Canis_familiaris Locus mono:SNORD60
snOPY snoRNA Orthological Gene Database
Canis_familiaris mono:SNORD60
Canis_familiaris
mono:SNORD60
6
SNORD60
1001..1084
2084
cacctatcacaactcctcaggattccccgggtgctgtccagcgctccgcacccgggatc
accggcttgagcccccaggagacgcctgccaatgcctggaggcattccgggtggtcacgg
ggtgggggggaggcccctgtatctagcgggtggagaccggggatattgctccacgtccac
cgaagcacggcggggaacgctcggcgcccagtgtcaacagcggcgggccgcagaaaagct
gccagagaagcaaagccgctccaccaacgcggcggggaggaggcaatgagcaacgaccgc
gcgagaccccggcccgcgcccgccccgccccccaggttgttcccactccgcgggccccga
cgcgccccccgcgcggccccgaggcacgagcccccggccaggcgcgcctcgccgacactc
acccgcccgcggccaccggggagcggcagcgccaccctcccgcttcatcgtgcccccgcg
gccgccggccgggaaagggacaggacgtgcgagccggaagcgcccgggcgcggcgcacgc
cgggacttgtagttccccgactcgcaatgtccttggggccgcctcacgcgcggctcctca
gaaactacgacttccggcggctcgacgtcaggggcgggattggcagctttagaatcgctc
tatgttgcaggtcgcagtctgattggttgcttgcggctgtcgctcacggtcctgttcggg
gccggggggccgggagcgtatcagcggtgagggggggcggtacttccgtcaggaaggccc
aatcgcagcagtagggctgtttctataaaggcttgagcctcgcgccctcccattctttcc
cgtgggcgccgtgggttgaggtcgtgtcctcgctgggcccccagcctccggcggtgcctg
gcctctcccgccccggcggaaggtgcgaacccccccagacctacttctccctgcaggtga
ggccgggccgggccgggcctgctgtcccctatgccccttggAGCCTGTGATGAGTCGCTT
TTTACTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTTGCAAAACTGA
GGCTTcggggcgtgccccgggtgacgggagggggccgggggcgccttgtccgaaagccgg
gaatgggctctgtctccatttggacgctgtctctctccttccagggcggcgggtgacccg
actggaggccctgatccagagtccaggtctgtatctgaagtgcggcaataaaggtggtga
gtcgatgggcgcgcaggtgtctttattctcctgcgcgtttgaccccaggggaccgggtgg
ggcacctgctcgcccctgggcaggcatgagacagggcagagagggatgtgtgtacaggga
ctaatccaggcttgtctcgaaggccaaaaacaacgggtttttgttgttcgttttgtttcg
cctgtggcttgggtagttcaggaactgtttaataactcactagccggtgctggagtcctg
tttcttccccggtgctctctagaccgctttggggttccaagcagcctagtgatgggggct
ggggcggactcctgagtgttaaaggccacccatactttgctgaggggcctaggacaggtt
tctttcaacagaaaagacaagcagtccagaaaacacaactttattcactagaactgaaaa
caaaggctcttattctaaagactgacttgaagatttccgtacaaggtggagcgtgctacc
agccccctggcttgccctgactgagcacaggcctccccggggctggcagttctctctgac
ttttctgtgatttcccacatgctgttctgtatcacaaagccacaaccgtggcgttcttca
aggtcgtgtggaaggaagacccgttgatgtctgaaccagagtctcctggcaggtgagctg
ggagcagatggctctggtccttgcggcacaaatgcacgatgcgatgatttgcggcgaagc
cttctgccccaggcgtggacagcagtcctgccttaccctgcctgggcacgtgcgcagctg
aagacctggctttctaaggggttaggcactcactgtacacgtgct
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved