Canis_familiaris Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Canis_familiaris EEF1B2
Canis_familiaris
EEF1B2
37
SNORD51, SNORA41
2802..2879, 3171..3303
4834
AGAGAACGTTCCCTAACGAAACAACTTGGATGTTTATTCATCAGAAACAGTTCACATTT
TCAATGCTCTCCAATCATTCTGGAGCACAGCCGGGCCTAATCCACGCTCTTACGGTACAT
GTTAGAGCCCCACACGGCTGAACAACGTAGCTAGGTCATCTGCAGTGCGACCTTGGGCAA
AGGTTTTAAATACCATTTTCCTCAGTTTAACCCACCAGGGAAAGGAATAAAAAAATAACT
CAATGGACAAAAATGAAAACACAACAACAACAAAAATCCCCAGACGCATGGACGGCTGCT
AAGGCAACGCCGGCCAACGTCTGGATTATGTGTGTTAACTTGGGAAACCGCTGCCTTGAG
GCCTAAGTCACTTGACAGAGTCCTCTCCCGGGAACGTCCTGCGTCTCCCTTGCAGAAGGA
AGGTCACTCCCACGCCTGCCTCCGCGCCCGCGGTCCCAGGGCCCCCAGGCTCCCCACCTG
CCTTCCGCCCCAAGAGACCGGAGACCGCGGCCAACGGCGCTCACCTGCCGGCCCCGGGGG
TCCCGGAGGAGGCGGGCTGGGACGCGGCGCCCAGTCAAGGGCAAGAGGAGGAGGAGTCGC
CTGGCCTACAAGAAACCGTCTCGTCAAGAAGTCCACTCCTGTGGCAAGGGCCACCTCAGC
CTTCTCCCGCAACCACGACCTCACCTTCTCGGCGGAGCCGCCAAAGCCGCTCTGCAGAAC
CGCCGCACCTTCCCAGCCCCCTCAGAGGCCCGATTGCTTATTCAACATGGCGTCCTCGGC
AAACCTCGCCCGCCGGCCCTGGAGAACGGGAAGCCAGGAGGGACCAGAAACCTCAGATTC
GAGAATTTCCCGCTTAGCGCGAGTTCGGCAATTTCCGGCAGCCGGACCGGGGGGCGGGGC
GGAGGCGGGAGGCGGGAGGCGGGAGAGACGGTTGGGAACCGCAGTTCCGCCGGAAGTGGT
CGGGCGCCTGAGGCCGAGCGTCTTCGGTCACCTCCGGCGCTTCGAGGGGCGGTTCCTGTA
GTGTGCCGGAGCCGCGGAGGTACTAGTTTAAGGAATACTCTTTTTATTAGCTTATTTCTA
AACACAAAGAAAGGCCGCTGGATAATTTGTGCGCCGTTCAATGCGGAGCTTCCGAGTTTT
ACGTGGAGGAATGAGGCTGTTAGAGGACGTTGACCCTTAACCTTTGACCCCGTGCGGCAG
AAGGAAACGCCTCCGTCTCTATATAAGGCGTTTTCCGGCCTTTTGCGGCCCTTTTTTCCT
CTCCCCCCTCTTAGCGCTGGGCGCCGGGTGCCTCCCCTCTTCTCTTCCTTCGCTGCCGCC
CGGTTCTTGGAGCCGCCGACGCTATGGGTTTCGGAGACCTGAAAAGCCCCGCCGGCCTCC
AGGTGCTCAACGACTACCTAGCGGACAAGAGCTACATCGAGGGGTGAGGACGGGCCCGGG
CTGGAGCCGGGCTGGGCCGGCCACGTGGCGCGGCCTCGGGCGCAGCTGGGGGCCGAGGGC
TTCCAAGGGCGCCTTCTTTGCGTTGACTGGATTCAGCCACCTTTTCCGCGTCTTCGCTCG
GCCCGTGGACGTAAGCCCGTAGGTCTCCGTCAGAGATGCGAGCTCTGAGGTCCACGACGT
GGCAGGGATTCCTCGGGAGAGGGCGGAAAACCAGACACATGGCCCCCGATCTTGAGTTTA
GCGTCGAGAATAAATCACCTTAGGTTGCCCAGTGGCAAATGGGCCAGCTCCCAGCGCTCA
GCTTGGTGGCCGTGGCGCTTGGCCCCTCCCCTCAGGGCGTGTGTGACTTGCCTCCCCGCA
GGTACGTGCCGTCACAAGCGGATGTGGCAGTGTTTGAAGCAGTCTCCGGCCCCCCGCCTG
CCGACTTGTATCATGCCCTGCGTTGGTACAATCACATCAAGTCTTACGAGAAGGAAAAGG
CCAGGTAAAGTGACCTGTGTGTTTACCTGAAGGACAGGAGGCTTCCTAAGCTTCAGGTCA
GGATCTTTCACGTGACAAAATTGGACCCAGGCTACGTGAGTTTTGTTGGGGTGATGTAAG
CTGAACTAGCTCTGTGACTTGAGAAGGCCGAGAGACTGAAGTCCTGCATTTTTTCACAGA
ACACGTAGAACCTGGACCACAGCAATTCAACTTTTCCCCACACTGCCCTGACACTGTGCC
CGGACCCTGACCTGGGGGGCCCGCGTCCGGGGTGAGAGGGGTGGCTCATTGATTCAGTCC
TTGGCCATTCTTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGTGGACTCCAGTTC
ACTAAGAATGGAACTGAGCATACTTAATCTCAAACAGAAATACTCATACTGAAAGAGTAA
ATCATAGTGAGTATCGAACGTAATGTCTCACATGCTGCTAATGTTTGTTGGGTGAGGAGT
TAAACACACAACAGTATTTACCTGGGAGTGTTTACGGGCAAATTCTTAGTACCTAAGGGC
TCTTTGGATAGTGATGGAAACAAGTTCTCGTGTACTGTCTGAGAGTTTACCAGCGTAGTG
GTGGTTGAACTTATAAGTTTTGTTTTTTTTTTCCCCAAGCCTTCCAGGAGTGAAGAAAGC
TTTGGGCAAGTATGGCCCTGCTAATGTGGAAGACACCACAGGAAGTGGAGCTACAGATAG
TAAAGACGATGATGATATTGATCTCTTCGGATCTGATGACGAGGAGGTATGGCATAAGTT
GGTGTGTAGATCGATGAGCTTAATCATAGGCTCTGTGGTGAAATTGCCTGGATTTGAATT
CTGGTTTCACCCACTTCATGACTTGACTTATAAAAATTCTCACTGGTTATATGATGAATA
AAATCAAATCACCATCTTTCGGCTGAGCTCCTGATGGATTTGCTTTTTCTGATAAAACTG
GTCTTTGTTGTGATGGATTCACTAGCTTAAAGCTGAGGAACAACTGTCTTTGTGAAACAT
ACTCTATTTTTCTTTATAGGAAAGTGAAGAAGCGAAGAGGCTAAGAGAGGAACGCCTTGC
ACAGTATGAGTCAAAGAAAGCCAAAAGTAGGTCATTTTTTTAAAATTTGTGCTGCTTTAA
TTTCATTTCATAATTGAGTAATCTTTTGAAGCTTGATTCCCAAAGTAATTGCCTCCACGT
CATTGACTAGTTCAGTATTTAAAAATCTGTATACGTAGTTTTTCATAAAACTTCCACAGC
TACTGGTCTGCAGCTGTTCTTACAGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACT
GTTATGCAATTAAACACCTCTTTCTTAGCACAACGGAAAGTGGGCATATGAGTAACAAAC
ATAAGTTGTATTCTGTAGTTTTGTTTGAGATGATCCATTAAGAAACATTAAGATTTTAAG
GGTGTCTTCAACTAAAGTGAAAAAACATCACTGGGTGTCTGAATAACGTTGGTTGTACCT
TTTTACCTTTTTTTTTTTTTAGAACCTGCACTTGTTGCCAAGTCTTCCATATTACTAGAT
GTGAAACCTTGGGACGATGAGACAGATATGGCAAAATTAGAGGAGTGCGTCCGAAGCATT
CAGGCAGATGGCTTGGTCTGGGGCTCTTGTGAGTTCAATCTTTGCTTTTTGAAAGTGACA
TCTGGAAGCTGCACAGTTAAAATGTTTGCCAATCAATAGGGCTTTGCTAACTAAGATTTT
TCTTAATGTTCTTTTCAGCTAAACTAGTTCCAGTGGGATATGGAATTAAAAAACTTCAAA
TACAGTGTGTAGTGGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCGGATCACTG
CTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTTAATAAGATCTAAAATTACA
TCGTAGATCATTGTCCTTAAATAAAAGCTTAAAAGACAACCCTTGGCTCTTGACTCTTAC
ATAGGGTAGTTTTTATATTCCATTTTGAAGGAAGAAATTCAATTCAATTCACAAAAAATA
TAAATTTGGATTAGCATTTTTGTATTTAGCCCAAAAGGGAGGACAAATATCTTTCTAAAT
ACTATGAATTCATATAGTTGTTGAGATTTTATGAATTGATAAATAGAAATGGACTCCATC
TTCGTATGTTTTCTGCTGTCCGTGTACAGGAATTTTTTTTTAAAGATTTTTTATTCATCG
AGATGCAGAGACACAGGCAGAGGGAGAAGCAGGCACCATGCAGAGAGCCTGACGTGGGAC
TTGATCCAGGGTCTCCAGGATCACGCCCTGGGCTGCCCAGTGTACAGGAATATTGCTTTT
ACCATAGTATTGCAAATTTCCCATTTGTTTTATTTTTTTAAGATTTTATTTATTCATGAG
AGACACAGGCAGAGGAAGAAGCAGGCTCCATGCAGGGAGCCCGACGCTGGACTCCATCCT
GGGTCTCCAGGATCACACCCTGAGCTGAAAGCGGCGCTGAACTGCTGAGCCACCCGGGCT
GCCCTCATATTTGTTTTAAATAGAAATTAGATAAACTTCACTTGTAGAAACTGTGGATTC
AGAATTTCAACTAGATTTTTAGTCCTGTAGGTTTGCAATGGTTCAGACCTTGGGCTTTTT
GCAAGGAGTAATCTGGGCTGGTTTTCCTTGATGGGAATATTAGGGAGTACCTTAATGATG
AAAAATGGGTCTATACATGTAAAATGTGTAAGACACTACTGGCCACAGTGAATGTCCTTC
GTTGGCTGGAAATAGTTAGATGGCCCAATGACTGAAGTAATTTGTAGTTATCTAGGATCT
TCAAGTTGAGTGTTTCTCCATACCGAAAAACCACACAATTAAAAATCCTACTTGAGGGCA
GCCCGGGTGGCTCAGCGGTTTAGCGCCGTCTCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1274..1422, 1801..1923, 2559..2685, 2959..3025, 3442..3567, 3678..3834
1343..1422, 1801..1923, 2559..2685, 2959..3025, 3442..3567, 3678..3829
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved