Canis_familiaris Locus NCL
snOPY snoRNA Orthological Gene Database
Canis_familiaris NCL
Canis_familiaris
NCL
25
SNORD82, SNORD20, SNORA75
4892..4957, 8641..8719, 9294..9428
11501
acttgcgcggccaatgggtcggtgtttggcctgaccaagttcctccccccgccgccgtt
gtaacacccggtgaccaccagaaagttattcctccgggcctgttcctcgttgggacaaaa
acctagcccaggggggggcgcgccaaaaaagggggggggggagaagggcccaaagacacc
ggggccggtcaaaaaaacagcccccaggaggcagctgggaacaggggcccgaaaagaaac
ccgcctctaccgggtaagggggggggggggggggcggaggcgggcctccaacccgggcgc
tttgaacctcacggtccccgaatttccggaggtctcgggctcatccgcggagggaaaggc
gggcgaacactttctcctcggccgccgggcggctcggcgtggagagcgggccggagccgc
gcgtagggccgcctggcatctgcaaggcctccggcgtcgacagcaccctggacactttcg
ggaaccggagaccaccagtacccagcctcccggggctcgggaacaagcggcgccaaaaac
ggccgtcttaccgcgcaggcgtcgcgagcgcgggccgcggaggggcacttcaggaaccgc
gcgcccactacccaatcagcgcgggccctgcacaaagcgagtcccgcccccagggcaccg
ccaccgaatcccctccccctcccctgcccgcttcggcccgcccactcccgcctgcgcccc
gccccgcgccgttcttgggtagaggctcgcgattggcccacgggatgggcgcagcctctg
attggtcgagacggagtcacgagggcgccgtcgtcgcctttccagaggcgattactgggc
aggctcagtctttcgcctcagtctcgagctctagcgagcagccaagcgtacgcgctccgg
gaacctctcgtacccgcggccgccatcgacgtcgcttggattcttctgggctcgtctgcg
ccactcgcccgccacacactccgccggcataagccgccatcATGGTGAAGCTCGCAAAGg
taagaagacggcttgcgcaagcatggacgtcgaggcctgctttctgaggagcgcgcgcgc
ggcgccgcgaggaggagggcctgcgcgccgtcccgggcgcgttcgagggcgccatgctgc
gggaaatctcgcgcgatcggcggggaggtctcgcggcttttggctatttggtagcgaggt
gaagagcttcggcaggttccgcgggtggttggtgcggcgccgaaagacttagggactgag
tggggagggggcgctgggcctcggggtggagggatgatgccgaactcctgcgacgggccc
aagcggggccccgcctcctgacgcacgtgcctcagcgcgctgcccgccacgtgggccgcg
ccgcgtgtgtcccggcgtctgcggaggggacttggaggggaggcggggggctgcgggatg
gtttcagatggaggccccgtggcctgtgggccccggccagacaagcgggcgcgaggtggg
cttcaggaggaggccttgcctcgtgctttctgcgccctgctgcgcgcacatggtgaccta
cggggtatccccacgtggctctgccgggtctggaaggggcggggtttttttccacgggaa
agaacttaatggggagaccaaaggtagtaagattaaggtctgattttcttttataaaagt
tgtcttgaagatcctgcccccaaatttggattcaggcgactgtgtaagatctggtgctag
aatttaccaaaagcttttttttctcccccccaggtgtggttctccgcccccggtgaaggg
ctatgaattgttggccgttaaaattggccagttgtagtctattaaaatcatgcgtgatgt
aatggtcggttttggaagtatcgttttaaaaacggatgtgcttaacgaaggcaaaaggag
gagggagataatattgttgtagttgcatttttatccttgagtttctgtaaaacctgacag
gagtaatggggtgggggttggcagttgctgttttgacgttggcttcgatagtgttcatgt
taatttttatatctagcattaggaaatgtggactttatgtagggagacggctgtttttac
tctgaagaatgatggcataatatgaacggtcagatgttttaggtgtaatgtgctaaatgt
ctattttagGCTGGTAAAAATCAAAGTGACCCCAAGAAAATGGCTCCTCCCCCAAAGGAG
GTAGAAGAAGACAGTGAAGATGAGGAAATGTCAGAAGATGAAGATGATGACAGCAGCGGA
GAAGAGgtaattatatacaactttatggagacgtgtgttaaactatgaaatggagagctg
aaatagctgatactggatgtatgaaaatattggcaaaaataagattgtattcattgagta
tggcctgctgagactgttttccaagctcttcattaacatgttgatataggtaagtatttg
aatttgagagaaaaaattgggagtcctcttttcatgtgcattttttgtagggcttggtgt
tatatttgtgttcagccgtgacatttttctagtttgagtatgttaacccccaccttacta
gataaacaaacagcctggactattaactgttaagtaagtggcattgctgtgcatttattc
aggtctgaggttagctttaccagattactttcctagcctccaagcaggattgatttgtct
ctcattgtataagagcatcgtgatactggttactgaacatcttggtgtgggttgagcgtt
gccacctcactttgtgttaacctattactgtttgcttactgtaaagacaactattgtatt
tgtgtttagatttcttgtttaggatgtaatgaatattttactgatgatatggtacccagt
aaaactaggagtgagcaaaaaagtataattttaatgtagatgaacgatggtttttatcag
gtttaaggtgcttactctttactaaacttaggaagagctaactatccagtgtatttgata
ctcatttactggtcttaagaacaagccttcaatgaaccactgcccactgtaggacctctg
aatgattcagtagcatctaacaagtagagctttctttgtgcaagacttctaattacatat
atatgtcaactcctaatctaacaatatgtaaggttggtgctgttatcccttacagaggag
aaaaaaagtcgaggcttaaaattttcttaaagcctgttttaaagttgcagttataatgtg
tgaggtattttagctgttaaaaaggggctctatatgcttgagtattttacctgaagatga
aggctgtgatttctggcacatggttctgtagtttagcatgctaacataacatccagtgca
tgtgggtctgaaaccagaacagtgttagaatttagtctcattcatgggaccaaggctgtc
tttttgggtttggaagaagacttacctttggttttatttgttctttagGTTGTTATTCCT
CAGAAAAAAGGAAAAAAGGCTACCACAACTCCAGCAAAGAAGGTAATGGTTTCCCCAACA
AAAAAAGTCGCAGTTGCCACACCAGCCAAGAAAGCAGTTGTCACCCCTGGCAAAAAGGCA
GCAGCTACACCAGCCAAAAAGGCGGTTGCACCAGCCAAAGCAGTAGCAACACCTGGCAAG
AAGGGAACCACACCAGGCAAGGCATTGGTAGCAACCCCTGGTAAGAAAGGAGCAGCCACC
CCAGCCAAGGGAGCAAAGAACGGTAAGAATGCTAAGAAGGAAGACAGTGATGAGGAAGAT
GATGATGACAGTGAAGAGGAGGATGAGGAAGATGAGGATGAAGATGAGGATGAATTCGAG
CCAACAGTGATGAAAGCAGCTGCTGCCGCCCCTGCCTCAGATGAAGAGGAGGATGATGAG
GAGGACGATGATGAAGACGACGACGAGGAGGATGAGGATGAGGATGAAGATGgtgaggag
ttctttggctagtttttaggctacttttgtaagatacatcagggtaaggttttggcagta
atgatacgtataccatgacaacctgggagttagatgaacatctttccagggattttcctg
aggtattcatggtacactaaacttaggttatctaaaatgattgcctgcccctgagaaaat
acttttagtgagtgtttttcataatggcagattttgcttccagctgatctgttaatcctt
tccataactgctaagcacagtggcattgataggattgtatttcctttagattttcctgga
actaatgttggtttttgggaggattctcttgagtttttgacttttcaaactcagacttca
ttttcagACTCCGAAGAAGAAGCTATGGAGACTACACCAGCCAAAGGGAAGAAAGCCCCT
GTGAAAGCTGTTCCTGTGAAGGCCAAAAGCACAGCTGAAGATGAAGATGAAGAGGAGGAT
GATGAGGATGAGGAGGATGACGACGAGGAGGAGGAGGACGAGGATGATGATGAGGAGGAA
GATGAGGAGGAGGAGGAAGAAGAAGAAGAGGAAGgtaatcaagttttcatctgaagtaca
ctgtaaaagtattatttaaaggaggcacttgaaggggcatctctggctcagttggcagag
catgcgactcgatcttggagtaattagagctgcatgttgggcatagttgagtttaaaacc
aaaaaaaaaaaaaaaaaaaaagacacttcaatgtgtgtggctgctcactaataaccagat
tgtttgaaatcttgttcagAGCCTGTTAAAGAAGCACCTGGAAAACGAAAGAAGGAAATG
GCCAAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGAAAGTAGAAGgtaacttggagaat
gagggattggggagagggtaatgacacctcactgcacaagtgatgaacaacaaagggact
taatactgagacctgatgtgatacgaggtctgatgtgctctgtgtagtaatggcgtattg
gaagttgaagttcataccatacttcacaaatagactaatttgagtttgttttatacagCT
ACAGAACCAACTACGTCATTCAATCTTTTTGTTGGAAACCTGAACTTCAGCAAATCTGCT
CCTGAATTAAAAACGGGCATCAGTGACCTTTTCGCTAAAAATGATCTTGCTGTTGTAGAT
GTCAGAATTGGTGTGTCTAGgtgagtatgagggagttctgcacattactcctgggtttgg
aagtcttcaaataattagacattaatgtattaagtaatgagatttgatgtttatgttcct
agaaagatctaaaactggtggaattgaagagctataatagtgaatgattttattaggttt
ttttcttggtgcttataaacaggttctttgttggttaatatcgatggttactaaataaat
aaataaataaaaattaaaaaagtatcgatggttacaaacagtatggctaataagacctca
aaggtgaactcagcatcatttccccgtacttagaccttgctctgtagcaacagtttacag
agccttgacttcttttaatactataggtgcatttttatttaatccttgtttgcatcctga
cattagtgtaactgctcacccagtatgtgttttctagcttatatttttgtgagttttttc
cccctagtcataattttgcctttttcatcttctcactctatagGAAGTTTGGCTATGTGG
ATTTTGAATCTGCTGAAGACCTGGAAAAAGCTTTGGAACTCACTGGTTTAAAAGTCTTTG
GCAATGAAATTAAATTAGAAAAACCAAAGGGAAAAGACAGTAAGAAAGgtatgtaaggct
agggtaattttgatactagtctcttacttgttagtagatatgtatctagttgggagctag
gtggctagtgtaaataaataatttaactttttttccttggtttccttacaatttgagaat
tgaatgagttcaactgttaaatccacagcttgctggtgttataaatttcctgagttaggt
aagcaagaatagacccttttaaaaaaaataattggttaatatagagggagcttttccttg
ctggaactgggttagatcccaattacactttttgtatcctttaccttctctgtattcact
tgccatatttaaaaatgttcatatgtttaattcaaaaaacattgagcacctattgatttc
agttacagtaacttgtgtttttgccgttgttgcatctccatactagcagagtgccttgta
tattgtaggatctcaaattatttgttgaacaaaacttttccattagttgatttttatggg
gaagtgtcttttaagccatacgtttcctattttgtctgtttaatctagATCGAGATGCAA
GAACACTTCTGGCAAAAAATCTGCCTTACAAAGTTACTCAGGATGAATTAAAAGAAGTAT
TTGAAGACGCTGTGGAGATCAGATTAGTCAGCAAGGATGGAAAGAGTAAAGGgtatgttt
tgtctatggattgttgagttttattaaaaccaatgcatttccttgattttgtaaaaaatt
ttgatctcactttccaaagtgtgtgattttggccaaattgatcttcaaccagtgcctcaa
tttcctgtctgcacagtggggctagcatacttaaatccatagggtgattttattttttta
tttttttttaaattttttttttaatttttatttatttatgatagtcacagagagagagag
agagaggcagagacacaggcagagggagaagcaggctccatgcaccgggagcccgacgtg
ggattcgatcccgggtctccaggatcgcgccctgggccaaaggcaggcgccaaaccgctg
cgccacccagggatccccatagggtgattttaaaagacaagctaacatgtataaagtgct
gtgaaatgtgcctagctttgtaaataatagcagttacgcagtgaagtggggttactagaa
acagttcttcgaggtgtacttggcaatcttgggtagtacgggaggaaagttttaattgaa
acacagaacatagcagaaaaccaaaacatttcagtttatttgaaacaacttttttattgt
actctttgaaataaggttctgttgctcagattaaaacatttgttaaaagactggttttta
aaaatgagttctcgggacgcctgggtggctcagcagttaagcgtctgccttcagctcagg
gcatgatactggagaccctggatcgagtcctacgttgggttccctgcgtggagcctgctt
cttcctctgcctgtgtctgcttctctgtctctcatgaacaaataaaatctttttaaaaaa
ataaaaataaaaatgcgttggttatgcccccctgccccccttttttgcagGATTGCTTAT
ATTGAATTTAAGACAGAAGCTGATGCAGAGAAAACCTTCGAAGAAAAGCAGGGAACAGAG
ATAGATGGGCGGTCTATTTCCCTGTACTATACTGGAGAGAAGGGGCAAAGTCAAGATTAC
AGAGGTGGAAAGAATAGCACTTGGAGTGgtaagaatttatagaattccaggattgacaga
gggaaatctttgcatctttgaactttcctaagttaactaataaattagatgtatgtaggt
atcaaacaagttatgcctctgtagtgatgatcattcagttcttgagtaaaagctatacaa
aatcattttgttttagaacacagacaaatctagcttttgtgtgttttatactttagctta
gatggtgtgcatttttaaattataatctagatattctaggaggatgtagaccaatatttt
tttacatctctaggtaacagggaggaaactgtgcatgacaaatacttggtaataaatact
tagtaacaggtggaagtccacctgcatcgacattgtcatgttaataactctttgcaagtg
tagaagttcttgaataaggtattctagttgtgtctaaactttaggaccattgtttcagtc
ttcatttggcatcttttttctttgtagGTGAATCAAAAACACTGGTTTTAAGCAATCTGT
CCTACAGTGCAACAGAAGAAACCCTTCAGGAAGTATTTGAGAAGGCAACTTTTATTAAAG
TGCCCCAGAACCAAAATGGCAAATCAAAAGGgtaaaataattacatctttaggttatcaa
ctatgggctctaagaatgttttgcatagatctaaagaaggggggaaggtaaattttttcc
tggatgttactggaagctgaatcctataagcctccacaagttggtttaaagagtatcatt
taggtatattcttgaggtaaaaggcttggtggcattagataatataggaaccgtgtgctt
ggtaacttgctctgagtattgattattcttcctcagGTATGCATTTATAGAATTTGCTTC
ATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAAGGCAGAGC
AATCAGACTGGAGTTGCAAGGACCCAGAGGATCACCTAATGCAAGAAGCCgtaagttata
tttattagggtgtggtggtgtgggtcagcactccttagtgtgctatgctgcattggttgt
ttttttgtccaatttagagctggacatttgtgttttcctcttgttgctgagtgaaggata
ctggatatgatgactgattatctgagaaaataattgatgaaatcaagaaaattcctctag
atagtcaagttctgatccagctatgtcttctctgagcagcacatctgcctctggttactg
ccttgtgcggtgatcataaaagctgtctgcttagagattgccacttatttgcattgctgc
tcctgctttccataaaggatctgagaccggatctctgctgttttggtaatcattgtaagc
ttaagatggtggtgatctgtgacttatattttaattaagcactagtttgctaagtttctt
ttacctgtttttgtttccaaacagcttttgggtgaaaagcaagcttctgctaagatgagc
attcttggcctgtagttccatactggacattattgaaagccagcatccagttaagaattg
tggctttaggtaaaatgtacaatttttcttccgtagAGCCGTCCAAAACTCTGTTTGTCA
AAGGTCTGTCTGAGGATACCACAGAAGAGACATTAAAGGAGTCATTCGACGGCTCTGTTC
GGGCAAGGATAGTCACCGACCGGGAGACTGGGTCCTCCAAAGGgtaagatgatcaaggaa
tgaatgttcagtgtctgcctaagtagagacacccccccaccccccatctagcgtatcttc
tcattgagctcctttctgtcaattggtggcagtttatggattcgcacgagaagaagagac
aattcacagttagcattattttaccttctgtcttcacagaggtatatgttgctgttttgt
gagacatctctgaggttcaagcagtcaataaaaccagttttgatcttctatggggagcta
ctattattacttgtgtcttagttgagcaagtttacttcctatgggatcactattcaacat
gtgaggttaatcttggcacttgttttggtatgtgttgtataatgggcaatttcattttgc
attttagGTTTGGCTTTGTAGACTTCAACAGTGAGGAAGATGCCAAAGCTGCCAAGGAGG
CCATGGAAGATGGTGAAATAGATGGAAACAAAGTTACTTTGGACTGGGCCAAACCTAAGG
GTGAAGGTGGCTTTGGAGGCCGTGGTGGAGGCCGGGGTGGCTTTGGAGGCCGAGGTGGTG
GCAGAAGAGGCCAAGGTGGATTTGGTGGCAGAGGCCGGGGAGGCTTTGGAGgtaaggagg
ctgggggagggacttccttgtaatatgcattgaacttgtgtggcatatgcacttcagaat
gtgctcagaactccgggttccctggatcaatctcccaagttctcatatgatcactctggg
gaggggaggactcctggcagctttgtactcattctttaatgatgttttgctttcctatag
GGCGAGGAGGCTTCCGAGGAGGCAGAGGAGGAGGGGGAGACCACAAGCCACAAGGAAAGA
AGACGAAGTTTGAATAGTTTCTTCCATCCCTCTGTCTTTTCCTCTTCTGTTTGAAAGAAA
AGGACTCTGGGGTTTTTACTCTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCC
AAGACAGTATGCAGTCCTGTGGTCTACTTGGAAATTCGTATAGATAACATTTCAAGGGAG
ATACCCTGTTGGTTTTGACTGGATATTCATATAAACTTTTTAAAGAGATGAGTGATAGAG
CTAATCCTTATCTGTAAGTTTTGAATTTATATTGTTTCTTCCCATGTACAAAACCATTTT
TTTCCTACAAATAGTTTTTGTTTTTTTTTTTTTTTGCGTTGGGGGGTGTAAAGGAAAGCA
GAATGTTTTATCATGATTTTTGCTTCAGCAACTTTGGGACAAATTAAAAGTCCTAAACTC
TGgtgccagacttgtacttcctcctggactgtccctgaaggtggagcatggcaaagccag
ctctgccactccagatccagcccaccacccctgctggaaataattagttggtttcaagca
tcctggctacaagttttggtgaaatggctggtaaggtaacatgaaaggcttgtatttttt
gtaagtcctccaacaacttcaggttaaactaacgagaagggtcttagatattaacactat
gttcagtacgccctcatttaagtactccttgtcccctctgcctctactaataaaagttag
gggccacatgaaaagtctttgccaagggattaacaggattactaaacagtgccccagatg
ctacagagcagagatttttttttttttttttaagatttttatttattcagagagagagag
actgaggcagagacataggcagagggaatagcaggctccatgcagggagcccgatgtggg
actcgatctggggtctccaggatcacaccccaggccataggtggcaccaaactgctgcac
tactggggctgccctcagagcagagatcttaaacctagctatccaaatccaaaagcccgt
ggattgtaaccaactgttttagaatcatactagtccttgccaaatcaagttgtagaaggg
gcacctggccagtagagcatgcaacccttggtttcagggttgtgagcttgagccccacat
tggatatagaggttacttaaaaaaacttgaaaatagtgtaaacacacactctacactggg
aggatttgttcagcttagaaggcagtctaaagcaaataaatggacagttgattttgtcct
gattttcactacggggtgaggaaatctaagctccacatacctgtgactcaaaccagttct
gttggaagtactgtgggagtagacagatggcctgcttggagggtgagagtgccagtggaa
gtttgctgctgggaagaaaggtcaaactagcagaagggtatt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2169..2285, 3468..3951, 4327..4533, 4759..4845, 5038..5179, 5683..5807, 6348..6471, 7370..7527, 8007..8130, 8376..8509, 9096..9222, 9607..9830, 10020..10501
1001..1018, 2169..2285, 3468..3951, 4327..4533, 4759..4845, 5038..5179, 5683..5807, 6348..6471, 7370..7527, 8007..8130, 8376..8509, 9096..9222, 9607..9830, 10020..10096
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved