Canis_familiaris Locus UAP56_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris UAP56_CANFA
Canis_familiaris
UAP56_CANFA
12
SNORD83
6058..6134
12397
gggcatttgcggagggcggggctcctttcacttttcctctcttctgtgggtcctcttaa
tggcccaaggtgggaactggaggaggagccgactactgagcctggttggacccttctgtg
agctcaccaaccatcacttggaacattttccacttgttcatgcgtggtgtcatgtcggtt
atcggagaggagtctgatctgaggagtaacagaagaccctttgctatagttcctggtaga
gctggagcgaatgctgtctctctctcgttctatggagaagagacgagtactttcccgtcc
cagccacgtcttctgtatcccctcccccacgttacacggggaccccttagacaccgggag
gttcctgaggagtgggaggtggatggcagccacatgatgttatttcgaggagtgagcgct
ttgcgctaggatgaccttaatctatcaccagtaactgatggctgctttgttagggagatt
accaggaaagcagagaggtcctgtgaggattttcagcacttaccttgtcatctccattct
tcactccgttgtcctactttgcttttcgttacccgtttttcttcattactgttgcttaca
gatgaggaattcatgggctggttgtccccttcctacttcctgcttaatgctattctgatc
ctaattttgttgaaaagttgtgtctcaaccacctcacttgggaccactgtgttatgtttg
ctgttgcttttatgttttgtgttcctgttagttttatccccaggtaaaggggtcacagtt
tagggaaagtgggaagagtgtggggatggaaaagaagggcgaaggctctgctcctgacta
ataagtcctccatctatttttttcctagctcttctatcacaaactagggtattttttttt
ttttaactgttgctccagcccccactctcctcctctgtttttacttattctgcgtgaacc
catccagagacccatctccttctccccctgccggcccagttATGGCAGAAAATGATGTGG
ACAATGAACTCTTGGACTATGAAGAAGATGAAGTAGAGACAGCAGCTGGGGGAGACGGGT
CTGAGGCCCCTGCCAAGAAGGATGTCAAGGGTTCCTACGTCTCCATCCACAGCTCTGGCT
TTCGTGACTTCCTGCTGAAGCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGCTTTGAAC
ATCCATCAGAAGgtaaattttctgcaggtcatagtgttcattaggctctctaaggataca
agaaaaaggtgtgttaaacagtcacttaatgtaataacgttcttatttaggctactttag
gaaataaaggtcaaaaactatttcagcagtaggaaagatttatatagattggtttttttg
ttcacgataacatgaaaaggctagtgacctaaaagcaacttagaggtttgtgcttgtgac
cagcatttattcttgtctacttgttattaattttgttgtttaggtttctaaatttgaatt
tcctgagaggactggttggacctttagtctctccctgttgggccaggccacctctggtct
ctggaaatcttcatagctggtctaaaatgggtggcttctggatcagctaccaaccccttc
agagttgcaaggttttgtagccttaaagcaagggaagctaagtaggagaaatggcttggg
gcaggcagtcacatgtcctggattgttacagatcaaggaaagtcgggacagagtcagaag
caccaaaggtgaactgttggtaggtgcaagagggttgtttgcagtttgtggggtgggggg
agggcactggagttggaggaggctaaagctagaaggaactaggaaggtctatctggtttt
gagataaatctgagggagcagagaggtagaaggggtctggaaattgataaccatttaaga
aggggtgggaaatgggtttgacatggtgaaaaaaggttgtggagttatctggagactgaa
gtctaatttatcttttttctccccctgcttctagTCCAGCATGAGTGCATCCCTCAGGCC
ATTCTGGGAATGGATGTCCTATGCCAGGCCAAGTCAGGGATGGGAAAGACAGCAGTGTTT
GTGCTGGCCACACTACAACAGTTGGAGCCAGTTACTGGACAGgtacacttggggagagtg
ctatggaagacatttttggttaggaatattggagaagggtgttttgtctcagctgtgtga
tgcttttagagccatgagtgtttgtggctaagatgaactctgtcacctttgactgatggc
cctgggggatattacatagtaatcatggggttaatggtttagatctcagaattgaagtaa
tttatgatctgtcagatgtgcttttgtgacagttggttccccagaggggatagtaagtat
atactgtttatctccatgtactcccccctccacccaagGTGTCTGTGCTGGTGATGTGTC
ACACCCGGGAGTTGGCATTTCAGATCAGCAAGGAGTATGAGCGCTTCTCTAAATACATGC
CCAATGTCAAGgtaagccaagataaacctgggagagtgtggggagttggagacattgaag
acttgtagaccagcagtcttcattttttcagatgattaattaactttatatgaaggtcat
ttacttgtaatagctggtcagtttctgcaaactttggtgtgcaggagatttacattctat
ggtttacttgaatacacattgcaatttctgatatgttcactatattccaattttggagaa
gctttagtttgttcttaacacatcatgttaatatagctagcagcggaagactgcatggaa
tgggttctggaggatgtttaccacagtactacacttgggtttactacttttttatactga
ctttgaatgatttcattgtgctttggttgacagtttgagaattctaggatgtgtgcaaga
gaaagctggaagcttcaaaatatctctttaagtgtgtggtgtgtgaattttgaggattct
ttaaaatggcagaaaattgaaagatatttaggggccacaacagacgaggtttgggcggtt
ttccatatatgatcttgattttcatagtatggttcccagacctctagttagagcatcatt
tggaagcctgatggaaatgctgattatatgggtaccatcccagacctaactgagtataaa
catgcattttattttattttgttttattttattttattttatttatttatttatttattt
atttaatttattttttaaacatgcattttaatacaatcttcaggtaattggagtttgaga
agcgctgatgtgtataacctcctaccttcctgactaggatgtggtgaaaaacagtacttt
tgtttggattgttgtgatattctcctgttactcatgtgttgagtcctagccctaaactaa
aaatagtaattcttaaaaaagattttatttaagcgagcaaacacacacgaacgggatggg
gtcaggtggggagggaggtctagggagagggagaagcagactccccctctaagcagggag
tcccacatggggctatatcccaggacccctaagattgggacctgagctgacacttagcgg
actatgccacccgggcacccctaaattggaagtagtcttaagaaccaaagtagtaataaa
taacaatgtgggggtaaacatgcagtaaatatgctgaagtaatagaaggttcatgatgaa
aagatttgtgttctcttacctctaatcgaacttcatagaaggtaatcatttgttaacctt
ttttttttcgttatggtctgtgacaccaagtattaggtactattctctcgttttataacc
ttatgagtgttttttatttcttttcatgagagattggttgcgatttttttttatatttga
agattaattctttaacaataatttaagtgtcatatctccttatgttgtagctatccttag
catttcttttatgtcctttcattgagcaggctcgatggcctattgattctaaaaagtgga
aaaccagaaaatggtttccactgttatgaccattgaaacatttattgttgggctcattag
tgagtgaggattgtattttgacctctgtaggtccaatttagcagattatgctgctcaaaa
gagattttttttaaagtttattagttttttttaatctctacatccaggatggggcttaaa
ctcaaaaccttgagatcgagagtcacatgctcttccaactgagccaaccgggcaccccaa
aacaatatttttggtgttaagatcaaattgtcgtgacattttcttacttttctttaaaat
tgtgctaaagtgacttgtctgaggttgggctagtttttttttttttttaacattttattt
atttattcatagagacacagagagaggcagagacacaggcagagggagaagcaggctcca
tgcagggagcctgatgtgggacttgatcccaggtctctgggatcacgccctgggctggag
gcggcgctagaggcggcgctaaacccggcactaaacccgctgagccacgagggctgccca
aggttggctagttttacataatatcctacctctggatttgtctggttactcccttatggt
attaacttgctttttgtttttttttttttttttttcagtatttcctttaactcaaatatg
tatttgaaagctcaactaatttaagttaaacatttttggcaagaattgttcagagttgat
acactgtatatttcctgttcttcagcagacttggttgtcccataattagtgcttttagtt
ttatcataacagtctgatcttgtaattgatttttcattctttgaagctggaaagcagttt
ctggtgttattcgatactataataataaggctcagattctcaacaaatacttctgtaact
ttttttttttttttttttttttttaactttttaaatttatttatgatagtcacagagaga
gagagagaggcagagacacaggcagagggagaagcaggctccatgcactgggagcctgat
gtgggattcgatcccgggtctccaggatcacgccctgggccaaaggcaggcgccaaaccg
ctgcgccacccagggatcccccgtaacgtttttaatacggagtagtatgtgtagcttaaa
tcaataatttgatagggtttgtgcaaaaaggcatttgaaaatctgagttcagaagcactt
ggatggcttaggtggttgagcatccgactcttgatcttggctcaggtcttgatttctggg
ttgtgagttcacaccctgattgggttccacactgggcatggagcctactaaaaaaagaaa
aatcagagtttaggaaaatttgatgttctatgaggcattttgtggtactttgcactctgg
tgatttcttgctgtcctctttttttttttttcaagttttttatgtataatctacacccaa
cgaagggctcaaactcatgatcaagagtcacatgctctactgactaagccagccaggcac
cccttgcattcctcattcttggaagtctggccatagcactgtgggaaggaagattattag
attaagtcagaagaatgctagtcctaactaccttgattagccacataactttaggcaaga
cacttttgtttcttagcttcagtgtttgggaaacgtaataagaattttagatttgctgac
ctttgatgttccttttagctttgaaatgttctaagaattcatgtagattaaatttaaagg
gtgggaactggggagattggactctttccttgtgagaccgtattttctcctgggttaata
cagGTCGCGGTGTTTTTTGGTGGTCTGTCTATCAAGAAGGATGAAGAGGTGCTGAAGAAG
AATTGCCCGCATATTGTTGTGGGGACCCCTGGCCGCATCCTCGCCCTGGCTCGAAATAAG
AGCCTCAATCTCAAACACATTAAACACTTTATCTTGGATGAATGTGATAAGATGCTTGAA
CAGCTCGgtgagtgacagtgctggggtgaagctagtgatctgggagttgctctttagagc
caaatgatgtttatttgatagaggagcactttagtgccaggacgactcttaatctatcac
ccatgactgatggctctggctctcctgttggtttttgttaggctttttaagcaaccttgg
tgatcaaggggaagggtgttttgtcctttctttctgtgatggagagttcttttttctttg
aggggattaactttgctgattttttagacatcagtcacaccactgttctttgcctttata
gattcttatgctgggtagataaactggggagataaactgaaggaggaagaccatttactt
tctggcatcccctgcacatatatcagaatttgtaactgaatagacttaagtgctaggatt
aatgtggagagtttatgggattttctgtaattcagtgttccacaagaaaggaaaattgta
actcacatttaataaatgagtggaaaattggaactcacatttaataaatgagggagtggg
gatggacttagccccagggataagtagttccaagtgatcttcggttattttagatggtga
actataagatgggctctgggtagaggtcttatttgcctggctggataggacagtgatcca
gaggaagcatggactagactttgacaactagaatataattatgtgtgcagtatttgtaga
cagttggggtgtggggagaaagtagggagaagggccttgtaaagcatctctcaagggtct
taggtttgtgagcctctgcagtagacttcatctccatatcatacttgtgagatttggagt
ttcattatcttcttgcctggctaaaacacatagtgctgaaatttggttctaggtctttat
ttgaaattttccatgtgttactgcaatggatgtgattttacggtggttcgtgtaaataga
gtacctgagacaaatctttgtgggaaatggctcttgcttacctgtttccagcagtttcac
ctcactggggaggctgtctccggtctttgtctatgacatttccttctttccttctaggat
ttttttcctttttcttgtagACATGCGTCGGGATGTCCAGGAAATTTTTCGCATGACCCC
CCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATCCGTCCTGTCTG
CCGCAAGTTCATGCAAGACgtaaatacccttctaccttctctccctccactccccgccca
ctgcctcctccccttctgcgccctcttcctccagactcccttgtccttcaaatgccaaga
agggggcacgtgcccatctgggagtgatgactccttgaagagacacacagaggcagagac
agctagtgttagggtctgcgcgggtgccagggaaactccggaagacttggtcgggttaac
ttgagagcgggtagtgttcgacctttttttttttttttttttttcatcacagcatttttg
aacctcttcttcctttttgggggagggcaggattttctgccctactacccacccatcgtc
tcctacatacccctttacagccacgcaccctcaaggtggcatggagcagacagttggagc
cttctgctccccaaaactcaaccccccggtggcaggagagcaagagagggacagacagat
ggcagggcatgtccaaaagaagagcaaacagcacaaatgaatccgctccctccccacctc
caggggtgggggcctttggcacctcagtccccgatcccttactccttccgtccatacctc
ctcgcacccatccggaatctcggctgatgtgagccggcagcggagaagcaccatggaacg
gcgggggaaatgcagacggcacccagcggtggatggcggcagcggaggccgcggggaaac
ctgaccaggaagctgaggaccaaaccagcctctttttctgttcccggtttttttcctgaa
tccaaggcgtgccgtgctccctgtttttccccatatgtgttggggggaggggtgtcctga
aacggggggtagttttttttcttttttaaaacaattttttaatactccaaggagagggat
atgggaaaagtaatgtgaggagctccacttggatgtaaccaggtgggtgttagggtttgg
cactagacgggccctattgtataaacagtgcagtgtattctttcttatcctgtactgctc
cttcccgtgggatgtcagttacctttagttatacttggggctagatttgaaggaggccat
gaagcttcattttgaaaagcctgcttttgcaagcctgctttctgggattgggcttctggt
tctctcccgtgccactcatcctttcctgaaaccttgggccctgggtgttcatgttaatta
tgtccccaggttagtgaagagtgctaggaaacttggactcaggagttgagtcttgtgtca
gtttgtttttttttttgctatcttcctccccttaaagggttttatgtgtgcgtgcgtgtg
tgtatgtgtgtgtatatacatatatacatatatatgtgtgtatatatatatatatataca
tatatatattacaagatggttgtatatctgctgctctgaatttgtttcttaacaccattt
attggtactgtccatgtaacactagttgatttgactcctagttcagagaccagtgccatc
tgaactattcccttgtggtctgagggcgagttgttactcatcctgagtaacttttcatgg
tatttttgactatgttcattttagcattctgatcttgacagataatccaccctcctgatg
tggatctgattctcttagttgtttggttttttccttaatattttatgtattgatttgaga
gagagcaagcacaagcaggtggaggagcagagggagagggagaagcagatccccactgag
gagggagcctgactcggagcttgatcctaggaccctgagattatgacctgagccgaaggc
agacgcctaaccgattgagccacccaggtgccccctgattctcttagttgggagaatact
caaatggagcaatccctgtcttcccctctatttttacaaccaatagtggtggaattcctg
acctcgagtcaccatgtccaccaattcccaggtgtttggattacattttccctttgggga
tcctctcccattgttttctttcctctgctacctccttttgaggtcatggcatcttgccat
tgggtggtctcactgctccttttcaaactccttgccaggttaccttcccgtgatacttgg
gcaatcttaaaacaactgctaggaaggaaattagagctaacgtggaagagaccacattaa
aatgaggatatttttgggggtgtggtggggttttcagtcttctcttttcccatcccccaa
tggggtgttttggagatcaagttcctccacccccccaggtttaacccccccactctgccc
tcctcccgttccccccctactcccccctccctcccccagCCAATGGAGATCTTCGTGGAT
GATGAGACGAAGCTGACGCTGCATGGGTTGCAGCAGTACTACGTGAAACTGAAGGACAAC
GAGAAGAACCGGAAGCTCTTTGACCTTCTCGATGTCCTTGAGTTCAATCAGgtcagttgt
tcaaagtccagtagggggatgagcacgtctccaactgtagcagaaacctggttaagtacc
tttttgttgaggatatgacataggtgatgtgagcgagaacagtggggaaattaccttcaa
atgaaattcttttaaatgagaatttaagtgcctttggtgctgagtgtgaacaagatggga
gctgctgttctgttctttggctgtcacagccaggtattgagtaaagaaaaatctcaaaat
ccttgagaggatttcataaacttgtaaaagttccaaaatatcttgggtttcttaggtttt
taaaatttgttttttcttgtactgtttactgagaagaaatgttccactactttacctgct
gtggttcgtttgcaccaaaaactttctaaaattaaggtaaattgcatatgtttgatgttt
ttgatgagcagaaactactctccacactttaaattttttttttccacactttaaattttt
accactttcatttttaccattagcttcatccttgtctccctaacatatctggtagtttta
gttacttttctctgtatcttctcttcagcatgtctgctcaggaaaaatcagaactgagtg
agaaaggctaagttgtatttagaacagaagaggaatatgtaatggggattggagaagttt
caggaagagtaaaagagtagttactgaaaactcttctcacacttaatctctcacttatcc
cacatggacccatgtcccccaactgtcacacacccagGTGGTGATCTTTGTGAAGTCTGT
GCAGCGTTGCATTGCCCTCGCCCAGCTGCTGGTAGAGCAGAACTTCCCAGCCATTGCCAT
CCACCGAGGGATGCCCCAGGAGGAGAGgtaagtcagaaatggaaagatgttttgtgtcct
tgggaaggaaaagagaccgttgaagcgaagggactcagtatttttctaatttcctttctc
acgaagGCTTTCTCGGTATCAGCAGTTTAAAGATTTTCAACGACGAATTCTTGTGGCTAC
CAACCTATTTGGCCGAGGCATGGACATTGAGCGGGTGAACATTGCCTTCAACTATGACAT
GCCTGAGGATTCTGACACTTACCTGCATCGGgtaagctccacacccacacgtgcattcca
gtgtcccctccccctgattttgtatcttcatacctgatagcctctcccttctttttggat
gtcttcctacttcgggatctcccaggactatcctctgtctccttccagGTGGCCCGAGCA
GGCCGGTTTGGCACCAAGGGCTTGGCCATCACATTTGTATCAGATGAAAATGATGCCAAG
ATCCTCAATGATGTGCAGGATCGCTTTGAAGTCAATATTAGTGAGCTGCCAGATGAGATA
GACATTTCCTCTTACAgtgagtatggatcttaagaaactggctcaactcttcagtctcct
tgttccttagtgtgtttgtcttaaatcccatcatgtacacaaagagcctctagtgtgtaa
caggcacttaattatgtcctttggatcttgatgcccctgctgggatgtttagttgatctg
tatgtctcttttcttaacaagctagtttatttttccctacccccagtctatcctttgcac
ccacaaactacagacatctgcatgtagtggggggtgggggcatgttttctgccagccttg
ccttttccatgtcttgtaattgtgccatgttttctctccagTTGAACAGACGCGGTAGag
gacttacccacccattttggaatgtgacagtctgtccctcttcaggagacgacagtagac
atggggtgaaggagacactactgccacctacccgtgacaacccccaccccccaccccatg
gcttcccccttttgcatcaccaccactcctgaatccctgtttcctgaattgtcggaaatt
ttttttttttttttaacaaaactaaaaaacacatgcgtctgtggtgtctgtaagtgctcc
atgcctttattgggtttggggtgagattaggtcatgattcagtgtatattcattcttata
aggactgtgtgccctgctgtggggctcaggtcagttgggagggatcagagggggggaggg
ggatgtgactaagactgcagaagccattgctccttgctacttcaatttctgccctttgtg
aaagtgtcttcccttttttttttttttttttttttcagtggcctaggaggggctgggatg
tttctgacccaaaggccccagtgtgggtggtgtgtagtgtttccagtgttggaaggtaaa
atgggaactgatggaaagtttaggcgtctcctaggctctcccggtgtctcctcatctgtt
ccttcagcttctggatcttgagcaccagggcctgggcttcccaagccccttcttgccctt
ccagaagagcctggtacagctccagctgctgctccagcaactcctcagcttgggccagct
cagctgtggggcggggcctgggaccctgaatgaggggggcagaggggagggagcatcagc
cagggcaggaagctgaggcttgctggaagtccggtgttgtgcctctcacatttccacccc
cttttattaataaggttctctgtactgtgaagcgagggtagcttctggtcttaggcatag
gcctgtggggggcagtttgcggctcaggggttaaactggactccttgtgcaaggaaggat
atggagaggagaggactggctgtccctccccccaccaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 2014..2141, 2438..2530, 5823..6006, 7100..7218, 9519..9650, 10417..10526, 10626..10770, 10908..11055, 11381..11397
1001..1211, 2014..2141, 2438..2530, 5823..6006, 7100..7218, 9519..9650, 10417..10526, 10626..10770, 10908..11055, 11381..11397
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved