Canis_familiaris Locus SRCAP
snOPY snoRNA Orthological Gene Database
Canis_familiaris SRCAP
Canis_familiaris
SRCAP
6
SNORA30
9830..9958
34926
cctatgaatgttggctttaggctcagtcacaggttaatccatgagcttgattcatttgt
aaaatggagcattgttgggattaaaagagaattagtgcacaaagtggtctcagtagaaga
taactgttactattctattctggggtgagggtatctcaaaggagttcttaacctagaaag
ttggccaacaaatggcatatcggtgcttgggagctattgggaataacacccttgtgttaa
gcgaagcagctatgtaagtacactgccgtaggaatccagaggcccaggctctactgctaa
cttgctgaaagtacctgacaaattgcttcagctctctgggtgatctattaaaaaacgggg
gactggtccgaattggcagccgcaatgcagctccactggcactttctcctgtggagaata
aagacgctctgccgcggggcaagcgcggagtctccagaggactacatcacccagcctgct
ttgcgcttcggacagcgccctacgctagcacgcgagcctccccgatcctccaacctccag
ttactgtctctcgcgagaggacgggccgcgccggcggtagcgatagagagctgtggtggt
ggtgctggtggtggtggcggccgagacggcggcggccattttggtggggcctcggaagcg
gcggcggcggttcgctgagagtagcgtcttccatttttcccacccaccgcccgcatctct
gtgtcgtgagaggaggcaatggaagcaaggcggtggcagtagccgcgggccccaggggaa
tttaaaggccgcaaaggcggcggccaagagggggccctcccccctcctcggcgggagggg
gggtggtgcgcacgcccccgaggacgcaggtaaggagagggagacaagatggcggacact
ccacagttccccctcccctgacgggagactgcgcgcgcatcttttggccacggcttttct
tcccactttccgggggtgttgggcgcgcaccttcggccgggGCCCCGGGGCCGGTGCGCG
AGGCTTTCGGCGCGCCCCCATAGAGACAGGTTGAGGGGGGCCAGGCCGGCCAGCACAGGG
CCCAGGGGCATTTCTTTTCCCCTCCCGTCCGTTTGGGCACGGGTGCCTGAGCGAGCGAGC
GACCCCTGAGAGGACGGACCCAGgtgggttcccgcccgcccaccaaacccaggccccccc
ccccccaggggcgcgcgggaagaggaaggggggcgtgggacgaggagtcggggcgcgcgc
ccaccatatccagtcagtaaccaggacctggcggcacgaaccctcccttatgtcagccct
tcgcggtctggtggtggggggctccctgacgggtagggatgagagacttcccagcctgcg
acccttgtgtgcgtgggtttgggctctggcgggagcccccgggcggtgcgcgcagccggc
tctctccacctccaggcgcgcacgcgcgggcccctcccccagtctgtcgcgcacgttggg
tggggtgggagtctaggagggggcggggctagtttaggtttagtggcaacttggggtaga
ggtcaggggtcacgccgggtcagtctgttggaaggagttgggaggcagcagtgaagccag
gggtcaagagttcaggcgtcttgaattctggttagctcgggtcttgtgaatctgttgtgg
aggaaggagtgaatcgaaggctgcactgtggctaaggaatttccttaaacactagggaaa
cacttccgggcctttggtgggtttaccctacctgtttccggggcatggttctttgccgag
cggtctttctcacttctgacttctcctctaatgtctcctgctgcaattcttgtgtttgag
gaagtgtctcatggggcaggtataggagttacggggccctgccctgaggaagggtggatt
ctcctgtgattctgttcaatcctcacttgaaaggagagccaacatctttcagagcttctg
gatgtgacagctttttttgctgttatttgccctctgttccgtggttagaaccttttacgc
ttaagctttttaaactttttgtttcttgttctttgcttcactgcagtgcttctcttccag
ccagaatcttagctctcttagggaattgtgtttttgcaaaacatgatttgcttttatttt
ttctgaaacgagagctttccttactataattctcttcaacctttgattttggtgtattta
aaagcttcaaaagttgtcgtaaagaaggctttgatgttcgtagatcatcgtggaataaac
cgatcgtggatcagttcctcactgcctgttttccttcccctatgcttgtttcagGCGTGA
TTCCTCTCAGTACGGCGGCACCGTGGAAGTACAGACTTTCACAGGGGGTGTGGTCTCAGC
TCACACAGgtgagggttcagataccattttgtgtactgatgctaatggaaaagatgtttg
agatgagagaaattataagtatttttcgttttttgatagtggcacaagcacaaaagttga
cttgtgaatagagaaaggtctgataaccctgattttcccaaggagagtagcaccttctcc
gtggttttggcatcagactacctcagtttaagtctttctatcagttccttactgtgtgac
cttatgcaagtcatttaggtctctgtatgctgactttcttacataaaatagggaaaatag
tagaatgcaggctccatttaggtctgggatgttttctgtgttatctaacttcaatatatt
gaagaaactaaacgtttataaaggtgtgaaaaataacgtggtttgcaaggtaggtatgaa
gattacagaatgtatcaagtcagtgtttagtacggtatgacacatagcggaagcccaaga
aacataggctttaatcattgtttctttacttttgttctttaatgttattcttgggtttgt
ttttttttttaaaggttcattaatcttattaaaacccatttttactcttttttaccctac
ttagGTGCTCCAGAGGCCGGTGGACCTGAGCGGAGGCTGGGACGCCCTAGTGGGCCCCGG
GCCCTGGAAGGCGGGTCCCGGTGGCCGGTGGCCCAGAATGAGGCCAGCTCCCAGCATGCC
CTGCAGCCGGACGCCAGCCCCTCGGCCAGCAGCAGTGGTGATAACAACCCAGTCATTCTT
CAGGCGTCCAAAGAGGAGCCTGGGAGTGGGACCATGCAGAGCAGCCCCTCCCCTGCTCAC
CCTCAGCTCCCAATCTTGCAGACACAGgtttgaaagtggacgggttccttctctgctttt
gctttgtgtgttgttggctctgaggcagaaaaaaatgtggcaagttttagccacatttcc
atgatcctagctaactggaaaatttttggtgcttatgttgaccatcaagcctgttagata
cattctttttgacattagtgtaatattggtcactaagagtgtggaacctccttgttacct
gaaatggtttcaactaggccaggttggaaatgggttggcacaacatgcttctaagacaga
gagctttgagaatagctcagtttctttaggaattgaagcattatggatggtgtgtagcat
ttatactttccttgtaatatagcaccaaggaaatggaaaagtagaaaaaacatggctttt
gagaatagccatatataggtttgcataggtaggtttttaattggtatggatttgatactt
aaaattttcctgagcacctggggaattttgtgacatacagtcttttgtcatttaactgag
gtaggaatttcagtggcacacctgaggctagtgtgccagagtgattttttttggttttcc
tcactacctacatttaagtgagatattatttcctacttattactgtttgtgcagtagctt
gtaaagtaataggtgaatacttgagaatagtgactccctttccttcccaccttcctagta
aaggaaactaccaagattgttgaagaacataaaaagatttaagtgatcttggtggtggtc
tttgttgccttttgaatttggtggtaactcagatttgttctaataggtccatatgccaca
cttgatgtataaaggagggaagaagagggagttgttcatgtgaatgaaattcttgaggtt
ctgaaaggatcattagcgtttgaaatcatctactctagtatgttcttgaattcataaact
gtaaatgtcaagctataacttttcttgcatctgtaaacttggctttgttatcttgaaggt
ctttttaaaatgatatcgcgtatatttgtgtttataaaaacaagattgggcagccccggt
ggcgcagcggtttagagcctcctgcagcccagggcgtgatctggagaccctggatcgagt
cccacgtcaggctctctgcatggagcctgcttctccctctgcctgtgtttctgcatctct
atgaataaataaataaaatcttaaaaaaaaaaaacaagattgatcatttactctggagtt
tttccttgtgaaggtagaatgaaataatatcaagaatttttttttaaaagattttatttc
agagagagcatgcacaaacaagcaagcatgagtggcggggaggggcagaagaagaagcag
actccccactgagcagggagtcttacacggggtttgatcccaaagtcctgggatcatgac
cttagccaaaagcagacacttaatcaactgagccacccaggcgcccgatgagaactgctg
gtatggtgctaagtaaagtaaacattcattttatttatcatttttgtttttctagATGGT
GTCGGACGGCATGACAGGCAGCAATCCTGTGTCCCCTGCCTCATCCAGTTCCCCAGCCTC
TAGTGGGGCAGGCGGCATCTCCCCCCAGCATATAGCTCAAGATTCCTCTCTGGATGGACC
TCCAGGGCCCCCAGATGGTGCCACAGTGCCCCTGGAGGGGCTCAGCTTACCCCAGGCTGC
TGACCTGGCTAACAAGGGCCCAAAGTGGGAGAAGAGCCATGCTGAGATTGCAGAGCAGGC
CAAGCATgtatgtattggggaggtctctgaggattcttctttcttcaactcctatgtcct
ttgagctttttacttttctttccgtatggatggatggatttatttattttttaaagatta
tttattcatgagagacagagagagagagtgggagaaagagaggcagagggacaggcagag
ggagaagcaggctccgtgtaggagcctgacatgggacttgatcctgggtctccaggatta
ccccctgggccgaaggcagcactaaaccgctgagctccccctctttgtggatttagagta
taggctctgccttaacttacatgatcttgagttgcttaatctctgagccttgttttctat
aaggttgtagtatggtgtagtagtctatagagtgttgtgaggtttaagttaagggagaaa
tagacataaaagtgctttgtaaagctgtaaggctctttaagatttactggtttctacttc
tcatttttattctccagtctctcttgccttatccagtggtaagtttcatctctggaccag
cagcattggcatcacctgggaaatttgttagaaatgcaagtttgggggatccctgagtgg
ctcagcggtttagcgcctgcctttggcccagggcgcaatcctggagtcccgggatcgagt
cccatgtcgagctcctggcatgaggcctgcttctccctcctcctgtgtctctgcctctct
ctctctctctctctctctctatgtgtatcataaataaataaatctttaaaaaaaaaaaaa
agaggggatccctgggtggcgcagcggtttggcgcctgcctttggcccagggcgcgatcc
tggagacccgggatcgaatcccacatcaggcttctggtgcatggagcctgcttctccctc
tgcctatgtctctgcctctctctctctgtgactatcataaataaaaataaaaaaaaataa
aaaaaagaaatgcaagtttgttggtacccacctatctatttaaagctggaggggtggggt
ccgtcaatctgtcttaaaaagcactccagatgattttgatgcatgcttaaatttgagagc
cattgatctaatacccccatcttgatgtttctttcgccatcaggccatttagttccctct
gtctttgctggctgttttttcctctgattaatttttgtttggagaggataagaataatga
cggcagttgtcttttgagtttgtctttttaaatatttattttagagagaaagtatgggag
gggcagaaggagagagacagggagagaagctatgtggagagcctgaccgcggactggatc
ccacaaccctgagatcctgccctgaaccaaaatcaagagtctaatgctcagctgagccac
caggcaccccagttgtcttaaggttttttttgtttgtttgttttttaagatttttattca
tgagacacacacacccacacagaggcagagacacaggcagaggaagaagcaggctccatg
cggggagcccattgtgggacttgaccctgggtctccaggatcacaccccgggccaaaggc
agtgctaaaccgctgggccactggagctgcccaagtttttaagtcacctttgttgatttc
agatgcttttacttctttatgaatttaaccattgtagaaatagtgttctcttttgttatt
taatttttctatgtgtaacttcaatattgtcatcaaaatgtatgtttttataaaagtagt
atttttcaggcagcccgggtggctcagcggtttagtgctgccttcagcccacagcctgat
cctggagacccaggatctagtcccacatcgggctcccggtatggagcctgcttctgcctc
tgcctgtctctctctctctctctgtctcatgaataaataaataaaatctttaaatatata
tgtattctaaaaacaaataggattatgtaaattgggccttaaatttctaagcatgaacat
actctttctcaagcagaattcaacagcgatgatgatcttttgtccataaggaagggttca
ttccctgcttctctagaggcttcccttggaatatgttttcctcagtctttcctatattca
tagggcatggatattgagtgaaataacagaatgtgaaatctggtgtctggagtcattaga
cctatttttaatttccagctcttatcacttcttggttgtgtgatctcaaatcacttttat
cttcctatcttctctctttttttttttttctcacttgaaaaagttgtaatacctgcttac
tttcaggattggtaagaggacttaagacatgtaaaatgctcagtccagacagtgcctata
tataatcagtgcccaggaattcagctgtatttgtgaggtaggttttatttgcagtggttg
acttagctcctctttgttagGAGGCTGAGATTGAGACTCGGATTGCTGAGCTGCGGAAAG
AGGGTTTCTGGTCACTGAAAAGGCTGCCTAAAGTGCCAGAGCCTCCCCGCCCCAAAGGCC
ACTGGGACTATCTATGTGAGGAGATGCAGTGGCTCTCTGCTGACTTTGCTCAGGAGCGTC
GTTGGAAACGGGGTGTGGCCCGTAAGgtatgtcatcaactgggcctaccttccttatttc
ttttcccagtttccttttcgttgatatgtgggttgaagaaaaccaaactgaaacagtata
gggtggttattaatgcctatagtctcaagacacaagctgatttcccagatttcttggact
tgattacgatctttgcttttgatttgaggaaggagtaggagattggccttggaatgtttt
cactctggttccttattccacagGTTGTGCGCATGGTCATCCGGCACCACGAGGAGCAGC
GGCAGAAGGAGGAACGGGCTCGGAGAGAAGAGCAGGCCAAGCTACGCCGAATTGCCTCCA
CCATGGCCAAAGATGTCAGGCAATTCTGGAGCAATGTGGAGAAGgtaggcagcagggatt
ggaagagggaaatgccttaggtttgcttggtatggttagcatggtatcaggaacgatcaa
aacttgagagagaaatattttaacttcaagtgattctagtgagatttccattgtgcattg
gatctctctagcattgggtgccaggaagaagaaagaagtagagtggaaaaatatggccat
accttaggggattgttaataagactttttgatccctctaggccactcgtcctctgcaggg
cattctgcacacttttcctacaacctcttagtgccatttagctggttaaataccattgaa
gttctcagtaatcaacttgttcccttatgttaagttttattgtttctcaagtgctacttg
gtttctgtctatgttttcagtcttgtctcctgttagttcctttccttttctttcttcgtt
tcaaatattctttcttttgcccatccctgctaacttacctgtgctttttctgctgcctgg
aatgcatttctcgtcattcccactttgggaacacctactagtcttaaagattcaactcca
gatacatttgtatatttttccctgctacctgaagttaaactggctcttctctttcctttg
ttccctttgtgctttccttaaggaaaggtcattttagttcttctcttttgaaaagctagt
tcatagtctaacatagaggaagtttccttaaatgttaggtaaaagggtacatgaataaaa
gattgttagtgacctgttcatttcatgttgtggcagGTGGTGCAATTCAAGCAACAGTCC
CGGCTTGAGGAAAAGCGTAAAAAAGCTCTGGACCTGCACCTGGACTTCATTGTGGGGCAG
ACTGAAAAGTACTCAGACCTTTTATCTCAGAGCCTCAACCAGCCACTAGCATCCAGCAAA
GCTGGCTCTTCCCCTTGTCTAGGCTCTTCCTCAGCTGCCTCTAGTCCTCCACCCCCGGTT
TCCCGGCTGGACGATGAAGgtgtgtgtcctctttggctctgttactcttcctcatgtacc
ctttccagagctgaaaacccaccctgtggcttgcagggccccgtggactttgtgaccttg
ttctcctgctatagATGGGGACTTCCAACCCCAAGAGGAGGAGGAAGAGGATGACGAGGA
GACGATTGAGGTTGAAGAACAACAGGAAGGCAATGATGCAGAGACCCAGAGGCGTGAGAT
TGAGCTGCTTCGACGTGAGGGAGAATTGCCATTGGAAGAGCTGCTCCGTTCCCTCCCCCC
TCAGCTGCTAGGAGGGCCTTCCAGCCCCTCGAGGACCCCCTCATCTCGTGACAGTGATAT
CCGAGATGGGCCTGAAGAAGGTGGTGAAGAAGAGCCCTCTCAGGTGATACAGgtatgggg
agaatgagtagagggaggactcaaaagtgggaacagaggtagaggttcaaggactgagat
ctggtttataaggttggttgtggttttcaggagtcctctctggttaagagtaattggctc
tcatttggggacggataaagaatctgggtttggggcaagttgcattctgatacgggcagt
ttctgatgctgtagtggaaaagtgtattgtactctactttttaactgctatgtcttcttg
aaaaaagatacttaatctggtttttgccacttctgtgaaatagtcctaatactccctatt
ggtttctaggtttggagctaggatgataatcttgaagtcttttctggacctaagctctct
atcatatgtctgagtgcatagggatggtgttgggggcctgtgtttcttatctagcacttt
cacagatcctcccccaggcagtggggccaggatttggtagctggtgctgaaagaaaacct
ttgattgcatccttgccctgggaccgtaccagtggcagctgtcactcagtggaacagaga
ctgttctgtgacaatgtattcaacatcgaacctttctcctgttgcttaaaccttaggtct
tcttcctttttatcctttgccatacagGTGAAACCCTCACCCTCTGTTACACAGCGCAAT
AAACAGCCTTGGCATCCAGATGAGGATGACGAAGAGTTTACTGCCAATGAGGATGAAGgt
caggcttattttctgtatcctttgcccctttccctttgaattgtctagacataatattta
atgctttctcctttgttcagcttggactgggtcctataattctgttcccattgattttgc
ttcattctctttcttagCGGAGGATGAAGAGGAAACTATAGCGGCTGAGGAGCAGTTGGA
AGGGGAGGTGGACCATGCCATGGAGCTGAGCGAGTTGGCTCGAGAAGgtgacattcacca
gatgtttactgagcgtccactcggtgtctcctttgtgcagaattccagggataaagggat
gaataagactttatccttctcagaggaactccaggtctaatgacaaagacagatgttaaa
taattataaatagaatatgacaagttttgatggaagtttgaacaaagtgataggacagct
aagtggaactgatgtaagaggatgttggctgtgtttgacttgaatcttaaagagatttag
tttgatatccttcccagtggatggcagcatcacccatggttctggccaaggctgtgtggc
ttggctttagtagcaggtgttgaaagcaaactcttacctcccttcagatctgagcccagg
agtgtctgtagaaaccaacataaaattaactggcagccctcagtcctttctcctttacct
cctttcccttgaagcaccaagaagctcctgtgtcatttcttccccagGTGAGCTATCTAT
GGAAGAGCTCTTGCAGCAGTATGCGGGAGCCTATGCTTCTGACGCCTCTGGCCCAGGCTC
TGGGAGTAGCGAAGAAGAGGACGAGGAGGAGGTTGAGGCTAACAGCTCTGACTGTGAAGC
AGAGGGGGCCACAGAGGCTGAAGAGGCTCGTCCTGAGGACAGTAGCAGTCAGTCAGgtga
atgtgtggtcatggatgtgctgtgggggaggctttggaggggaatgggtgtggtgagcac
taagccttggtgtgcttcagAATCTGCTGAAGAGCAAAGTGAGGAAGAAGAAGATGAGCA
TTCAGAGGAGGAAGAAACCAGCGGGAGTTCAGAATCAGAGGAATCGGAGTCTGAGGAGTC
TGAGGAGTCTGGATCACAGAGCCAGGCAGATGAGGAAGAGGAGGAAGATGATGACTTTGG
GGTGGAATACTTGCTTGCCCGGGATGAAGAGCAGAGTGAGGCAGATGGGGGCAGTGGACC
TCCTACCCCAGGACCCACCGCTACTCTAGGCCCTAAGAAGGAGATTACTGACATCGCTGC
GGCAGCTGAAAGTCTTCAGCCCAAGGGTTACACCTTGGCCACTACCCAGgtaacccctga
ccccagcttctgctttttcttatcttgacttttttgattctcagtgactaaggcctcatt
tctactttgatatctctcttcctccctaccagGTGAAGACACCCATCCCCTTGCTCCTGC
GGGGCCAGCTCCGGGAGTACCAACACATTGGGCTGGACTGGCTGGTTACTATGTATGAGA
AGAAGCTTAATGGTATTCTTGCTGATGAGATGGGGCTAGGCAAGACAATCCAGACCATCT
CCCTGCTTGCCCATTTGGCCTGTGAAAAAGgtaacaaggcagggcccttcttcttggatc
tccttgaccaattccctgtgaagcttatttaatggtgactagttgctggatggtgaaaca
ctgtttcctgcttagtagcttccttgactggtcagtaactagggagatgccagtgtaggt
gctaggattcttaggaggggatcattagagtgatcagggttatacctgagggactagaat
agaaccgcagtttgcatttctttaccacctctaatttttctttctttttaaattctcttt
aaaatctttttttttgggggatccctgggtggcgcagtggtttggcgcctgcctttggcc
cagggcgcgatcctggagtcccgggatcgaatcccacgtcgggctcccggcgcatggagc
ctgcttctccctctgcctgtgtctctgcctctctctctctgtgtgactatcataaataaa
taaagaaaaaaagataaaaaataaaaataaaatctttttttttaagttgaggtataatcg
acatgtaacattatgtaggttttaaggatccagcataatgttctgatgttagtatgtgtt
gtgaaatgattaacacaataagtctagttaacgtccactactatacgtagttacaaaaac
ttgtttctcgtgattagaattttttaatgtgttcttttaactttcaaatatgcagtccag
tattattaactatagtcaccatgctgtacatctcttattcttttgctaaacagGTAACTG
GGGTCCCCATTTGATCATTGTCCCCACCAGTGTGATGCTGAACTGGGAGATGGAGCTGAA
ACGGTGGTGCCCCAGCTTTAAAATCCTCACTTACTATGGAGCCCAGAAAGAGAGGAAGCT
CAAGCGGCAGgttcgctctccatgtgatcaccccccccccccccacctcttttactctta
agccctttcctcagaggagttcctttccctcctttttctgttgctgcctcctgctcctgg
ggctttctcttttttcccaacctgatttatgtcccttgaggaccttagcatgtcttttct
gtatcctttcttttcttttcattccactatctgctgctttctcctgatatctcagGGCTG
GACCAAGCCCAATGCCTTCCATGTGTGTATCACGTCTTACAAGCTGGTGCTGCAGGACCA
CCAGGCCTTCCGCCGTAAGAACTGGCGCTATCTCATTCTGGATGAGGCTCAGAACATCAA
GAACTTCAAGTCACAGCGCTGGCAGTCACTGCTCAACTTCAACAGgtggagatggaaatg
ggggtttgtaggacggttgacttagcttgaagggtgagatgctcagaaggttaggacctt
gatgatcatcctccctctaattccctctgtttctttgcagCCAGAGACGCCTGCTCCTTA
CAGGAACTCCATTGCAGAACAGCCTCATGGAGCTGTGGTCTTTGATGCACTTTTTGATGC
CCCATGTCTTCCAGTCTCATCGAGAGTTTAAAGAATGGTTCTCTAACCCCCTAACTGGCA
TGATTGAGGGCAGCCAAGAGTACAATGAAGGTCTAGTCAAACGCCTCCACAAGgtagggc
ctataacatttggcagggaattgggaatggcaggctaaggacagtacctagaaaaccttt
agggaaaatgaagccagtgctgggctgaattcactcagtgtcatgtagcagggttctagt
gactgagccgtaggcaaattgagttatttcatcttcgtcattttcctttttttactgatg
gggacatttctgtcttcattctctaagtagaataatactgatcagtccttgctcagattt
cttcttactagggttttttccaactttgattgggttctctctctctttttttttctttct
ctctctctctgttcttgtttttttctggctctttcctttcgtcccccccccccttttttt
agcaagattttatttatttatttatttgtttgtttatttatttatttagcaagtagtttt
tttttttttttaagattatttatttatttattcatagagacacagaatgagaggcagaga
cacaggcagaggtagaagcaggctccatgcagagagcccgacgtgggactcgatccaggg
tctccaggatcacgccctgggctgcaggcggcactaaaccgctgcgccaccggggctgcc
cagattttatttatttattttagagaaaggaagggggaggagcagagggagagggataag
cagcctccaccctaagcacagagcctgatacagggctcagtccgacaactctgagatcat
gacttgagtcaaaatcaagagttggacactcaactgctttgtccagcttttaaaataaca
tctctcaacattcttgtctttttttaaatctcagttaacatctgttttttttttttcttt
tttttttttttaatttttatttatttatgatagtcacagagagagagagagagagagaga
gaggcagagacacaggcagagggagaagcaggctccatgcaccgggagcctgacgtggga
ttcgatcccgggtctccaggatcgcgccctgggccaaaggcaggcaccaaaccgctgcgc
cacccagggatccctcagttaacatatcttaaggtttcaagaattctccactttatattt
ttacagtcttaaccaaactatttaaatttctaacttgatatctttaattctttttttttt
ttttttttaatttttatttatttatgatagtcacagagagagagagagaggcagagacac
aggcagagggagaagcaggctccatgcaccgggagcctgatgtgggattcgatcctgggt
ctccaggatcgcgccctgggccaaaggcaggcgccaaaccgctgcgccacccagggatcc
caacttgatatctttaattcaaagtttctcttgaacacaccctgttctaagccaaaatct
cgagtcttatagcctcctatttctactccattttgttccatcacaccttcattttggtaa
atcagaatagaaaccaaaaagacttcactagctatgtctctttccttcgttttattccta
ttttccatttcttccatgtgaatttaaagactatgtcctatcagattttacctcttggga
tttcagatttgccttttgttttctgtggtactgtcactgccacaagttttgttctcagct
tctcttctggatttactctcgtaatattacaaatttacatttcctcctggaaatgtaatt
tgagtcattcctcctgtagttagttgctctgccttcagtgtcttttttttttttttaaag
catttctttaggtatggtatcatctttgtgtatgtctccttcaaccgatagtaaatgttt
gagaagagggctttcatttgattcctctctgcgtgattggttcttggcacgctttatggc
ttcatgagtatttactgaagggctaagccagggttcttctggtcatcagctcaagaccca
gctagagaggctaggctggggctcagtgcccatcattcttctgtcagcctcttgcttatt
tgcttttagGTTTTGCGGCCTTTTTTGCTGCGCCGAGTTAAGGTGGATGTTGAGAAGCAG
ATGCCTAAAAAGTATGAGCATGTTATCCGCTGCCGGCTCTCCAAGCGTCAACGCTGCCTC
TATGATGACTTCATGGCACAGACCACgtaagggaggcccgagggtgggccctggggctct
ttattggaacagatgtgattgtcaggatgccccatatatttttcctctctcccagAACTA
AGGAGACCCTAGCCACAGGCCATTTCATGAGTGTCATCAACATTTTGATGCAGCTGCGAA
AAGTCTGCAATCATCCAAACCTGTTTGACCCTCGACCTGTTACCTCCCCCTTCATCACCC
CAGGAATTTGTTTCAGCACCGCATCTCTGGTGCTCAGGGCCACTGATGTCCACCCCCTTC
AGgtgagtagttgctcccaagattattggccctatcctaaccctgcatctttttctttag
gctggattctgaccttttgcatttttccttttatataatctgagcactattcttctagtt
tcattgtttcctagctgtgtgactttgggcaagctctttattaatctctaatgctgtttg
cctttgaaagtagggattataaagtctattatctgcggtttgtgaaaattgtgttaatat
ttttgaaagtgcctggcatgttagttatacttaaatacttaaatgttactttgttttcct
gttccttccctcttttttggccacttttccctccaaacttttggttttgttgtggcaaaa
tacagaaattgtatcattttaaccatttttaagtatacgtttcagtggcatgagtacatt
cacattgttgtgtgactaccatcatcactgtctatcttcaaaactttttttcatctttcc
aaattgaaacgccatgcacactaaataataattactcctcattttctgctttcccccagc
ccttggcagccacactctactttgtctaagtttgcctattctaagtactcatataaatag
gatcatatggtattcgtccttttgtgactggcttatttcacttagcagaatgtcttccag
gttcatccatattgtagtacatgtcagaatttatttcattgttaagttagggtgatgttt
tgtatcatatttatgtctacgtatttgtatacatcctgacatgtacgtgtgtatactgta
ttttgttttatctgtttatccatcagtggacactttgggttatatttacttttggctatt
gtaaataatgctacaatgaacacaagtgtgcaaataccagtttgagtcctgctttcaatt
cttttgggtacatacccagacaaggaattggatcgtatggtagttttattttttaatttt
gagaaatcgccatagtattttccatagtgactgctccgtttcacattgccaccagcagtg
cacaagggttctaatttctccatattattgccagcagttggtgttttgttttattacaat
agccgtcttaacaggtgtgaggtggcagtacctcattatgatttgatttgcatttcccta
atgattagggtacatgtgcttattgtgtatttcctttagagaaatgtccatttggtatat
ttgcctgatttttttaattaggttgtttcgttgttgagttgtgggagttctttatatatt
ctagatattaacatcagatacatgatttgcaaatattttgtctcattacatagcttgatt
tctcattctgttgatagtatcttttgatactatcaaaagtccaatttatcgttttttttt
tcttttgttgtctgtgctattggtgtcatatccaagaaatcattgctgtattggtctctc
tgacaacatgcttttgtgttcttcttgtaccagCGGATAGACATGGGTCGGTTTGATCTT
ATTGGCCTGGAGGGTCGTGTCTCTAGATATGAGGCTGAGACATTTCTACCCCGTCACCGC
CTGTCCCGCCGGGTACTGCTAGAAGTGGCTACAGCTCCTGATCCCCCACCCCGGCCCAAA
CCAGTCAAGATGAAGGTTAACAGgtaccagggttgagggataaaggggatgggttcctag
aaaaagtggctatagctggctgggggtggaaattggggtggaaaggagagagttggaggc
taggctagaatgtttatataggatggatacaacgtactggaggaattgggggagacaata
actagaagaggatcctgggaggggctcttgtgtttgtcactgatttgtttctccctttct
ctggttggtgctttttggttatcttggatctctctttctttctcctttgtgtccttttct
tttaccccctttgcttttgtaatttctgttacgtttcttcttcaacttcctattccttat
tctccctccctttcctacccacccttttgtttctgtcctcatagGATGCTGCAGCCAGTG
CCCAAGCAGGAAGGCCGGACAGTGGTGGTGGTGAACAGCCCACGGACCCCCATTGGCCCT
GTCCCCGTCCGACCCTCTCCAGGCCCTGAGTTCTCCGCCCAGCCCACCCCTGGCCCAACA
CCTCCAATGCTGCCAGCACCACTGATGGTGTCAGCTTCGCCTGTTGGGCCCCCACTTATT
CCGGCATCCCGGCCTCCTGGCCCTGTTCTGTTGCCCCCACTGCAGCCAAACAGTGGGCCT
CTTCCCCAGGgtgagttacaagggggccagtgtgctgggggctacctcaggcagattgtg
attatgcctgttcagattggggaagaagtaatgaaattagagtagggaggatgctaaatt
ggagacaggtgtggtatttgataggttgggagcatgtgtggtgatttctgggagcaggct
aaggctatatctgacagatgtttgctttgtgtctgcagTGTTGCCATCCCCCCTGGGGGT
CCTTAGTGGGACCTCACGGCCTCCTACACCAACCCTGTCCTTGAAGCCGGCCCCACCTGC
ACCTGTTCGCTTAAGCCCTGCTCCACCTCCAGGCTCCTCCAGCCTGTTGAAGCCCCTGAC
AGTGCCACCAGGCTACACTTTCCCTTCTGCTGCTGCCACCACCACCTCTACTACCACAGC
CACTGCTCCCACCACGGCAGTGCCAGCTTCTACTCCTGCACCACAGCGCCTCATCTTGTC
TCCTGATATGCAGGCTCGCCTGCCCTgtaagttctcaggagtctgtgaatgaaggtttta
agatgggaggagtgtatatatgctacagggctggagaaaagcttgagaatgttgaaagta
taaaactccaagtagctaatgcatgtgaaatattttaccatatgctggaaattcatagtc
gagtaagagctgtcaaggagttctcaggctagtgggggaaatgacaccagagatgagtaa
atagtgatagacctagaagtagaaagttatttggggataaagggcagcatggagttgggg
gtgatgattagctcagtatggtggcaggccattagaggatataaagaagattgctgggca
cacaatgggattggaaggggtagcacatcaaaggctcaaaggctgagtttgttggaacct
ggtaaattgagttaggagggttggaggaactggagacttgtgcctcttgaggcaaagtgg
tgttaaagagtagttgctgtgtacattaagtcccttctttgttcctagCAGGTGAAGTGG
TCAGCATCGGGCAGTTGGCCTCACTGGCACAACGTCCAGTGGCTAGTGCAGGAGGAAGCA
AACCTCTCACCTTCCAAATCCAGGGCAACAAGCTGACTTTGACTGGTGCGCAGGTGCGCC
AGCTTGCTGTGGGGCAGCCCCGCCCGCTGCAAAgtaggtaaaacccaccccctgtcctgc
tttttttctcctcttccttgtctctttgtttttgttgctctcttcggacgtcagccttta
tgtttcttttcctaacttttggtgggatggggccaaagggaatgtttagaagggctcttt
tgagaaaagtagggatgaggtcattctagagaagttatcccctctctgttctttcctttt
cctctggcccttgcctctatcctcctcctgctgatagctgcttctctttctttctctctt
cccttaacccagGGAATGTGGTGCACCTGGTGTCAGCAGGGGGGCAGCACCACCTCATCA
GCCAGCCTGCCCATGTGGCTCTCATCCAGGCCGTGGCCCCGACCCCTGGCCCCACCCCTG
TCTCTGTGCTGCCTTCTTCGACCCCCAGCACCACCCTTGCCCCCACTGGCCTCAGCCTTC
CGCTTGCTGCTAACCAGGgtgaggctcctggccttcctacttacttagcccttgctggcc
ttggtcctttcaggcatgccctgggctactgtctgtccagccttcccccagtgttgtttt
cccttgccagtatctccaatatctgtctgctaccctctcctgcccctggactatttccat
cctttgggtctcttgtttcttttctaccttcccctcaatgtagcttcctcttgcagTGCC
ACCAACCATGGTGAATAATACAGGCGTGGTGAAGATTGTAGTGAGACAGGCCCCTCGGGA
TGGACTGACTCCTGTTCCTCCACTGGCCCCAGCACCCCGGCCTCCGAGTTCTGGGCTTCC
AGCTGTGTTGACTCCGCGCCCCACATTAACCCCTGGCCGGCTACCCACACCTACTCTGGG
TACTGCCCGGGCCCCCATCCCCACGTCCACTCTGGTGAGGCCTCTTCTCAAGCTGGTCCA
CAGTCCTTCGCCCGAAGTCAGTGgtgagtccaggtggctaagagcagatgtttttgccag
gaatggacatagggtggtccggagggtttctttgtcacagcaagattctctgtttatcag
catactgactcactttgtagtgggcctcagagcgaggctgctgagctcttgccttatttt
aaaatatacttcatgaaatcttggagggaaaggaaatgttaagttgtcagagtctttgca
tctttgacttcatggtgtgggattgaaggttttctaggaaatggataaagcgtgggggta
agggagaagggtgggatgaagtaatgaaaagacttctggggctaactcatcctctgtctc
cacagCTTCAGCACCCGGAGCTGCTCCCTTGACCATCTCTTCTCCTCTCCCTGTGCAGTC
CTCACTCCCTGGGCCAGCCTCTTCTCCAATGCCAGTTCCCAACTCCTCTCCTCTTGCTAG
TCCTGTGTCCTCTACAGTCTCAGTTCCAGTGTCCTCTTCACTTCCCATCTCTGTTTCGAC
CACGCCTCCTGCCCCAGCCTCAGCTCCACTCACCATCCCCATCTCAGCCCCCTTGCCTGT
TTCGGCTTCTGGCCCAGCTCTGTTGACCAATGTGACTCCAGCACTGGCACCTGTTGTCTC
AGCGGCTCCTGGACCTCCTTCTTTGGCACCAGCTGGGGCTTCCCCATCAGCGTCAGCTTT
GACTCTAGGTTTGGCCACAACTCCATCCCTGTCTTCATCTCAGGCACCTGGTCACCCTCT
GTTGTTGGCTCCAGCCTCTTCACATGTTCCAGGCTTGAACTCAACTGTGGCCCCAGCATG
TTCACCTGTCCTGGTACCAGCTTCTGCTCTGGCCAATCCTTTTCCGGCAGCACCAAATCC
AGCTCCAGCTCAGGCTTCCCTTCTGCCTCCAGCACATTCTGCATCTCAGGCTCTAgccac
ctctctggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncag
ACATTATCACTGACTCCAGCATCATCCCTAGTACCAGCTCCATCGCAGACGCTGTCTTTG
GCGCCAGGACCACCACTGGGTCCATCGCAGACGCTGTCTCTGGCTCCAGCACCCCCTTTG
ACTCCAGCTTCTCCGATGGGCCCAGCCCCAGCTCACACACTGACTTTGGCTCCAGTATCG
TCATCTGCTTCACTCCTGACCCCAGCTTCGGTGCAAACATTGACCTTGAGTCCTGCCCCT
GTTCCGGTGCCGCCCTTGGGCCCAGCTGCAGCCCAGACTCTGGCGCTAGCCCCAGCCTCA
ACACAGGCCCCAGCTTCCCAGACATCCTCCCTTGTGGTTTCGGCATCTGGATCTGCTCCC
TTGCCTGTCACCATGGTATCCCGGCTGCCTGTTGCCAAGGATGAGCCTGAGACACTGACA
TTGCGCCCTGGTCCCCCCAGCCCTCCCTCCACTGCTACCTCGTTCAGTGGTCCCCGGCCT
CGACGCCAGCCCCCACCACCACCTCGTTCCCCTTTCTATCTGgtaagtttactctctcag
aggagaggaaataggaagttgggtttctttggagcgttggtaaagtggagtagaacaatg
ttatttttatcttggtaaattacaaagcctagttttgtggacctggtagttgagtgtgca
gttggatcagtaccttctctcttccttgactggccctgtcctcttatctgtataatggga
ataatatctatattctgcccttctcaggggagtaattgaggacctaatgtgcgtttaaaa
cttcaaagaattactggtatgttcaaggttgccttgttactattggttaatttggtactt
gcttgcttattcttgagctagtgttggcatctaattgcccattttacaggtgaagaaact
aggccacttgatgttatagaggtgacacaacttgtgagaactcagatgtgctgactccat
tgctttctcctcttttggacaagaggcattcctcagagataggaagacttttctcagttg
ctaaaagcatcacatttgtcaagtatttgaacgtctgaggggaggtgacaccgtggaata
cagttccctaaagattgcaagcctctgactgatggttatctcttacagttttttacctcc
atggtgatcaagtgggcaataaaaagaactatgtttcttgtccttccatgaactttgtaa
tagctgtttgttttctgttatgtgtatggttccatatatgtttggttgttaaatttacag
ctcaaattgagtgaaatagtccaggaagtaataggaagaaagatctagggaatcgttcca
ggccctctttgtctttttctccctttattttccagagctgctgcttatactttgcctcag
cactaggcccccactatcagtagcatttactccacctttgatctttcagcaagccatgtt
ggtctggcttgctgaaagtagaaaggagaactagatcccttacccatggtttgtgctaaa
tgttggttgctctacaagtatgtagaaaattcttaaaactctttttttctttgaacagtt
tgacctaaagaccatagtataccatgcagcttatccatgtaaagtgtgtaattcattggc
ttttagtatattcacgtaggttacaaccatcactgcattcaacttgaaaacatttcatga
tcctaaaaaagaaccccacacttttagttatcattttccaaccctttcatctctcaactt
taggaaaccattaatctttctgtccctttagatttgcctatggagtcatagggtatatgg
tcttttgtgactggctttttcattcatcttaatgtttttgaggttcttcaacattgtagc
ttatgttggaactttaattgttgaataacattcaattgtaaggtatacgttttatatatc
tgttcatcagctgatggacacattcgagttatttctgctttttcactgttgtgagtaatg
gctgctctaaatattcatgtataagattttgtgttttcatatgttttaagttgtattgga
tgtatgcctaggagcagaattgctgagtccaacagtaactatgtttaactgtttgaggaa
ctatcaaactgttttccaaagtggctatgccattttacatctcactggcagaacataagg
gttccaggttctccacatatgtgccaacacttgctattgtctttttggttgtcgccatcc
tagtgggtatgaagtgatatcttgtgggttttgattggttttcctaatggctaatgatgt
tgagcatcttttcagtgattggccatttgcgtattttctttaaagaaattttagatattc
agtttacgtttatttatttttgtcattttttgatttttttttttttttttttaagtaaat
tctacacccaaagtggggcttgagctcacaatcctgagatcaggatcaagagcatgctgt
accaactgagccagccaggcatccctgccctttttaattggattgctttactgatttgag
ctctttatatattctgggtataaataccttttcagatacatgatttgcaaatattttctc
ttttgctactatttttgagagctgtcaaaagctgctctgctaggatgctttcctttttca
ctttgatcaccatgagcttaagaggtcaagtttaagggagcagtcagggagggcgatttg
ggacactgttttttttttttcaggaccatctcctggggtccagtctcctccttttcttca
ttctaatatccgctgttgattgagagcctacgtggtgctagatagtgggtgattatagtg
agcaaggtcagatgtggcttgaatttatatggcgttaagttttgtggatagaaggctgtc
ttattaattaaagagtcatacagatgtaaagctgcaaatgtggtaagtgctgaaaaaaag
gtagttttatagcctgtgaaaccagaagcactagtgatgggaaaagacggtgtcaaagtc
ctacagattttctctctgcaagggcactcctctttgttctcttagggtgatgaaacctag
atgtctgatttagctgttcccatcctgctccatttcagtctgacccttggcagaaacctg
ccgtggatttgattagccactctatcctggtcagtgacttgagggcttttaataattgtt
ttggatccacttcaagcatgcaaattaatttgaatgttgtggagtaggtgttacttagga
aaattcccagaaatcatcgatcttacaagcttgctggatatacagatcttaattttgaag
atttaggcattctgttttggtagcctatgaaggaagatcatggtttttttttgttttgtt
ttgttttgttttttgcagagaagctatttaacattatgaaaggaataactttgattattg
acaacttagaaaactactaaaggcataatataggtttgaatcttatggtttccataggtt
atgcttaattctgggaggaatggtcaggtttttcaggaggacactgattactttttctgt
gttttttttttcctctcatccttagGACTCTCTGGAGGAAAAGCGGAAGCGGCAGCGGTC
TGAACGCCTGGAACGGATTTTCCAACTTAGTGAGGCTCATGGGGCCCTGGCACCTGTGTA
TGGGACTGAAGTCCTGGATTTCTGTACCCTGCCCCAACCTGTTGCCAGCCCCATCGGCCC
TCGTTCTCCTGGCCCCAGCCACCCCACCTTTTGGACTTATACCGAGGCTGCCCGCCAGGC
TGTACTGTTTCCCCAGCAACGACTAGACCAGCTGTCAGAAATCATTGAGAGgttggcagg
gctaagtgctaatgggaagcgggtcttggggcctctgagtggatgtagtggttagggctg
gtgaaggtgcacttctggggcctttcagagttccatcttttatactgcttaccttcttcc
ttcacagGTTCATCTTTGTCATGCCTCCTGTGGAGGCACCTCCCCCTTCCCTGCATGCCT
GCCACCCACCTCCTTGGCTGGCCCCACGTCAGGCAGCCTTCCAGGAGCAATTGGCTTGTG
AGCTCTGGCCCCGAGCTCGTCCTTTGCACCGTATTGTGTGTAACATGCGCACCCAGTTCC
CTGACTTGAGGCTCATCCAGTATGATTGTGgtaagtttgttgttaagtaaggatcccttg
accttttttttcctctcctactagcaaggctgccatatcaaagggatgctgtatataaga
tttttgtgaatttcattaaacagtttttcaggttatacttagaggcaagataaagaaatg
taggccttatgatggattcttggcattcatgaatttgactgatgaaagttgaaaatttgt
gctaactcattcagtggttcagttcattcagtgattattttgtgagtatatattgtattt
tgctaatcatttgggatgcagtggtaaataagatagcctagcatagagttttcaggttca
tgggaaaggtgcaaggtggtagaagactgcacagtaaataatagttttggggaaacacaa
ggatcttcttgtctttggttagaatcctgttggttagaatgcatttggctgcaggtaatg
gaaaactgaccagtagtggttttaaccacaagagcgtttgtttacttgttgagaataatg
gtatgtgactggttcagctttttgatgtcttcatggacccaggaccttctggtctttctg
caatccttaggttttatctttttattctcttgagtatttcttgatggtcttactatggct
gccacagttctagggagcacagcaatcctctgagcaggaagcagggcttgagataaaata
ctctcagcaagtttcccttttaggggtggggagaaagttctcattgactgtgcttcacaa
ctctctgccttaatttgtgctataggcccatccctagaataaccactgataaagggaaat
ggcaaagaggaactatggcttatttagactgatcatgatttatctgttggggttggtttg
gggtttctcgtccctgggatcagaggatccttgccaggtacctacagtgtaaattgggtt
ctgttaagtaagaatatcttttgaaaagtagtgaattgtttctgccacaaccctgcagag
atattattatagtaacatgtttggagatttcctaagtggtcttagaacgtaagacagcaa
aatactgggatgcctgggtagctcagcagttgagcttctgcctttgactcagggtgtgat
gccagggtccaggattgagttctgcatcgggttcctgcagggagcctgcttctccctctc
tctttgtgtctgcctcattctctctctgtctctcaggaatacataaatctttttttaaaa
accagaaaaatatttttattactatatatgtactcagtattttagtaaataattttgtga
catttgaaaaaatataattttgtaacatttgaaaccatttagagtagatgaattgaaagt
ctttgttaaaagcattcaaactgatttattagaaacattgcagggttgtttctgtgtttg
atggggaggttgaactaaagataacctcataagatcctctttccatggttctgatctcag
tgatttttcaatccctgtatgtaggtcatgacagccaaaagatgttgttgatgcctgtcc
tgtgaatgttttgtgttttagctggcataactgagtgtagtacttaaggatttccttcct
gcttatacaccattaagggttccttttttcctcccaagggtctatatgttttcctactct
tggctagatgcagaagtgagatccaagacggaagcagactgaagaggggaccccataagg
gaagaaaaataaagttaaaacaatttttttaaggtttagttaattttagggagcatggac
gttcacacctgtgtatgagtgaagagggggaagagggaacctggagctggctctgagatt
acaacctgagctgaaaccaagagtcagataatgaactgcccaggcatccctaaagttaaa
tagttttgatctcttaggctaattgaaatccccacctgaatccccacttattatctttca
actacagtcttccagtgctaagtgttctccctattccagcttatagcaagctccctgtac
cccttcatatttcttcagGAAAGTTGCAAACATTGGCAGTGCTGTTGCGACAGCTAAAGG
CGGAGGGCCACCGGGTGCTCATATTCACCCAGATGACCCGGATGCTGGATGTATTGGAAC
AGTTTCTCACCTACCATGGCCACCTCTACTTGCGTCTGGATGGGTCTACTAGAGTTGAGC
AGAGACAGgtaacctgggcatctgcagcccttcgaggttcacatcagctactgtctccat
tttccagacctcagggttccagaaggggacccactaagcctttggtctgtttggggggga
tatgtttcctgataatattttttttctttttctctagGCTTTGATGGAACGATTCAATGC
AGACAAACGCATATTTTGCTTCATCCTTTCAACTCGGAGTGGGGGTGTGGGTGTGAACCT
GACAGGAGCAGACACTGTCGTTTTTTATGACAGCGACTGGAATCCCACCATGGATGCGCA
GGCCCAGGATCGCTGCCACCGAATTGGCCAAACCCGAGATGTCCACATTTACAGgtattg
cctagtttcccctcaacttgcatcctctttactgataggctttattaatgtatttgtcta
tttatacatggctttcatcattccttagACTTATCAGTGAACGGACAGTGGAGGAGAACA
TCCTAAAAAAGGCAAATCAGAAGAGAATGTTGGGAGACATGGCCATTGAGGGAGGCAACT
TCACCACAGCCTATTTTAAACAGgtaccaagatcttccagtctaagcaggaaggcataga
gaactgctatatgtcgctaggggttgttcctgtttattaaagaggatactggggcttctg
ggtagttcagttggttaagtgtccatcctgctgttggtttctgctcaagctgtgatttta
tgggtcatgagattgagcccggcagtgggctctgctctcaacgggcagtctggcttgaaa
gattctcttcctgtgcccctcccctcatgtgcgtgtgctcactctttctctctaaaataa
ataaaccttttaaaaaataaagaggatgttttggcctccacagatctttctcttcaagta
gtggcattttttttaagatgttatttatttattcatgagagacctagacagagacataga
gagagagaagcaggctccatgcagggagcccgatgtgtgggactcaattctgggactcca
ggatcacaccctggactaaaggtaggtgctcaaccactgagccactcaggtgtcccacta
gtggcatttctgattactactacttttttttttcttttcttttgaagattttatttattt
atttaacagcacaagcagggggatcagcagagggagaaagagaagcaggttccctgctga
gcagaaaacccaatgcatgcaggactcgattccaggactctgggatcatgacctgagcca
aaggcagatgcttaactgactgagccacccaggcaccccattctgattacttctaagcta
ttatctcatagatctgggccatcattgcattggtgctgacacttccctctctctccaaag
CAGACCATCCGAGAGCTGTTTGATATGCCCCTGGAAGAGCCATCCGGCTCATCTGTGCCC
TCTGCCCCTGAAGAGGAGGAAGAGACTGTGGCCAGCAAGCAGACCCATATCCTGGAGCAG
gtgaagaaagaacaggcaatctctagggtagagctaatagttacagtgtgggttttccag
agggaaagaatgttttccgctgcttcccagatggctgttggcctttgatatttgtgagta
gattgtttattgtttcataagacttcatagaagaaagacaggatttgaaattcttggtta
taggtttgaattctaacagtacttcttactaaaatgtgtctgttaagccaaatctgctta
attttctgagcctggaatcttttcacttttctgaactgttcatggaagaaagtaacaaac
actgactgataataataggatcacttgggaagccctttttgtttttttgttttgtttttt
gtttttttttaattaagtaggctccatgcccagcatagggcttgaactcacatctttgag
attaagttgtacactctactgactgagccaggtaggtgccctggagagcttttaaaggat
tgattctgggatcccatctgagaatctactgtcatttgagggggataaagggtgggtgtt
tgtattttttcagaagaagatgtttaggaactacaggtgtacagtaccatggagatgttt
ttccctaccaagtgtcttctcctcattgctgggcacaccgtaggttgcatcccttgatga
cttcggtgtgacctttctggatattcatcatgggaaaaatcaggtgtggttagtctgttg
tcaagagatatctcagtgcaaaaaagaatgagggatttttttgtatctaaagctttgtgg
gactgctctttttaagatcttagtctaacttgcatggaaaaggaaacagagctagagatt
tctcttttttttttttttttttttaagtttttttgttttttatttatttatgatagtcac
acagagagagaggcagagacataggcagagggagaagcaggctccatgcaccgggagccc
gacgtgggattcgatcccgggtctccaggatcgcgccccgggccaaaggcaggcgctaaa
ccgctgcgccacccagggatcccgagctagagatttctaaaaacagttcttactgggggg
cctccaggtgaaatctgtttcatcctctgtggaatactgcattgctttgataactttgag
ggctgagaagggagttgagcttagttgtaagcctggtttggtgttaacttgtcctttaat
ttttgccagaaccaaaccaaaggatgtaggattctttaattttcctggtttttcttcccc
acatctttgcagGCACTATGTCGTGCAGAGGATGAAGAGGATATCCGTGCAGCCACCCAG
GCCAAGGCTGAACAGGTGGCTGAGCTGGCAGAATTCAATGAGAACGACGGGTTTCCCACT
GGTGAGGGAGAGGAGGCCAACCGACCTGGCGTGGAAGATGAAGAGATGTCCCGAGCTGAG
CAGGAAATTGCTGCCCTTGTAGAACAGgtcagtgttggacccactagttctcaacctcac
tcttcacaactacttcctctagactttgtgatcctccttctgtcttctctggtgaaaata
agggtgatgggccccggttaccaaacctgtatgttcatcactactgctccttcccacagC
TGACCCCGATTGAGCGCTATGCCATGAAATTCCTGGAAGCCTCACTGGAGGAGGTGAGCC
GAGAGGAACTCAAGCAGGCAGAAgtgagtatttctagggggtggggattgaagggggaag
tggctgctttctacccgctccccaccctgcttgcctccctctgaccacccactgtttggg
ctctcttggtagGAGCAAGTGGAAGCTGCCCGCAAGGACCTGGACCAAGCCAAGGAGGAG
GTGTTCCGCCTACCCCAAGAGGAGGAGGAGGGGCCAGGGGCTGGGGATGAGGTTTCCTGT
GGGACTGGTGGAGGCAGTCACCGGCGCAGTAAGAAGGCCAAGGCCCCTGAAAGGCCAGGG
ACTCGTGTCAGTGAGCGTCTTCGTGGAGCCCGGGCTGAGACTCAAGGGGCAAACCACACT
CCTGTCACATCCACCCATCATACCCGCAACATTTCCACACCCCCACGCTGCAGCCCTGCC
AGGGAGAGAGTTCCCCGGCCAGCACCTAGGCCTCGACCCCCTCCAGCTTCAGCTCCTGCT
GTAATTCCTGCCCCAATCCCTGTTCCAATCCCTGCCCCAATCCCCATTTCAGCCCCAAAC
CCTATAACCATGCTTCCTGTTCATATCTTGCCTTCTCCACCACTTCCTCCTTCACAGATT
CCTCCCTCTTGTTCTTCTGCCTGTACCCCTCCTCCTGCCTGTACTCCTCCACCAGCTCAT
ACCCCACCTCCCACCCAGACCTCTCTTTCAACTCCTTCCTCCCCTCTCCTGCTTGGTCTA
CCTTCTGTGCCCATCTCCCCCCCAGTCACAAACCTCCCCTTGGGCTTGGGGCCTGAGACA
GAGCTTTGTGCACAAGCATTGGCATCTACCGAGTCCCTGGAGCTGGCTGATATGGCCAGT
TCCGAGACTTCCCCGCTTACTCTTGTGCCCCCTAAGGATCTGTTGCCAGTTGCTGTTGAG
ATCCTGCCTATATCAGAGAAGAACCTTTCTCTCGCCTCTTCTGCACCTAGCCCAACCCTG
GAGGCTGACAGCGTCCCCAACGGTCAAGAGCAGGAAGTGCCAGAGCCTGCTGAGGGGACC
ATCCTCACAGTGCTGCCTGATGGTGAGGAGGTGCCCTCGTGTCTGAGTGAGAGCAATGGG
CTGGATCTCCCACTTTCAGCAGCATCTGATGAGCTACTTCAGGAGCCATTGGAGGCTGAC
AAGAGCTCAGAAGAGCTGGTGGAGGCCCAGACCCCAACCTCCAGCCCAGAGAAGCCACAG
GAACTTGTTTCAGCAGAGGTCGCAGCCCCATCCACCTCATCCTCCGCCACCTCCTCACCT
GAGAGTCCTTCACCTGCCCGGCCCCCTCGGCGTCGCACCAGTGCTGATGTAGAAATTAGG
GGTCAGGGGGCTGGTCGGCCAGGGCAGCCTCCAGGCCCCAAAGTTCTCCGCAAGCTGCCA
GGACGGCTGGTGACTGTGGTAGAGGAGAAGGAACTGGTGAGGCGACGGCGACAGCAGCGG
GGAACTGCCAGCACCCTAGTGCCTGGGGTCTCTGAGACTGGTGCCAGCCCAGGAAGCCCA
TCTGCCCGCAGCATGTCAGGGCCAGAATCCTCACCTCCCACCAGTGGGCCCTGTGAAGCT
GCTCCCCCATCCACACTGCCCACCCCAACTCAGCAACCCTTCATAGCTCGCCGTCGCATT
GAGCTAGGGGTGACTGGTGGGGGCAGCCCAGAGAATGGAGAAGGGGCACTGCTTGCCATC
ACCCCTCCTGCTGTGAAACGTCGGAGGGGGAGGCCCCCCAAGAAGAACAGGTCTCCAGCA
GATGCTGGGCGAGGGGTGGATGAGGTACCTTCATCTGCCCCTAAGGGAAAAACCAATGGG
GCTGACCCAGTCCCTGGGGCCGAGACCCTTATTGTTGCGGAGCCTGTCCTGGGACCCCAG
CTTAGTCTTGGACCCCAGCCAATTCACAGACCCGAGCCCATCATCCTATCACCTGTGGAG
AAAAGAAGGCGTGGGCGGCCCCCTAAGGCACGAGATTTGCCCCTTCCTGGGACCATTTCC
TCTCCAGGGGATGGCAACTTAGAGAGCCGGACACAGCCACTCCCGCTACCACCTCCCCTG
CCACCACTCCCACCACTCCTAGCCTGTCCCACTGCTACTGTCGCCAACACTGTCACCAAT
CTCACCATTTCAACATCCCCACCCAAGCGGAAGCGGGGCCGACCTCCCAAGAATCCACCG
TCACCTCGGCCCAGCCAGCTCCCTGTCTTGGACCGTGACAGCTCTTCTGTCCTTGAGAGC
TGTGGATTGGGGAGGCGGCGGCAACCCCAGGGCCAGGGGGAGAGTGAGGGTAGTTCCTCT
GATGAGGATGGAAGCCGCCCCCTCACCCGCCTGGCCCGCCTGCGGCTTGAAGCAGAGGGA
ATGCGGGGACGAAAGAGTGAAGGGTCCATGGTGGTGGCTGTAATTCAGGATGACCTGGAT
TTAGCAGATAGCGGGCCAGGCGGGTTAGAATTGACACCTCCCGTGGTCTCGTTAGCTCCA
AAACTGCGTTCGACCCGGCTGCGTCCAGGGTCTCTAGTCCCCCCACTAGAGACTGAGAAG
GTGCCTCGCAAACGGGCAGGGGCACCAGTTGGCGGGGGTCCTGGGCTGGCAAAGCGGGGC
CGCTTACAGCCCCCAAGTCCCCTAGGGCCTGAGGGTTCAGTAGAGGAGTCTGAGGCTGAA
GCCTCAGGTGAGGAGGAGGAAGTAGATGGGACCCCACGTCGCCGGCCTGGCCCCCGCCGA
CTTGGTGGGGCCACTAACCAAGGGGACCAGCGCATCCTGCGCAGCAGTGCCCCTCCCCAC
CTGGCTGGCCCTACCATTAGTCACAGAGGCCGAAAGGCCAAGACGTGAGTGGGCTGCCCC
TCCACCTAGGCTTTCCGCCATGGCCCCTCTCCCTTCACAACCAGGCCTGACTCTTAACCA
CTACTTGAAGTCTTTTGAGGGGGGAAAGCCTCCAGGGAGACATAGGGGCCTTCTCCCTTC
TTTCCACCAAAGTAGGGGGTAGGCAACTGGTTGTCATGGAAATGGGGCTCTTCACATAAC
CCCTTCCCTTCCACCCCACATGGCTGGGCAGTGTTAAGGGTGGCAAGATAGTCTCTGTCC
CCACCCCCTTGTACTTGATTCCCCAGCTATCTTTCATGGCCCCTCACCCTTAGGGGAAGG
GGGAGGGGCTTCTCTCTACCATGAGTTTTTTTTTTTTCTTTTTTTTTTTAAGAAGAAAAA
ATAATAAACTTAGTTTCTGTATGAGCAtccgcgtaaggaggcttctgattttctggtctg
gtggagggttgggtgggaacttgggcatcatttttctcctctctcttgttcttgccaaaa
ccctagtacctgatatctgacccagaattatgtgtctttgaggcagaaatcacccaaggg
gaggaaagattggcatatctgatctggtagggttccttttcctaaagtttctgttttaag
tctctccaactcatacttttttctctcctcctattcccttagttcctggactcccccaga
gctctctgatgcctcagacttttttcctgctttacccctttgctcaggtgctttcactcc
ttttccagaaggcaggcatcttacctccaattgctctatcctcccccccccccccacctt
tgctttcctccatccagccaaactagtttgagtcagccacacccccttccaagctcccgg
ggcctttcaggtggtggctggccacccaaccccacccctgggcttggtttggagacctga
gtcagctccatctccacccaagccaaatcaaacctgaggcaggagccgaaactcacagtc
cctcaaggcctatagacaggtaagagcccctgttcatttttacattttctttgatctcaa
ctccctggatgctctcattgcattttccccctaatgactatgtttacctcatcggttctt
tcctcatacccactctcctgcagccttgtggcagagattctttgtgctctgcttatcttg
cctcctttatttgactctctgttgcttatgttcagagaactgcaaatggttctattttat
gtaggtcgtagggatggttggagatgagggtggaaagatggtttgatgccacagctcaag
agaatttgagaagttagtagatgagaaatgattagagcatcattatgcaggtttctgtgt
gggttatgaggtcatagagttatctgaattaattgtgtggcctgggttaaaatggagaga
gtaacag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 2334..2407, 3004..3266, 4795..5046, 7460..7645, 7883..8023, 8796..9018, 9134..9411, 10047..10137, 10277..10366, 10847..11035, 11120..11448, 11552..11729, 12473..12609, 12835..13004, 13120..13312, 15309..15445, 15535..15721, 17193..17362, 17744..18009, 18218..18505, 19008..19172, 19452..19637, 19856..20122, 20465..21054, 21180..21701, 24745..25010, 25147..25349, 27378..27547, 27697..27893, 27988..28102, 28920..29039, 30312..30506, 30659..30742, 30852..33926
3213..3266, 4795..5046, 7460..7645, 7883..8023, 8796..9018, 9134..9411, 10047..10137, 10277..10366, 10847..11035, 11120..11448, 11552..11729, 12473..12609, 12835..13004, 13120..13312, 15309..15445, 15535..15721, 17193..17362, 17744..18009, 18218..18505, 19008..19172, 19452..19637, 19856..20122, 20465..21054, 21180..21701, 24745..25010, 25147..25349, 27378..27547, 27697..27893, 27988..28102, 28920..29039, 30312..30506, 30659..30742, 30852..33527
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved