGATACATCAGCCCCATTCTTTTAAAGACGTATGCATAATGGGC
AGCCTGGGTGGCTCAGCGGTTTAGCGCTGCCTTCAGTCCAGGGCATGATCCTGGAGACCC
AGGATCGAGTTCCACGTCAGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTACCTGTGTCT
CTGCGTCTCTCTCTCTTTCTCTCTGTGTGTCTCTCTCATGAATAAATAAATAAATAATCT
TTAAAAAAAAGACATATGCGTGAGGTTAAAAAAAAAAAAGCACCTAAAAGAAAGTGGATT
CTCTCTCAGAAACAAATGATTTCACCATTGCAAGTCTTGCATGTGTCCTAGGAGAGAAAT
GAGAGGTGGGAGGGCATTTGCATGAGAAATGCATTGTTCTGTGTGCAGTTGTCTCAGGGA
TGTGTGTACCACACAGAGCAGCACATAGGTGCTGTGAAGTGTAGGCATGTTGTTGGCAGG
AAAGACCTAGCGTCGAATGGAAGATGTATCTCCCCCACCCCCCACCATTAAGCTTCCATC
CCAGTAAGAGGAGGTCTAAAAACCAGCAAGGGAGTAGAACACGGACTCTCCTGCAGAGCG
TGGGCGATGTCCAGTGGGGAGGTGCTATGGGCAGAGGGACAGTACAGGTGGCAGAGGATT
AGGAGGGAGTGAGGGGTGAGGGTAGTGGGGCCTGGCCACATTTTAAAAAATAGCCCTCTT
GGGCAGCCCCGGTGGCGCAGCGGTTTAACACCGCCTGCAGCTCAGGGCGTGATCCTGGAG
ACCCGGGATCGAGTCCTGCGTCGGGCTCTCTGCATGGGGCCTGCTTCTCCCTCTGCCTGT
GTCTCTGCCTCTCATTTTCTCTCTGTGTCTCTATGAATAAATAAATAAAAAGTCTAAAAA
AAAAAGATAGCCCTCTGGCTCTGTGCTGAGTCTAAATTGTGGGGGCTGGAGCAGAGACCA
GCAGTAGGGGTGCAGTTGCGTGGCAGCAGCATGGCCAGGTGAGAGCAGGAGAGACTGGAG
AGGTCTTTTGAAGGTGAAGTGAATGTGGGAGCCTGAGGGCAGTGCTGGCCAGCAGTGCCC
TGAGGATCGGGTCTCAGGATTACTTCCAGATGCCCAAGTAACCCGGGAGTCTCCAGCAGG
AGCGATGCTCTTCAGAAGACCCGTGCAGGAAGATGGCTTTTTTTTTAAAGTTTTTTGAAG
CATGAGAGCCTCCTGAGAAGTACACGTCCTAGAGAATCAGCATGAGAGGGCACTATAGGA
AACCCCTTCCCCCCCGACCGAAACCGCCTGCCTTCCTTACCACTCCTGCCCCTGAGGGCT
GCTCCTGTGCCTCCTGACCACATGGCTGCCTGTGAGGATCTGGCTTCTGGTTCAGGGTCA
TGGTGCTTCTCATGGCAGTACAACACTATACTCTGTGTGGTGTTGTAATTTCTTTATTGG
GCCACAGTCTGTGTTTTGAGCCATGTGTCTCTGAATATTTTGTGTGTCTCTTGGCAGATG
CATGTGTGTATCTGCTAACCCCCCCCCCCTTTTTTTCTCTCTCTCTGCTAACTTTTAGGC
AGCACACCTTGGGGTGGGACCCCTGCATCATCGTTGAGCGTGTGTGTGATGGGCAGGGCT
GTCAGGCAGTTTTGTGAACTGTTCGAACCAGCATGGTGGTAGATGTGGGCCATGTCTCTG
GTTTAATTTGCCCATTGCTCCACCCATGAATTTGTGCACCTCCACGTGTTCCCTGGCAGA
GTAGGTACTTTCTTGTGAAGTGTTTGCTCATGTCTTTCCCCCCTTTTTTGGTTACCTGGG
CTGTTTATTTTTCTCAGTTGTTGGCATTCCTTCTGTGTTCTGGGTGCATGGTGTAGAAAA
CCTCCCTGCATTTTGCAGTCTGCCAGTGAGCAGGAACTCTGGGTCCTGAATCCCCCCAGC
AGCCCATCTTTATCACAGTTGCTGCTAATGTTCTGCTCAAAAGACATTCTCCTGACTCTG
GGTGGTCAGGACATCCTCCTTCGTTTTCTTCTGGGTGCTTCAGTGTTTAACTTTGTCCTG
AGACATGCGGTCAGTGTGGAAGAATTTATAGTGTATAGTGTGAGGTCAGGTTACATCTTA
AGCTGCAGGTTTTGCCAAATCGCCAAGAAAGAGAGGTTGCACAGCTCCTAACTGATACCT
GGTAACCAGAAACCATTAGTTCGCCTGATGTGTGAAGGTGCACCCCTGCAGTACACGTGC
CTATCAGGCAGGAGCTCCTGGCTGTTGGGAAGGCGCCTCCTTCCTTTCTCTGGTGTTTCC
TGATCTGTTGTCCACAGGTTTGGTTCTGGCTCCTAGGGCTCTGGGTCGTTTGTCTTCTGT
GAATGCTGTGGACTGTGGCCCCTGTCTCATGCACTATGAAGAGTTGTTCTCCTCTGTCAG
AGCCGTGGCCGTGGGGCATGTTGGGTGTAAGGTTGAATGGGATGTCCTGTCCCTTTCTAT
TCTTGGGGTCAGGTGACACGTGACTTTTGCCTGGAGTTTGGTGTCCAGTGAGGCTGGGAG
CCACTCCCACGCCTTCTCTGTCACCCTTAGGGCTTTGTTCTTCATATCCAAGTGGGTCTC
AGATGCGCGAGAGCATGTCCACGGGGAGGCTCTATGTGCAGTGAATGGAGGCGTCTCCCT
GGCTTTATGTGGGGTGACTCCTTTTCAAAACCCCATAATTTAAAACTATGAAAGTAACAT
AAATCTGTTATTTCTTTAGGCCCTCAAGAGCATTGAGTATCTGGAAGAAGATGCCCAGAA
ACCTGAGGAGGAAGCTGTGCCAGGGTCACCCGGCACCAACAGCCCGAGGTGGAGTGAAGA
GCCATCTCAGCTGGAGGAGTTAGCTGACTTCATGGAACAGGTTTGAGAGCTTTCTCTTCT
GCGCTTCAGCTTAATTTTTTTCCAGATACCTCGGTATTTTAAATTTGACTCTTCCATGAA
ATTTTCCTTGGTCTCTTTGAGTAAAAATAATCATTCTTTTGATTCAAGTGTTGGGGGGTT
ATATGGGGACTTAACCTTTGTTAATTTGCTGTTAACCCTGTTCAAAACAATGATTTTTGG
AACAGCTTACACCTATTGAGAAATATGCTCTGAATTACCTGGAATTATTCCACACGCCAA
CTGGCCCAGAGAAAGAGGGCAGCAGCGAGGTAAGGGTAGACTTCTGGTTTGCGTAGCACG
TGAGGGCCTCAGCCTTCAGATTCACATTTGGCCTGAAGTAAATGTGACTTGTGTGGAATT
AAAGGAATAAAAAGCAACCCACCAGTGTAGAAACAAATTAAAAATGAAGTCTAGAGAAAC
CCTAGGGAACGATTCTCATTCAATTGGGCACAGCTTGGTGCTTGATGGAGGGATATGTGT
TGGAGGAGGGAAGGGGTCCAGAGCCCGTAGCTTGGACAGGGTGGAGCTGGGGTGTGGGGT
GCTGGGCCTGCTGTAGCCATATCTCAGAGCCCCTCTCTGTGGTCTTCCCACCAGGATGCC
GTGTTGACCGCTGTGAGGGAGTGGGAGGCCCAGAACGTGAGGGCCCTGCAAGAGCGGGAG
GCACGGGCGCTGCAGGAGCAAGAGCAGGAGCAGCTTCTCACCTATACGAGGGAGGATGCC
TACAATGTGGTATGCGGGGCTCAGGATCCAATGCGTTTCTGAGAGATGAAGCCCATCTCC
ATGTCTGGCAGCCCGTTGTCTGATGCTTGACCCTTGGTTGGACGTTTCTGGTTACACATA
GGCTTTTCCCCAAATGTGGTTGTTAAAACGTGTCATAGGTGCTTTGAAGACCTACTAAGC
ATGCAGGTAAATAGTTGGTGGCTTGTAGTGTTCGTCTGAGATTGTGACACTGAAACGTGG
CCCCTTCCCTGCAGGAATACGTCTGTGAAGGCGCCGATGGGCAAGTAGAAGTCATGCCAG
TGAGTGCCCGTCTCCCTGTGTGTTGGGGTGGCTGCATTCCCCCATTCATACAACTCATGG
CTCTCCTTTGTCCCCACAGCTCTGGACGCCGCCCACACCCCCCCAGGATGACAACGACAT
CTATGTGGACCCGGTCCTGTGTCTCACGTATGAGAGCACTCCCATCCCAGAGTCCAAGCT
GCCTCCCGTGTACGTGAGGAAGGAACGCAGGCGGCACCGCACGGACCCCTCAGGTGCACA
CCCCATCGCCAGGCTTCCATGTCTGCTTGCTTTGCACTTGCGGGCTGTTAAGGAACCTTT
ACACTTACAGTCCTGCTTGGTGTACAAGCAAGAGAGTGGGTTTATCTCTACAGAGGCTCC
TTAGCGACAGGCGTCTTCCGTCGTCCTTCTTGTTCCCGTTTCCTCTGTGAAGGCACTGTC
TTCTCGTTAGCTACATCACTGAGAAAGGCTCTCTGTCCAGTTGCAGGCAGGAAGAAGAAG
CAGCGCCACGGGGAGCCAGTTGTCCCTCCTCGCTCACTGTTTGACCGTGCGACACCTGGC
ATGTTGAAAATGCGACGGGAAGGGAAAGAGCAGAAGAAGAACATTCTGTTGAAGCAACAA
ACACAGTTTGCCAAGCCTTTGCCAACTTTTGCCAAGCCAACAGCTGAGTCGGGCCCAGAT
AATCCCGAGTGGCTCATCAGCGAGGACTGGGCACTGCTGCAGGTGAGCACAGCCCGCAGT
CCACGTCCCGTCCTCTCCTGTCCATGTCCTTTGGCTGTAGTCCTTGGGAGCGCGCGTGCA
CCTGCTGATGCAGTTCTCTGACCTATGGTGCCTGAAACCTGGTCCTGCAGGCTGTGAAGC
AGCTCCTGGAACTGCCCCTGAATCTCACGATTGTGTCCCCGGCCCACACGCCCAACTGGG
ACCTTGTCAGTGACGTCGTCAACTCCTGCAGCCGCATCTACCGCTCTTCCAAGCAGTGCC
GGAGCCGCTACGAGAACGTGCTCATTCCGAGGGAAGAGGGGAAGGTGAGGGCAGACCCCC
TTCCACTCGCACATCAGCGGAACTCCAGCCCCTAGGCTGAGTGAAAGCTGGCGAGGCAGG
AGGCCCGTGTGGCACCTGGCATGCCTGGAAAATTCTGTGTGCCATGTGGAGGCTCCATGC
CACCCAAGGGCTCGGTCCTACCTTCATTTCTTTCCTCTTTCTTTTCTCTTTTGAGAAGGC
ATGAGGTGAATGAAAGAGCCTTTGTTTGGCTCCATTGGCTTATTTGAAGATAAGTTTGTT
TATGCCTCCTATGCCTTTGCTGCTGGTCTCCCGCCAGGAGCCCCAGCCATGGGACTGGTC
TGGACCCTGGTCCCGGCTGACTGTGTGCCTTGTACATGCTCTGCAGACAGAGGCTGGGTA
CTCCGTGTCTTTCCCAGGAAGCCCATGGTGGCAGTGGCTGCCCCCACCCCCACCCCCCAA
GAGAGCCAGCACTGCTGGCGAGTGCATCTGCCCTGCACTTTCCACCTTTCCACCTGCATA
CCTCTTGTTGTTTTGAGCCAAGAGGGTCTCTTTCTGTTTCTCCGTCTGCTGGCTTTGCCA
CTTCCCCTTCTTGTCAATCGCCCATCCACCTGCACTCTGGAGAGTGTCCAAAGTCTGAGC
ACAGAAGGGGCGCCCATGTGGCATGCTGCCAGCCTTGACAAGGGTCCCGTGCCTGCGAGT
CGTGGTCCTACCCACTACGTGTGACAGCACGGGGCAGATGCGGCAGAGGCACACATGGGA
CCCTGACGCAGTATGGAAACCATTGTTTCTACCATCGTTTCTGTTTTCATTTTCCTGAAA
ACATTTGCCTTAAAGCCTTTGTTTGCTTTTTGTTTAAGAACAAAAAAAGCAGGTATTCCT
TAACAATACTATGTGTGGTACCTTCACCACCAAGACATCATGAGGTCTTATGTTTGATCT
GTCTTGTGTTGGAAGCACTTCTAATGACGGCCATAATGTTAACATGGAAAAGCATAAAGC
TGAAGCTCTGTTTTTCTGTTTTATAGCTCACATGAGAAGTTGATCTAGAAAAAAAGGCAA
AAATGCGTTTATTGGATGTGACGGTGACATTGTGAATAAATTGGCAAGCACCTGTGCAGA
GGGCCATTTGATGAAGTTCAGAACCAGCCAGGAGGGGAAGCTGGTGCCCGCAGACATGTG
CTGGCAGCAGTGTGTTGGGTGGGGCAGGGCAGGAGCCCCCTTACAGCCTGCCACAACCTG
GGCTTGCTGTTGGGTGTTCGTGTTACGTACCTGATCTTATTCTTGCTCTACCTTTTCTCC
CTTGTTTTTCTGTGGCACGGGAATGCTCACAGACGTGGACTCATTTTCAGGACCCTCCCA
TGCTGATCTTGTGGTCCTGAGTTTCCTCTGGTGTGGCTCTTCTAGATGTAAAGCTTCAAT
TAGCACAGAGGACACGTATGCATGGCTCTCCCGTGAGCGGTTCTTACTTTGTGTCGCAGT
CTCCATCCTGTTCACTATGTACAGGTACAGGGTGATCAGAGCCTGTAGACACAGGGGAGG
GTCCCTGGGAGCCCTATGGCCCGGTCCTGACTTGGTTGCTTACAAGTGTGCTGGCTTTAC
ACAAGCTGTGTAACGAGACTGGAGTTTTCGCTCTGGCATCGGGTTGTTCTGAAGTTCTGT
GGGACAATGAGGTGTCTTGGGAGCTAGCAGTGCTTGTTTTGACTGTAGGATTTATGCTGG
AGAGATTACCAGGAATAGGTGATGCTGTGAATGAATGCCCCCAAGAGCAGATTCACATAC
CAGCTGGCACCTCTCCTCTTCCCTGTGCACTGCAACAGAGGCTTGCAGGGAGGGCAGCCA
CTCGGTCTCATTTGCTGTGTGACCTTGGGCACTTGGCCTAGCGGTCATTTTTCTCTGCAA
AGGTAGAGAGCGTCCTCCTGCTCTGGGTGATTGTGGAGCTTGCGTGAGGGGACGTGTGGA
GAGGAATGGCGTTTGCAGGCAGTGGGTGGTCAGGTGGTATGCTCACGTCTATGTTGAAGG
TTGTGAAGGAGGAACTCTGTTTAACCTGGGAGATTCCAAGTCAGGTCTCCAGATCAGCCA
CCATCTATCTGATGCACTGCCATTGGTTTTGTCTCAGAGTAAGAACAACCGACCCCTGCG
CACAGGACAGCTGTACGCCCAGGACGAGAATGCCACGCACACGCAGCTGTACACAAGCCA
CTTTGACCTGATGAAGATGACGGCCGGCAAGAGAAGTCCCCCCATCAAGCCTCTGTATGC
TTCCCGTGTCCTTACCGCCCCTCCCCTGTGATGAGCTGGTGTGGGGACACTGGCTTGCAC
AGCGTGTTGGTGATCCCTCCTTCTTCAGCAGGTGTTTCTTGTTGGGTAACTCTTGTCTCC
TTTTTTGTGTGGCAGGCTTGGCATGAATCCCTTTCAGAAAAACCCCAAGCACGCCTCCGT
GTTGGCAGAAAGGTATTTCTGTATTTTCTACTGGATGAAATAATCTCATTTTAGTGTTTT
ATTAAACCCTGTGGAGTCAGTAAATCATTCAAACGGTGTGTCCAGGCAGCAGCTAGGGAT
AGTGGTGTGGCCAGCTGGGAGCTGGCAAATGTGCACATGGCATTCCCATGATGAGGGTCT
GTCCCTGCCTACAGGCTTCGGGGGACACTGGTGGATGTGACTTGGCCGTGGGAGAGGCTC
TTCCTTTCTTGGCCGTGCTTGCGTCTAATTTGGCACATGTCTTTTGATTCTGCCTTTAAA
ATATATCCAGCATAGAGATGAGAGTAATTGTTTTGAAGCTGAACAAAAGAGAGAAAAGGA
CCGACGAAAGGATGGGCAGGGAAATGTGTGGGTGTGGGTGAGCAGGTATGGCAGGGCAAC
CTAGAAGCCAAGTGCCAGGTATCAGGGTGTTCTCTGCACACTCCCTGTGCTTTCCAGATG
TCTCTTTTACAATGAGGTGGTAGGAAGCACATGTCTAGTTAAAGCCCAGGTGCTAGCTAG
TCTGGCTCAGGCCTTTGTGGTTGCCCAGATGAGTGTCTGCCATACACCAAGGGTTCTCAC
CTTACCTGTTCTCAGTGTGGCCACCAGCTGGGCACTTCTTTGCCAAGACCCCTGACAGAC
TCTCCTAGCTGCTCCTGAGGCCTGGCCTCCATCAGATGCTCCTTACCTCATGGCTGTGAC
CTGCTGCTCACGCCTAGGGCAGTCTTCCTGGACTCGAGCCCAGGACCCCCTTACACGTTA
TCTTCTATACAGTCGCATCGTGGCCCTGTGTTTTCCTTCACAGGATGAACCATCTTCACA
TTCTCTACTTGAGTTGTGGTGTTTGTGTGCCTGTGGATGTAGGGCTTCTGAATCTGGAAG
CAAAGAGCAGGCGTTCTGTGTACATTTGTGGACTAAATTAGCAGATTGTTTCATGCAGCT
GACATTTATGGACAAGGTGTGTGCCTAGCTCTGTGCTGGGCCAAGCCGTTCAGTGGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 1209..1378, 2692..2888, 5935..6046, 6236..6379, 10399..10539, 10745..10828, 11154..11288, 11534..11578, 11659..11812, 12040..12281, 12410..12583, 14677..14813, 14955..15018
1001..1121, 1209..1378, 2692..2888, 5935..6046, 6236..6379, 10399..10539, 10745..10828, 11154..11288, 11534..11578, 11659..11812, 12040..12281, 12410..12583, 14677..14813, 14955..15018
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved