Canis_familiaris Locus poly:SNORA64
snOPY snoRNA Orthological Gene Database
Canis_familiaris poly:SNORA64
Canis_familiaris
poly:SNORA64
6
SNORA64, SNORA64
1761..1894, 2403..2531
3895
tttatttcgcggagaaagtcgggagggattttctgagcgagagtcagggtgagggcggc
ttctcacgggcggagttgcccgaggaagtcgcacatctttccccgtcggggtcggtaact
gacgttgagcggcggggctcctcctggaggccgccctgcttccccttcgcacctgcgggt
ggctcggtgccccgcccaagtcccctcaagcgcaaaagtacctgacctgctactgtggaa
gctgtgcggtgtgggacctgggccggccgacccgcgggagcccggctgaaggagctgggg
tggggggcggcaggaggccgcgctccggggcgtctgcgtcctgcggacagaacacggggt
caggagtcagaggttagggatcaagggccagagcacctgcggcccggggcggcggggcgc
ttgtcggggcctgggtttcacctctccacaaggaccagtgggcggtgagctgaggccccc
ggtggctctgggcgccgaatctcacccgcggccacgggcagggccgcaggtgattttcaa
ccaacgcccacccgccgactgccgcagggggacgcggcgaggcgcgggcctacccgcagc
gcgggcctacccgcagcgcgagcagccgggccgcggcggcacgcggcagcaggagcgcag
agccgatgtgcgcaagcgtacggggagccggccggggcgcctgggagcgcgcctccaccg
ctcttataggctcgcgctcggggcggggcacccgagatctcgcggtacttggcgtaggat
aaatactccctccgcgcggactcgttcttcttctccgagagaacacgtgagtctccgtgt
cgccggcggcggcgcgcgggccggggcggcgggaactcgcggcggtcgggtgggggggct
cgcacccgcgccgcggcgccatcgggcgggggtcgtggttcccggcgcccgcgggtggga
gggcctcgctgactggtgggttctcgcgtccctttcagcaaatggcggatgacgccggtg
ctgcgggagggcccggaggccccgggggccccggaatgggaggccgcggcggcttccgcg
gaggcttcggcagcggcatccggggccgcgggcgtggccgtggtcggggccggggccggg
gccgcggagctcgcggaggcaaggcggaggacaaggaggtaggttcaggcttggtggggg
ctgggcggcgccggtcaggggccctactcacccgcgcctctcctccagtggatccccgtc
accaagctgggccgcctggtcaaggacatgaagatcaagtccctggaggagatctatctg
ttttctctgcccatcaaggtagcggcgtgggcagctgcggtctccgcgaggctccttcgg
cctggggcgggatgtgtccacgggggccaaggctccacgggtcgggggagagggagtgtc
caggtgccctacctctgactgtgagtgtccggcttagagaggagagcctgggcaactgga
aaaccagttctacgggtccaggtggaggttcttaaccccgtttacaggggttttgagctt
tttgttaagtggttttgacattgtttcttactccataggaatctgagatcattgactttt
tcttgggggcgtccctcaaggatgaggtcttgaaaatcatgcccgtgcaaaagcagaccc
gtgctggccaacggaccaggttcaaggtatcctagtccccttctggtttcccagcctatt
tctgccaagaggtttgggagaACTCTCTCAGCTCTGCATGGTCATGCTTGCTGTCACACG
CGTGGCTTTCGTAAAGGGGAGAGAGAGAAAGGATCTCCTCCGGACCTCAGAGTGGCCTTA
CTGTGGCCACTCTTTCCTGGAGGGGTGCCACAGGTcctggttggtggctgctgaggccgt
gccagccagtggaccaccagccatctcaggctcttcacaggcattcgttgccatcggaga
ttacaacggacacgtgggtctgggcgtcaagtgctccaaggaggtagccactgccatccg
tggggccatcatcctggccaagctttccattgtccccgtgcgacgaggctactgggggaa
caagatcggcaagccccacactgtcccatgcaaggtaggcttggggtagtgagtgatggg
ctctgcaatggcacaggctccccatagctcatttcctgacatctccacactttgtaggtg
actggtcgctgtggttctgtgctggtgcgtctcatccctgcccccagaggcactggcatt
gtctcggcccctgtgcccaagaagctactgatgatggctggtattgacgactgctatact
tcggccaggggctgcactgccaccctggggaactttggtaggtggtcctcgtggacactg
tggCCTCTCTCAGCTCCGCTTAATCACACTTATTGTGTGCTTGGCGTATTTTCAGAGAGA
TAGAGGAAGGCTCTCCTAATGCACGGCAGACTGGCCCCAACTGGCCTCTCTGTTCCTAGG
AGCGCAACAGCTtttgtctgcatctggggtgttccaccaatccgccaaccctcttctgtt
ttctcttccagccaaggctacttttgatgcgatctctaagacctacagctatctcacccc
tgatctctggaaagagactgtgttcaccaagtctccctatcaggtaccgcctgccaagac
acctcattaacctagacaagggcacagggtgctggggtgtggctacaactcacaccttgt
ctttttttaggaattcactgaccatcttgtaaagacccacaccagagtctccgtgcagag
gacccaggctccagctgtggccaccacatagttttatacaagaaaaataaaagtgaatta
aagcttgttaatagtgcctttctttatttctcttcagtagttgaatttaaagggagataa
accaagtcattagtaggtcaaggttggagatcaaaggtgttaccagaaactgatttctta
tttttttattttgaggataatcttgtaaagaggctcaaggagctgccttaggcagcagca
gcctctttagcagcttttctctctgccagcatccgctgcttctgtttagccaggcacttc
ctagcagaataatgggctcccaggtcgtgatctaggaaagagaccagagtaaggaagtca
ggccagttttccaggatgcagaccagggtcttctctaagtggggaggaaacgcagctagc
taagtgctgagcagaaaagggacctgggatgtagtgattctcttaatacctctcccccaa
ccaactggcactctatgggcagtgatgtttctaaaaactggagggcagcccgggtggtgc
agctgtcagcccagggcatgatcctggagacctgggatccagtcccacgtcaggcttcct
gcatggagcctgcttctccctctgcccgtgtctctcctgaataaaatctttaaaaaaaac
caaaaactggagagaatgtggaaggttcaaggaagaggccagggtggggggtgcttacag
cggtcctggtaggccttggccacctgggtgaactgctccagctccttggcacagttctgc
ctgtagctctcaccttcccgctgctgacaggccttcagcctctcctggataatgttgacg
atttcttgatccactttactgaaaagaaccagaaaagtggtctttgaggaatcctttccc
tgtacccagagatggtagaatgaaaatgagaccttacagctctgttgtctggccgctgca
ccctcaagacctgggccaaccccaggaggcattcttgccagctgaccaccatcccacggt
accccagggaatgagagcccaacaggagatgctgaccgtgccaggctcaccattcc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved