Canis_familiaris Locus UAP56_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris UAP56_CANFA
Canis_familiaris
UAP56_CANFA
12
SNORD83
1723..1797
13732
GATATAATAGAGAACAAAAGGTATTTGTATCCTGGCTTTGTCAGCTTACTAGCTGTTTG
TTACTTTGGACATGCTGCTTCGTTTGCTTGTTACAGGCTGGGACTAATGGTACCTATTCC
TTAGTGTTAGATGATTAACTGTGGTCAAGGGCCAAACGTTTGCTGTCATTTTTGTGGACA
TCACATCTGACTTATCTAGCATATCAAAGACGGGGGTATCGAAGGTTTCATTCAGGATAA
AATTCAAGGTGAATAATGGGGCTGGCCTGCTGGAGGCGGGGTTGGCGACATTCTGATTGA
AATAATATTTATGGGATACTGCGTAACCCTCGAGTCCTACCATTTATTTTTAACACCTGG
AGACGATCCAACCCGTTGGTTGCAGAACACCTTCTTGACTCGAATTTCCTGCCCATCAGT
CAATTACACCGGCCAAATTATTTTGGGAAGACACCGCCCACCGTCTCCACCGCTGGGGAA
GGGGTAGGGGAGGACCCGCGGGCGCAGCGCCGGCTCACTCCCTCCCCTCAGCTGGGGTCA
GACTAGCTCCAGCGAGGACGCGCCGGTCACCTTGACTACCGGGCGGAGGACCCCGTGGGA
ACTCTCAGCCCCGCCAGCCTGTTGCCGAGCGGGGCGCCCACGGAGGGGTGACCAGAGAGA
AGACCTGCCGGCAAGAACCCGAGGGAAGAGGTGAGGGACGCGGAGTGGACGAGGACAGAG
AAAAGAGGTAACAGTGGGAGACGATGCTAGTTTCCTTCAAGGCTTTTGTTACTTGCAGTA
GCGAAGGAGTTAGAAGTGCCTTTAAAAAAAAAAAAACTCACACAGGCGTTTTCTAAAGGC
AACCCCGGAGCGCGCGGAACTCTCGAATCTGAAAGGGTCTTCTTCCGGTCTCCTGCGCCT
GCGTGCTGGCAGGCGGGAAGGCGAGGCGCCTGGGAGAGAGAAGGCGAAAACAGGAAGTGA
AGACAGAGTCCCTCTTTCGTCGCTGCTGCCGCCGCCATATGCGCTCGCCTTGCTCAGGTA
AGCTTTGGCCTTCGGTATCATCCGCCTCCATCTGCGTTTCTTTGCGGCCATCCTGTTCCC
TGGACTCCTGATACCCCTTCCACAGGCTATAGTCTGGTCCTTGGGGCCTAGTTGGGTCAT
TATTTCTATTGCTTGCATCCCTTTTCAGAGCTCTTAAGAGTTTCTGGGGGGGGGGGTAGC
GATGCTAGGGGGCCCAATCCAAGATGGTGGCCCCAGCGCCATTGTGTTCCCTTCGCTCAC
TGCTTCTTCGCTTGGGCTTCTCGTTTATCCGAGGCCCTAGCTATGGTGAGAGGCGGCGTA
GATGTCCTCTAGTCCAGGGCATTTGCGGAGGGCGGGGCTCCTTTCACTTTTCCTCTCTTC
TGTGGGTCCTCTTAATGGCCCAAGGTGGGAACTGGAGGAGGAGCCGACTACTGAGCCTGG
TTGGACCCTTCTGTGAGCTCACCAACCATCACTTGGAACATTTTCCACTTGTTCATGCGT
GGTGTCATGTCGGTTATCGGAGAGGAGTCTGATCTGAGGAGTAACAGAAGACCCTTTGCT
ATAGTTCCTGGTAGAGCTGGAGCGAATGCTGTCTCTCTCTCGTTCTATGGAGAAGAGACG
AGTACTTTCCCGTCCCAGCCACGTCTTCTGTATCCCCTCCCCCACGTTACACGGGGACCC
CTTAGACACCGGGAGGTTCCTGAGGAGTGGGAGGTGGATGGCAGCCACATGATGTTATTT
CGAGGAGTGAGCGCTTTGCGCTAGGATGACCTTAATCTATCACCAGTAACTGATGGCTGC
TTTGTTAGGGAGATTACCAGGAAAGCAGAGAGGTCCTGTGAGGATTTTCAGCACTTACCT
TGTCATCTCCATTCTTCACTCCGTTGTCCTACTTTGCTTTTCGTTACCCGTTTTTCTTCA
TTACTGTTGCTTACAGATGAGGAATTCATGGGCTGGTTGTCCCCTTCCTACTTCCTGCTT
AATGCTATTCTGATCCTAATTTTGTTGAAAAGTTGTGTCTCAACCACCTCACTTGGGACC
ACTGTGTTATGTTTGCTGTTGCTTTTATGTTTTGTGTTCCTGTTAGTTTTATCCCCAGGT
AAAGGGGTCACAGTTTAGGGAAAGTGGGAAGAGTGTGGGGATGGAAAAGAAGGGCGAAGG
CTCTGCTCCTGACTAATAAGTCCTCCATCTATTTTTTTCCTAGCTCTTCTATCACAAACT
AGGGTATTTTTTTTTTTTTAACTGTTGCTCCAGCCCCCACTCTCCTCCTCTGTTTTTACT
TATTCTGCGTGAACCCATCCAGAGACCCATCTCCTTCTCCCCCTGCCGGCCCAGTTATGG
CAGAAAATGATGTGGACAATGAACTCTTGGACTATGAAGAAGATGAAGTAGAGACAGCAG
CTGGGGGAGACGGGTCTGAGGCCCCTGCCAAGAAGGATGTCAAGGGTTCCTACGTCTCCA
TCCACAGCTCTGGCTTTCGTGACTTCCTGCTGAAGCCAGAGTTGCTCCGGGCCATTGTTG
ACTGTGGCTTTGAACATCCATCAGAAGGTAAATTTTCTGCAGGTCATAGTGTTCATTAGG
CTCTCTAAGGATACAAGAAAAAGGTGTGTTAAACAGTCACTTAATGTAATAACGTTCTTA
TTTAGGCTACTTTAGGAAATAAAGGTCAAAAACTATTTCAGCAGTAGGAAAGATTTATAT
AGATTGGTTTTTTTGTTCACGATAACATGAAAAGGCTAGTGACCTAAAAGCAACTTAGAG
GTTTGTGCTTGTGACCAGCATTTATTCTTGTCTACTTGTTATTAATTTTGTTGTTTAGGT
TTCTAAATTTGAATTTCCTGAGAGGACTGGTTGGACCTTTAGTCTCTCCCTGTTGGGCCA
GGCCACCTCTGGTCTCTGGAAATCTTCATAGCTGGTCTAAAATGGGTGGCTTCTGGATCA
GCTACCAACCCCTTCAGAGTTGCAAGGTTTTGTAGCCTTAAAGCAAGGGAAGCTAAGTAG
GAGAAATGGCTTGGGGCAGGCAGTCACATGTCCTGGATTGTTACAGATCAAGGAAAGTCG
GGACAGAGTCAGAAGCACCAAAGGTGAACTGTTGGTAGGTGCAAGAGGGTTGTTTGCAGT
TTGTGGGGTGGGGGGAGGGCACTGGAGTTGGAGGAGGCTAAAGCTAGAAGGAACTAGGAA
GGTCTATCTGGTTTTGAGATAAATCTGAGGGAGCAGAGAGGTAGAAGGGGTCTGGAAATT
GATAACCATTTAAGAAGGGGTGGGAAATGGGTTTGACATGGTGAAAAAAGGTTGTGGAGT
TATCTGGAGACTGAAGTCTAATTTATCTTTTTTCTCCCCCTGCTTCTAGTCCAGCATGAG
TGCATCCCTCAGGCCATTCTGGGAATGGATGTCCTATGCCAGGCCAAGTCAGGGATGGGA
AAGACAGCAGTGTTTGTGCTGGCCACACTACAACAGTTGGAGCCAGTTACTGGACAGGTA
CACTTGGGGAGAGTGCTATGGAAGACATTTTTGGTTAGGAATATTGGAGAAGGGTGTTTT
GTCTCAGCTGTGTGATGCTTTTAGAGCCATGAGTGTTTGTGGCTAAGATGAACTCTGTCA
CCTTTGACTGATGGCCCTGGGGGATATTACATAGTAATCATGGGGTTAATGGTTTAGATC
TCAGAATTGAAGTAATTTATGATCTGTCAGATGTGCTTTTGTGACAGTTGGTTCCCCAGA
GGGGATAGTAAGTATATACTGTTTATCTCCATGTACTCCCCCCTCCACCCAAGGTGTCTG
TGCTGGTGATGTGTCACACCCGGGAGTTGGCATTTCAGATCAGCAAGGAGTATGAGCGCT
TCTCTAAATACATGCCCAATGTCAAGGTAAGCCAAGATAAACCTGGGAGAGTGTGGGGAG
TTGGAGACATTGAAGACTTGTAGACCAGCAGTCTTCATTTTTTCAGATGATTAATTAACT
TTATATGAAGGTCATTTACTTGTAATAGCTGGTCAGTTTCTGCAAACTTTGGTGTGCAGG
AGATTTACATTCTATGGTTTACTTGAATACACATTGCAATTTCTGATATGTTCACTATAT
TCCAATTTTGGAGAAGCTTTAGTTTGTTCTTAACACATCATGTTAATATAGCTAGCAGCG
GAAGACTGCATGGAATGGGTTCTGGAGGATGTTTACCACAGTACTACACTTGGGTTTACT
ACTTTTTTATACTGACTTTGAATGATTTCATTGTGCTTTGGTTGACAGTTTGAGAATTCT
AGGATGTGTGCAAGAGAAAGCTGGAAGCTTCAAAATATCTCTTTAAGTGTGTGGTGTGTG
AATTTTGAGGATTCTTTAAAATGGCAGAAAATTGAAAGATATTTAGGGGCCACAACAGAC
GAGGTTTGGGCGGTTTTCCATATATGATCTTGATTTTCATAGTATGGTTCCCAGACCTCT
AGTTAGAGCATCATTTGGAAGCCTGATGGAAATGCTGATTATATGGGTACCATCCCAGAC
CTAACTGAGTATAAACATGCATTTTATTTTATTTTGTTTTATTTTATTTTATTTTATTTA
TTTATTTATTTATTTATTTAATTTATTTTTTAAACATGCATTTTAATACAATCTTCAGGT
AATTGGAGTTTGAGAAGCGCTGATGTGTATAACCTCCTACCTTCCTGACTAGGATGTGGT
GAAAAACAGTACTTTTGTTTGGATTGTTGTGATATTCTCCTGTTACTCATGTGTTGAGTC
CTAGCCCTAAACTAAAAATAGTAATTCTTAAAAAAGATTTTATTTAAGCGAGCAAACACA
CACGAACGGGATGGGGTCAGGTGGGGAGGGAGGTCTAGGGAGAGGGAGAAGCAGACTCCC
CCTCTAAGCAGGGAGTCCCACATGGGGCTATATCCCAGGACCCCTAAGATTGGGACCTGA
GCTGACACTTAGCGGACTATGCCACCCGGGCACCCCTAAATTGGAAGTAGTCTTAAGAAC
CAAAGTAGTAATAAATAACAATGTGGGGGTAAACATGCAGTAAATATGCTGAAGTAATAG
AAGGTTCATGATGAAAAGATTTGTGTTCTCTTACCTCTAATCGAACTTCATAGAAGGTAA
TCATTTGTTAACCTTTTTTTTTTCGTTATGGTCTGTGACACCAAGTATTAGGTACTATTC
TCTCGTTTTATAACCTTATGAGTGTTTTTTATTTCTTTTCATGAGAGATTGGTTGCGATT
TTTTTTTATATTTGAAGATTAATTCTTTAACAATAATTTAAGTGTCATATCTCCTTATGT
TGTAGCTATCCTTAGCATTTCTTTTATGTCCTTTCATTGAGCAGGCTCGATGGCCTATTG
ATTCTAAAAAGTGGAAAACCAGAAAATGGTTTCCACTGTTATGACCATTGAAACATTTAT
TGTTGGGCTCATTAGTGAGTGAGGATTGTATTTTGACCTCTGTAGGTCCAATTTAGCAGA
TTATGCTGCTCAAAAGAGATTTTTTTTAAAGTTTATTAGTTTTTTTTAATCTCTACATCC
AGGATGGGGCTTAAACTCAAAACCTTGAGATCGAGAGTCACATGCTCTTCCAACTGAGCC
AACCGGGCACCCCAAAACAATATTTTTGGTGTTAAGATCAAATTGTCGTGACATTTTCTT
ACTTTTCTTTAAAATTGTGCTAAAGTGACTTGTCTGAGGTTGGGCTAGTTTTTTTTTTTT
TTTAACATTTTATTTATTTATTCATAGAGACACAGAGAGAGGCAGAGACACAGGCAGAGG
GAGAAGCAGGCTCCATGCAGGGAGCCTGATGTGGGACTTGATCCCAGGTCTCTGGGATCA
CGCCCTGGGCTGGAGGCGGCGCTAGAGGCGGCGCTAAACCCGGCACTAAACCCGCTGAGC
CACGAGGGCTGCCCAAGGTTGGCTAGTTTTACATAATATCCTACCTCTGGATTTGTCTGG
TTACTCCCTTATGGTATTAACTTGCTTTTTGTTTTTTTTTTTTTTTTTTTCAGTATTTCC
TTTAACTCAAATATGTATTTGAAAGCTCAACTAATTTAAGTTAAACATTTTTGGCAAGAA
TTGTTCAGAGTTGATACACTGTATATTTCCTGTTCTTCAGCAGACTTGGTTGTCCCATAA
TTAGTGCTTTTAGTTTTATCATAACAGTCTGATCTTGTAATTGATTTTTCATTCTTTGAA
GCTGGAAAGCAGTTTCTGGTGTTATTCGATACTATAATAATAAGGCTCAGATTCTCAACA
AATACTTCTGTAACTTTTTTTTTTTTTTTTTTTTTTTTTAACTTTTTAAATTTATTTATG
ATAGTCACAGAGAGAGAGAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATG
CACTGGGAGCCTGATGTGGGATTCGATCCCGGGTCTCCAGGATCACGCCCTGGGCCAAAG
GCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCCCGTAACGTTTTTAATACGGAGTAG
TATGTGTAGCTTAAATCAATAATTTGATAGGGTTTGTGCAAAAAGGCATTTGAAAATCTG
AGTTCAGAAGCACTTGGATGGCTTAGGTGGTTGAGCATCCGACTCTTGATCTTGGCTCAG
GTCTTGATTTCTGGGTTGTGAGTTCACACCCTGATTGGGTTCCACACTGGGCATGGAGCC
TACTAAAAAAAGAAAAATCAGAGTTTAGGAAAATTTGATGTTCTATGAGGCATTTTGTGG
TACTTTGCACTCTGGTGATTTCTTGCTGTCCTCTTTTTTTTTTTTTCAAGTTTTTTATGT
ATAATCTACACCCAACGAAGGGCTCAAACTCATGATCAAGAGTCACATGCTCTACTGACT
AAGCCAGCCAGGCACCCCTTGCATTCCTCATTCTTGGAAGTCTGGCCATAGCACTGTGGG
AAGGAAGATTATTAGATTAAGTCAGAAGAATGCTAGTCCTAACTACCTTGATTAGCCACA
TAACTTTAGGCAAGACACTTTTGTTTCTTAGCTTCAGTGTTTGGGAAACGTAATAAGAAT
TTTAGATTTGCTGACCTTTGATGTTCCTTTTAGCTTTGAAATGTTCTAAGAATTCATGTA
GATTAAATTTAAAGGGTGGGAACTGGGGAGATTGGACTCTTTCCTTGTGAGACCGTATTT
TCTCCTGGGTTAATACAGGTCGCGGTGTTTTTTGGTGGTCTGTCTATCAAGAAGGATGAA
GAGGTGCTGAAGAAGAATTGCCCGCATATTGTTGTGGGGACCCCTGGCCGCATCCTCGCC
CTGGCTCGAAATAAGAGCCTCAATCTCAAACACATTAAACACTTTATCTTGGATGAATGT
GATAAGATGCTTGAACAGCTCGGTGAGTGACAGTGCTGGGGTGAAGCTAGTGATCTGGGA
GTTGCTCTTTAGAGCCAAATGATGTTTATTTGATAGAGGAGCACTTTAGTGCCAGGACGA
CTCTTAATCTATCACCCATGACTGATGGCTCTGGCTCTCCTGTTGGTTTTTGTTAGGCTT
TTTAAGCAACCTTGGTGATCAAGGGGAAGGGTGTTTTGTCCTTTCTTTCTGTGATGGAGA
GTTCTTTTTTCTTTGAGGGGATTAACTTTGCTGATTTTTTAGACATCAGTCACACCACTG
TTCTTTGCCTTTATAGATTCTTATGCTGGGTAGATAAACTGGGGAGATAAACTGAAGGAG
GAAGACCATTTACTTTCTGGCATCCCCTGCACATATATCAGAATTTGTAACTGAATAGAC
TTAAGTGCTAGGATTAATGTGGAGAGTTTATGGGATTTTCTGTAATTCAGTGTTCCACAA
GAAAGGAAAATTGTAACTCACATTTAATAAATGAGTGGAAAATTGGAACTCACATTTAAT
AAATGAGGGAGTGGGGATGGACTTAGCCCCAGGGATAAGTAGTTCCAAGTGATCTTCGGT
TATTTTAGATGGTGAACTATAAGATGGGCTCTGGGTAGAGGTCTTATTTGCCTGGCTGGA
TAGGACAGTGATCCAGAGGAAGCATGGACTAGACTTTGACAACTAGAATATAATTATGTG
TGCAGTATTTGTAGACAGTTGGGGTGTGGGGAGAAAGTAGGGAGAAGGGCCTTGTAAAGC
ATCTCTCAAGGGTCTTAGGTTTGTGAGCCTCTGCAGTAGACTTCATCTCCATATCATACT
TGTGAGATTTGGAGTTTCATTATCTTCTTGCCTGGCTAAAACACATAGTGCTGAAATTTG
GTTCTAGGTCTTTATTTGAAATTTTCCATGTGTTACTGCAATGGATGTGATTTTACGGTG
GTTCGTGTAAATAGAGTACCTGAGACAAATCTTTGTGGGAAATGGCTCTTGCTTACCTGT
TTCCAGCAGTTTCACCTCACTGGGGAGGCTGTCTCCGGTCTTTGTCTATGACATTTCCTT
CTTTCCTTCTAGGATTTTTTTCCTTTTTCTTGTAGACATGCGTCGGGATGTCCAGGAAAT
TTTTCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGA
GATCCGTCCTGTCTGCCGCAAGTTCATGCAAGACGTAAATACCCTTCTACCTTCTCTCCC
TCCACTCCCCGCCCACTGCCTCCTCCCCTTCTGCGCCCTCTTCCTCCAGACTCCCTTGTC
CTTCAAATGCCAAGAAGGGGGCACGTGCCCATCTGGGAGTGATGACTCCTTGAAGAGACA
CACAGAGGCAGAGACAGCTAGTGTTAGGGTCTGCGCGGGTGCCAGGGAAACTCCGGAAGA
CTTGGTCGGGTTAACTTGAGAGCGGGTAGTGTTCGACCTTTTTTTTTTTTTTTTTTTTTC
ATCACAGCATTTTTGAACCTCTTCTTCCTTTTTGGGGGAGGGCAGGATTTTCTGCCCTAC
TACCCACCCATCGTCTCCTACATACCCCTTTACAGCCACGCACCCTCAAGGTGGCATGGA
GCAGACAGTTGGAGCCTTCTGCTCCCCAAAACTCAACCCCCCGGTGGCAGGAGAGCAAGA
GAGGGACAGACAGATGGCAGGGCATGTCCAAAAGAAGAGCAAACAGCACAAATGAATCCG
CTCCCTCCCCACCTCCAGGGGTGGGGGCCTTTGGCACCTCAGTCCCCGATCCCTTACTCC
TTCCGTCCATACCTCCTCGCACCCATCCGGAATCTCGGCTGATGTGAGCCGGCAGCGGAG
AAGCACCATGGAACGGCGGGGGAAATGCAGACGGCACCCAGCGGTGGATGGCGGCAGCGG
AGGCCGCGGGGAAACCTGACCAGGAAGCTGAGGACCAAACCAGCCTCTTTTTCTGTTCCC
GGTTTTTTTCCTGAATCCAAGGCGTGCCGTGCTCCCTGTTTTTCCCCATATGTGTTGGGG
GGAGGGGTGTCCTGAAACGGGGGGTAGTTTTTTTTCTTTTTTAAAACAATTTTTTAATAC
TCCAAGGAGAGGGATATGGGAAAAGTAATGTGAGGAGCTCCACTTGGATGTAACCAGGTG
GGTGTTAGGGTTTGGCACTAGACGGGCCCTATTGTATAAACAGTGCAGTGTATTCTTTCT
TATCCTGTACTGCTCCTTCCCGTGGGATGTCAGTTACCTTTAGTTATACTTGGGGCTAGA
TTTGAAGGAGGCCATGAAGCTTCATTTTGAAAAGCCTGCTTTTGCAAGCCTGCTTTCTGG
GATTGGGCTTCTGGTTCTCTCCCGTGCCACTCATCCTTTCCTGAAACCTTGGGCCCTGGG
TGTTCATGTTAATTATGTCCCCAGGTTAGTGAAGAGTGCTAGGAAACTTGGACTCAGGAG
TTGAGTCTTGTGTCAGTTTGTTTTTTTTTTTGCTATCTTCCTCCCCTTAAAGGGTTTTAT
GTGTGCGTGCGTGTGTGTATGTGTGTGTATATACATATATACATATATATGTGTGTATAT
ATATATATATATACATATATATATTACAAGATGGTTGTATATCTGCTGCTCTGAATTTGT
TTCTTAACACCATTTATTGGTACTGTCCATGTAACACTAGTTGATTTGACTCCTAGTTCA
GAGACCAGTGCCATCTGAACTATTCCCTTGTGGTCTGAGGGCGAGTTGTTACTCATCCTG
AGTAACTTTTCATGGTATTTTTGACTATGTTCATTTTAGCATTCTGATCTTGACAGATAA
TCCACCCTCCTGATGTGGATCTGATTCTCTTAGTTGTTTGGTTTTTTCCTTAATATTTTA
TGTATTGATTTGAGAGAGAGCAAGCACAAGCAGGTGGAGGAGCAGAGGGAGAGGGAGAAG
CAGATCCCCACTGAGGAGGGAGCCTGACTCGGAGCTTGATCCTAGGACCCTGAGATTATG
ACCTGAGCCGAAGGCAGACGCCTAACCGATTGAGCCACCCAGGTGCCCCCTGATTCTCTT
AGTTGGGAGAATACTCAAATGGAGCAATCCCTGTCTTCCCCTCTATTTTTACAACCAATA
GTGGTGGAATTCCTGACCTCGAGTCACCATGTCCACCAATTCCCAGGTGTTTGGATTACA
TTTTCCCTTTGGGGATCCTCTCCCATTGTTTTCTTTCCTCTGCTACCTCCTTTTGAGGTC
ATGGCATCTTGCCATTGGGTGGTCTCACTGCTCCTTTTCAAACTCCTTGCCAGGTTACCT
TCCCGTGATACTTGGGCAATCTTAAAACAACTGCTAGGAAGGAAATTAGAGCTAACGTGG
AAGAGACCACATTAAAATGAGGATATTTTTGGGGGTGTGGTGGGGTTTTCAGTCTTCTCT
TTTCCCATCCCCCAATGGGGTGTTTTGGAGATCAAGTTCCTCCACCCCCCCAGGTTTAAC
CCCCCCACTCTGCCCTCCTCCCGTTCCCCCCCTACTCCCCCCTCCCTCCCCCAGCCAATG
GAGATCTTCGTGGATGATGAGACGAAGCTGACGCTGCATGGGTTGCAGCAGTACTACGTG
AAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGACCTTCTCGATGTCCTTGAGTTC
AATCAGGTCAGTTGTTCAAAGTCCAGTAGGGGGATGAGCACGTCTCCAACTGTAGCAGAA
ACCTGGTTAAGTACCTTTTTGTTGAGGATATGACATAGGTGATGTGAGCGAGAACAGTGG
GGAAATTACCTTCAAATGAAATTCTTTTAAATGAGAATTTAAGTGCCTTTGGTGCTGAGT
GTGAACAAGATGGGAGCTGCTGTTCTGTTCTTTGGCTGTCACAGCCAGGTATTGAGTAAA
GAAAAATCTCAAAATCCTTGAGAGGATTTCATAAACTTGTAAAAGTTCCAAAATATCTTG
GGTTTCTTAGGTTTTTAAAATTTGTTTTTTCTTGTACTGTTTACTGAGAAGAAATGTTCC
ACTACTTTACCTGCTGTGGTTCGTTTGCACCAAAAACTTTCTAAAATTAAGGTAAATTGC
ATATGTTTGATGTTTTTGATGAGCAGAAACTACTCTCCACACTTTAAATTTTTTTTTTCC
ACACTTTAAATTTTTACCACTTTCATTTTTACCATTAGCTTCATCCTTGTCTCCCTAACA
TATCTGGTAGTTTTAGTTACTTTTCTCTGTATCTTCTCTTCAGCATGTCTGCTCAGGAAA
AATCAGAACTGAGTGAGAAAGGCTAAGTTGTATTTAGAACAGAAGAGGAATATGTAATGG
GGATTGGAGAAGTTTCAGGAAGAGTAAAAGAGTAGTTACTGAAAACTCTTCTCACACTTA
ATCTCTCACTTATCCCACATGGACCCATGTCCCCCAACTGTCACACACCCAGGTGGTGAT
CTTTGTGAAGTCTGTGCAGCGTTGCATTGCCCTCGCCCAGCTGCTGGTAGAGCAGAACTT
CCCAGCCATTGCCATCCACCGAGGGATGCCCCAGGAGGAGAGGTAAGTCAGAAATGGAAA
GATGTTTTGTGTCCTTGGGAAGGAAAAGAGACCGTTGAAGCGAAGGGACTCAGTATTTTT
CTAATTTCCTTTCTCACGAAGGCTTTCTCGGTATCAGCAGTTTAAAGATTTTCAACGACG
AATTCTTGTGGCTACCAACCTATTTGGCCGAGGCATGGACATTGAGCGGGTGAACATTGC
CTTCAACTATGACATGCCTGAGGATTCTGACACTTACCTGCATCGGGTAAGCTCCACACC
CACACGTGCATTCCAGTGTCCCCTCCCCCTGATTTTGTATCTTCATACCTGATAGCCTCT
CCCTTCTTTTTGGATGTCTTCCTACTTCGGGATCTCCCAGGACTATCCTCTGTCTCCTTC
CAGGTGGCCCGAGCAGGCCGGTTTGGCACCAAGGGCTTGGCCATCACATTTGTATCAGAT
GAAAATGATGCCAAGATCCTCAATGATGTGCAGGATCGCTTTGAAGTCAATATTAGTGAG
CTGCCAGATGAGATAGACATTTCCTCTTACAGTGAGTATGGATCTTAAGAAACTGGCTCA
ACTCTTCAGTCTCCTTGTTCCTTAGTGTGTTTGTCTTAAATCCCATCATGTACACAAAGA
GCCTCTAGTGTGTAACAGGCACTTAATTATGTCCTTTGGATCTTGATGCCCCTGCTGGGA
TGTTTAGTTGATCTGTATGTCTCTTTTCTTAACAAGCTAGTTTATTTTTCCCTACCCCCA
GTCTATCCTTTGCACCCACAAACTACAGACATCTGCATGTAGTGGGGGGTGGGGGCATGT
TTTCTGCCAGCCTTGCCTTTTCCATGTCTTGTAATTGTGCCATGTTTTCTCTCCAGTTGA
ACAGACGCGGTAGAGGACTTACCCACCCATTTTGGAATGTGACAGTCTGTCCCTCTTCAG
GAGACGACAGTAGACATGGGGTGAAGGAGACACTACTGCCACCTACCCGTGACAACCCCC
ACCCCCCACCCCATGGCTTCCCCCTTTTGCATCACCACCACTCCTGAATCCCTGTTTCCT
GAATTGTCGGAAATTTTTTTTTTTTTTTTAACAAAACTAAAAAACACATGCGTCTGTGGT
GTCTGTAAGTGCTCCATGCCTTTATTGGGTTTGGGGTGAGATTAGGTCATGATTCAGTGT
ATATTCATTCTTATAAGGACTGTGTGCCCTGCTGTGGGGCTCAGGTCAGTTGGGAGGGAT
CAGAGGGGGGGAGGGGGATGTGACTAAGACTGCAGAAGCCATTGCTCCTTGCTACTTCAA
TTTCTGCCCTTTGTGAAAGTGTCTTCCCTTTTTTTTTTTTTTTTTTTTTTCAGTGGCCTA
GGAGGGGCTGGGATGTTTCTGACCCAAAGGCCCCAGTGTGGGTGGTGTGTAGTGTTTCCA
GTGTTGGAAGGTAAAATGGGAACTGATGGAAAGTTTAGGCGTCTCCTAGGCTCTCCCGGT
GTCTCCTCATCTGTTCCTTCAGCTTCTGGATCTTGAGCACCAGGGCCTGGGCTTCCCAAG
CCCCTTCTTGCCCTTCCAGAAGAGCCTGGTACAGCTCCAGCTGCTGCTCCAGCAACTCCT
CAGCTTGGGCCAGCTCAGCTGTGGGGCGGGGCCTGGGACCCTGAATGAGGGGGGCAGAGG
GGAGGGAGCATCAGCCAGGGCAGGAAGCTGAGGCTTGCTGGAAGTCCGGTGTTGTGCCTC
TCACATTTCCACCCCCTTTTATTAATAAGGTTCTCTGTACTGTGAAGCGAGGGTAGCTTC
TGGTCTTAGGCATAGGCCTGTGGGGGGCAGTTTGCGGCTCAGGGGTTAAACTGGACTCCT
TGTGCAAGGAAGGATATGGAGAGGAGAGGACTGGCTGTCCCTCCCCCCACCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 2302..2546, 3349..3476, 3773..3865, 7158..7341, 8435..8553, 10854..10985, 11752..11861, 11961..12105, 12243..12390, 12716..12732
2336..2546, 3349..3476, 3773..3865, 7158..7341, 8435..8553, 10854..10985, 11752..11861, 11961..12105, 12243..12390, 12716..12729
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved