Canis_familiaris Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Canis_familiaris RABGGTB
Canis_familiaris
RABGGTB
6
SNORD45, SNORD45, SNORD45
983..1061, 1860..1941, 3097..3168
10473
gccttggaacttttttttttttctttctttcttttttccgggcacagggagggtgaagt
attactcagcgtttcctgcggacctcgcggcctctaattttatctaggcttcctcctaac
aggcaggcctcaagattcgccggcccgatttcttaacaactcaagaaaaaaaaaaaaaaa
aaaaaaaaaaagaaagaagaaaaaaaaaaagaaaagccttgggcagtcggtgctgctgct
cctttattattttttaataatttttaaaaaaatttttcctatgtgtctgtgggctcagaa
tctacaaagtcctcaccggtactgtctttgaagatgcggtaaattttatcttatttatta
tttttaaattttattattatttttttattcatgagacacacacacagacacacaggcaga
gggagaagcaggccccacgcagggagcccaacgtggaactcgatcccaggaccccagggg
tcacgacctgggtcgaaggcaggtgctcaaccgcggagccacccgggcgtccccatgcag
tacattttaaacgggatccgatggcaatccaccagattctcttttctcggtggtggtcat
gatgcacttgcagggagtgaactgctgcctcgatcacaaggagctaggatgagaagtgag
caggcgaccacagagcagcagcctggtttccggaaggcttgttgcacacgaagaaatgaa
gactaaaagctgggggcgaggaggcccgaggagcatgagcatgaaccgaataggcgagga
tccctagaacggtccccagagaactggactgtaaatcctgggctggccacgatctgattg
tagggttgccactttgtgcggcgtgcaagcttttaggtcgtcctcaactgggaagctcgg
aggtcctttttggtgtttgttgattttactaggactcttaagtgagagagaagcagccgc
agaggagggtgaaaatggtcttgggtcgatgatgagctggcatgtattctgaatctgcag
ttggtgattactccttcagctctagaattactctgagacctgagaaatacccgaatcttt
gcaggagcctcagggctcaggttgcttcgaggcagatgaggtggcggcttttcaaacaga
aagttggcgtgtggcaagatgggatccgagtgaaaaaagttctgatgtatattgggtatg
tgcactggggtcaggcattaaaagagaaaaagttattaagtccctgctttttatttggaa
agggcacaccgcagaaggatgttatcatcaagtcagatgcacctgacacactgctgttag
agaagcatgcggattatatcgcgtcctatggctccaagaaagatgattatgtacgtatga
gttcatgttgaatgtttattttgaagaagtgagtgcacaaacattaagtaggtctgtatg
tgtggcccattttttttttttttttttttttttttaagattttctttatctattcatgag
agaggcagagaagcaggctccatgcggggagcccaacgtgagactcgatcccgggtctcc
aggatcagaccctgggccgaaggcagcactaaaccgctgagctacccaggctgccctaca
gtccatgtgtgtgtggtttttttttttttttaaatgctaactcttgcttgccaaggactg
aagatccttgaagtgcagtgcgtgtagctttggccacctgaggttgagggtttatcagaa
ttagccatggatcttagaggctttgcaagacagaatagattccccatctacccagattct
taaaagaggtttgagctacagaagaggcctgtacttttgtagctgaggtattacttgcaa
ggtcagtgatgtgttggcatgtattacctgactaaatggctgatgtgtgataacacaagc
tctagaattacgctgagaccttgaaaaagttttaccctcagttcaaacttcttctctggg
acattcttagaaaaaaagtaatgaagctggaagtcagtatttttccttgtagtgtctaaa
caactgggttaatttaccatgttgggaaacctctggtattgatgaatttgtgacttgttg
aatttccataaccttgatggagttgttaggaccatgtttattttttccctggatgtttag
ttaaagggttaggtcttgacttatccctgccttttttatctagtgctcaccagctgattg
cctaaacccagaatatgggttcacagcaaactattgagactattcacctgattgaaaacc
ggaacatgggactagcaaaaatttatttctggactattctctgtatcagtttttatgcct
gacttctgcataccatggccattttggttttcaagaggttgtatcattactaataggtag
tagatgaggctgtgtccatagtccatgtattagtaggatggatgtctaataatatgtgga
tactctgaaggaaaatactttctcccaaacttgagaaaagttggtatattttttacttct
acttctgattggctcttaggaattaaagtcctatttgtctggtcattgacagatgtgttt
attatctgcatctctgatactactccccattcccccaaatttgagagccacaaatttaaa
ataaatactgatgttaggatcaattgaattaaacagtaagtgtggctagttttatgtatt
ttatcactttgaccctgcatcgattcaaactggcacatagaagtaattgtgtatttcagg
aatactgtatgtctgaatatttgagaatgagtgggatctattggggtctgactgtgatgg
atctgatgggacaactacatcggatgaatagagaagaaattctgaccttcattaagtcat
gtcaacatgagtgtggtggaataagtgctagtattggacatgacccccatcttttgtaca
ctctaagtgctgtccaggtaaatacttcctaagatttagcagtcttgctgtattctttta
cctgagaatggagaaattgaattgggtattagtaacgtgacaaaattaatgtcaaaaagt
ttacctaatcttctcaaacaaagcctgtattctacaaggtcaatgatgtgatggcatgta
ttagctgaatccaaagttgatgtcaattgtaagattacactgagaccttgaatggtaaaa
tgtttattttcagtatatataaataatttgaaaatcaccaagtggagttaaatgttttaa
ttttgataatagtgaatatccagaattgtgtatgtttgtttcttttaagaattttttttt
ttttttaagactttatttattcatgagagacaggcagagacacaagcaggctccatgtag
ggagactgacgggagactccatcccgggtctctaggattaggcccttgggttgaaggcag
cgctaaaccgctgagccacccgggctgccccagaattatggttttaaagtctacttcagt
acgtgtaagttagtaaaaatataaaagttttgcaatgctaagttacaatttatatgtagg
aaataaatgatttatgttactggtttgggttgatactgtggcaaagtagaaagtctgcac
gtttctaaaaagttcatagtatgtatgaacaaagttatgcttgaagattgaaaaggtagt
tgaagaaaatcagaacaaacttagcagtgttgacgtatttacttattttttttattacag
attcttactctgtatgatagtattaatgttattgatgtaaataaagttgtggaatatgtt
cagagtctacagaaagaagatggttcttttgctggagatatatggggtaatgtccatcta
atccatgctacccagaataccaatattagaatctctgttttggtgtttattgtagtgata
aggtttgttggaagtttttaggaggctttgctaataattataaggagatttttaagtttt
tgatcttttcaggtcccactaagcagctggtcttactgaagttaaatggtctgctggaag
ttccagcatgcactgtgctagttatatcagcatacaggagaactggaacagagggggcca
gtctaagagatgaggtaggtgaaattttttcccccaatatttggtggctttgtaaagttt
ttttttttcttttctttttttttttttttacacaaactatttactgacaagggagaagta
ctcaaaaaactttacaaacttactagatatttgagtggagggagggaatagtactatact
tgataaatgtagataatctctgctttagggctgaatacagtgcaggccggagagaccagc
tgcttcatgggatgtgaaaatctacttttatgtaatagggtaagtttattgtcctcttag
aaattgaatagtccttttggttctctgttattttccctttttgatgctctaagcaactta
agataatttgctgtatttttgacaattttctagttcttgattttcttagaagtcatttac
ttgtgatttagctttcctcctggcgatttaaaagtaaatgttaagcttgaactcttggaa
gtttaaccatggtagttgtacagtttgtttttagttaactggcattatgtactaggatca
gatacctctgggagcacttagttttcatttgattcctttttcttttaggagaaatagata
caagattctctttttgtgcggtggcaaccttggctctgttggtaagttttgaatattgta
ttggaataattaaagtacccgtgattattttggaattcaataggcttattttttctgttt
gtaggggaagctagacgctattaatgtggaaaaggcaattgaatttgttttatcgtgtat
gaactttgatggtggatttggttgcaggccaggttctgaatcccatgctgggcaggtaat
ttattaatgcagattaaaatatgtcagttttgaagggataagtagtgtggtaaactggga
aaataacattaaaagcagtttgggtgtcttttatatatgaatgaagttaattaaaattaa
tgtaacatgagatgttatgtaagaattgcttaaatgcagataaaggaaggcatttttaca
gtagcttgttttatatacattacctgttggtggaagcttttggcccaggcaaacctaagt
agatttgttaccattaaagataacatttttgggatgtccaggtgattcagctgttgagca
cctgcctttggctccacataatcccagggtcccggatcgagtcctacattgggctccctg
cgtggagcctgcttctccctctgcctgtgtatctggctctctcttctctctctgtgtttc
tcatgaataaataaaatctttaaaaaagagagatgtttttattttccattagtcactccc
ttgccccgccccccaagttttatttatttaagtaatctgtacatccgacatagggctcaa
actcaacaactctgggatcaagttctgtgctccaactgagccatccagatgttcctattt
tccattaggtttttttttttttttttttttttattttaacaaaattaagtttcctctatt
ggcacttgcttgaagattatcaaaggtctctaccatagaggaccattagtttttaactaa
gtagatggaacattcagttccctacctatcctgaacacttatttgcttatgctagagaga
taaatagtatttgtactattatatattgtatatgtaaaaggtaaaataaaatttgcttta
agagccacctggctggcactgtcagtagagcatgagacccttgatcttgagttgcaaatt
caaggctccatgtagggtgtggagagattactttaaaaaaaaaaaaaaaaactttttttt
aagattttatttatttgacagagcaggagcagggggagcctgacctggggcttgatccca
ggactctaggatcatgacccgagctaaaggcaggcagacatttaccgactgagccaccca
ggtgccccaaaaacctttttaaaaaactttgcttttagccatgaggaaatgttgccagta
gaatttcattgcagatttggatcctagaattagtatgtttggatttgttcagatagttat
gtttgcaattctgacttgttaacagcagatttttagacataaaatggcattttaattgag
tagtttttatcactatgttacaattgaaaaattattatacacatatactttatgtctgta
attttagatctattgttgcacaggatttctggctattactagccagttgcatcaagtaaa
ttctgatttactcggttggtggctttgtgaacgacagttaccatcaggtggactcaatgg
aaggcccgagaaggtattgtttcataagatacactgtgttctaatagctttataattcca
atagcttcttgtaaactgataatgtgcttttgcccctcccctcattgcaatttttcagtt
gtacttcctaaaaaatgtcctgggcaaaagtaaaacaactagagtggagatacttataag
actcttgaagcaaagatgggtttgctaccttctgatagctctttttatgacaaagctttc
ttctaatcttcctgtcctgaagtagcatctggagttatctgaaggaaaaccaaaaaaatg
gcaaacgctcttagctttatttatatttgtattcagacatagtttgaatttttaaagtat
ataaaaatttgccactgtgtgaagaaggcttgggagtctgcagaagtggtggtgcccact
gcctttgcctctgagctcaaaagatttggggtcatggctgctccctttctaccctaagct
ggaggagccctggtgggacagtatatatttcaactgggaactactttctagtctgggcta
ctgagctggacctgctctcaacacagccactcatctagagcccagaacactttggaatca
gatttagacctttctgcataggagccatcatccaccagccagaagtcagtcagtcagcct
ccagagaacagggcactacagaacactggacggctacctgccatggctggctcttagcca
catccatccagctctggacacaccccagagcagagacggagatctatggtggtgggcact
tccagaatgatgctgtcctcccttccccaccctggatacatgctacttttgaaccatgaa
ccatgaccatatggacttaggaaagctgaagatcagcctgggaacttgtttctttgttta
gtccctaataagacaataaatgttgtttttagaggccttaaaaaaaatgaatgaaacgaa
gctgtttctttgaacatttagttctagatctataccaggaagaaatcagtcctgcattaa
aagctttatttacatctgggacaccaaaagtactgttgaatgaacacgtatcttgtacag
aaatctccatgtctcctcatggatgtgagaggacaatttaccaaatcaatgatttttttt
taaattatgtcacaaaatttttatttaaaatgcttaagtttttttagaaaaacccaattt
tgacactttgatttggagaaaaggaaattaaaccttcctatccaagtctgcagttctctt
tagctctcacacattatgttctaaattgggtctgtaaaggccaggtagtaaatgttttca
gctctgtagaacatagaatcttgttggcaagtacgtaactatcctgaagagcagatggtg
ccatagaccataagaaaccagtgagcatacctttgtttcagtaaaattatatgatacatt
tgaatttcttacgattttcctattacaagactgtggtggtgtttttttaagactttgtat
ttttaaaaaaccacttaaacctataaagaaacttggttgtagtctaggtttgactccagg
gctatatcctgctggatccttggccaagaatatgatatggcatggtggtgcttttatctg
ggattgtatttttgttttagctttgcttgcttaatatttaggaataagtcgagtggggaa
atagccacaggtagttttctagctagttaagatccaatgaaaaacctgggcaacttttaa
gttagaaaatggatcaggtttgggattgccaggaatctacacttaggtaggacaactttt
aatgtgcctgtgaatcacccattgattttttttttttttttaagattttatttatttact
caagagacacagagacaggcacaggcagaaggataagcaggccccacgcagggaacccaa
tgaggcgggactcaatcccaggtctaccaggactacaccctgggccaaaggcggtgctaa
accactgagccacccaggctgccctcacccattgattttgttgaaatgattcttgaataa
aaaatgagatactctgcaacttttaaactcaagtgacccatgttttgagcagccgagctt
tagattatttttaagaaagtatatgcctgtctggacagcacttgttgaaaatgctctttt
tagggaaacagaatatatgtcaccatggatttcatgggttttaaccaccagtttgttggt
ttcattgcagatacaatgtatagggagggttgtcactgagtacctaaactatgaaacatt
tagcatagatgtggattgaaatgtttggtcttttttccagtgattatctttaattctgag
taattgtattcatggattttaacatcttgaactgcatgtcagcatatccctaatccccac
cacctcctcatgtttagaatagaaactaaaatggtggcaactgtgttttttttttctcct
agttaccagatgtctgctattcgtggtgggtgttggcttccctaaagataattggaaggc
ttcattggattgatagagagaaactgcgaagtttcattttagcatgtcaagatgaagaaa
caggaggatttgcagaccgaccaggagacatggcaagtataattctgacatgttcatata
atagttatgttggtttaagttacttttctggcatttacagacttagaaatggttgataat
caaagtattgcttaaaaaagcaggatacttttctgttaatttttattggagaatatatga
gggtataaaacaagttcatagaaattgtcaaaaaagagtatggtaaaggttctatattta
aaaaaaaaacaatttaaagccatttttatttcagaaaattttaagcaattatttaagtaa
aaatataatggaacccaatataatttgttcagaagtagggttttagaagtttttgttttt
gtaatactctataaattcttattttttaaataggtagatccttttcatactttatttgga
attgctggattgtcacttttgggagaagaacagattaaacctgttagtcctgttttttgc
atgcctgaagaagtgcttcggagagtcaatgttcagcctgaactagtgagctagacattg
atggagatacaagataatgcttagtatagttttgccatcttaacatttctgtaaagtgct
tctcaaatttaatgactactgtgtcactattttgtatatgaattgtattaattttaataa
attatgtaattatacatactgtaaaataaagatctttatcttcagctttaggtttttttc
ctgcaatgctgttatcctgagtacagtattttgtttctgcttaagtgtatttatttgtat
gtttccttaacagtaaactattgacttaaagtttaagtcctgtgttctacttgattttcc
catgtgcttctttcatgtcatataataatggttactgtaaattgacctgtatcaatgaga
atgtaaaatgataaacctatccatatatgaattaaaagattcaccagaataaatggctgt
tgaaatttgggactgtttcataaaagttaatggttactctgaactgatcactaatttagg
ttaatgattcatttcaccatcttagaataggactgcagtctagactacatttcttgtttt
taaaacgttttatatcagaatgtaccagttaagtaccgagggaattgttagcctttaagg
aaatagaagttgatagttttccacaacattttttgagtcttttttccaaaagactaaaat
gagtataagaattctgagagttttacattcttcggtgaaaataaagtagttcagtgaaca
tttttctggaaatagaagccgaaattttctcaggcgtgttggcaatgactctagtagttt
taaggataatgattagtggggctcctggctggcttagttggtagtcctgccactattggt
cttggggtggttaattcaaaccccacagggagggtagagttcacttggacatcactcacc
aagatcaattttaacattgttgaaagatgcttacgtgagattcttgaaatgtctaccatt
gttttgatagttcactgatttaaagagttagggt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1369, 2759..2956, 3720..3826, 4669..4720, 4804..4914, 6247..6372, 8822..8970, 9332..9473
1001..1369, 2759..2956, 3720..3826, 4669..4720, 4804..4914, 6247..6372, 8822..8970, 9332..9473
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved