Canis_familiaris Locus ENSCAFG00000006810
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000006810
Canis_familiaris
ENSCAFG00000006810
25
SNORD102, SNORA27
3714..3784, 4058..4184
6366
GAAAACCGTAATGAATAAAACAACCGCTACCTACAAATTCCATACTCAGTTTGCTTAAT
AATGGTCAAAACAGTAAAAGCCTCTTTTACTACTTCATGATTCCTTCCCTACCGGACATG
AAATTTCTAAATTCGATTTTTACTCCCTTTTATTTCTTGACTCCTTCCACTCATCTGCAT
ATATACCTAAGCAACACATGGTACTGTTTTACATGTTTTAAGATTCTATGTATATAAGTT
GTCACACTATGTACGTCCTACATCTTGCTCTTTTTTTGCTTCGTATTTCTGGGTCCAGTA
TTGATGGACTGGCACAGTTCCGTTAAAGTATCTGTTCTCTTCCGTGGATCTTGCTAATTT
CTTGCTTCTACTGACAGTGCTGGCTTACATGCCAAAGTTTCTACAAGCTACACACTCAGG
AGCAGAACACTAGGGTAGACTATTTGAAATTTTGCCAAATCGTTTTCAAAATGGACGTAA
CATTTACGCACACACCGGCAAGAGCGTGGTGTATCTTGACTCATAAAGGAAAAAAAAAAT
CGAAAGACATACAAACTGGAATAATACGTTTGCCTCATTTACAATCTGTCTCTCGTGTCC
ACGTAATCATTTCCGCAAACAAACACAGAGCAGCTCCTAGCCCCGCAAAGGCGCAAAGGC
GCCATCACACCAACCTCTCCCGGGCCCCCGGAGACGCCAACGCCGACGCCGACGCCGACG
CCGACGCACGCGCGCTTCCGGCGTAAGCTCAGCGCAAAGGCGAACGTCGGCACGCTCGGG
ACGTCGGCGTCGTGTTGGACGCCCTGGAAGGCCCCTTTCCGGGCTGTCTGGAAAGCTCCA
AATGTCAGCTTGTGTTGGTCTATTGCCTCTTTTCCACAGGAAAGAAAAATATTCTGACAG
GCCCTCCTTGTTCTCTGAGCAGGACCCCCTTCCCCAGAGAAGCTGCGTCCGCCTCTCATT
TCATTCAGGCAGTGCTGCGGGCAGCCCGTCGGCCCTTGTAAGGAGCGCGCTGCCGCCCCG
CCTCCTTCCTTTCGGCCGGAACCGCCATCTTCCAGGTAGGGCCTGCGCGTGGCTCCCGGC
GCCGCGTGTCCCGTAGACTGGGGTTCTGAGCCTGTAAGCGGTGCTCCCGGCACTGAGGTC
CTAGGGAGACGGTGTAGCCTGCCCGGGGCCCACGGGCCGGTGGAGGCGTGGGTGGGGGTG
GGGCTGTGCTCATCCAGACTGGGTCTCCAGGGCCGGGGGCTGAGCGCCAGGCCGCGCCCT
GCGCGGGGAGAGACTCGACGGGAGCGGAGCCCAGGCGCTGGGCCGAGGCAGCTCGGTCGT
TCTGGGAAGGGACTTGTTTTCCCCGTGTCCCCACGGCTTCAGCTTCGGCCTTCTGGGCCT
CGGACCAGGTTGTGCGGGGCCGCGGGGCCCAGTCCTTTGCGGCCTCTTCAGTGTGGGGTT
CTGGCCTCTGCTGGGAAGCCTGGACTTGTGATGCTCGTGGTTAGGGGCTTCGGGAGCGGG
GGCCGGCTGAGGGGCTGTACCCTCCGCGAGGCCTGGTTGTGTGAGGAAACCTGGGCGCGC
GGCCCGAAACCGAATGCTTGCCTTGCACGGTGAGAGCCCCAGACCAGCGCGGCGTCGGCG
CGTGACAGCCTCCGGCGGTTTTAATGTGGGCCTCAAGTCGCCTCGGACAAACGGAAAGTG
CTTTCAGGTTGCCGCGAGCGTTCTGTTAACGTCGGGGCAGCATGTGGATAGCTGTGTGTC
CCGTTTGGAACTTTGGGGGAAAGTCCGTTGCTGTTTATCCTTAGTTTTGTTTTGCTTTGT
TTTCCTTTTCTTTCTTTCATCTCGTTTATAAATGTTCCCTACCAGAGGTGAGCAAACTGC
AGGTTGCATTTTATAGTGGATCCTGTTTGGTACTATTGCAGAATCTAAAAGCATCACTGT
TTCCTACGTTTATTATTGTGTTGGTTCGCGGTGGGGCAGATTTTTTTCTTTACTGGGGAA
AATGGGTCTGGTGGAAGGAGAATGAACTCTGCAGTCAGGAATTCCTTCGCATTTCTGAAT
CTGCCACTTAGTGACTCCATGAAGCGATTTTGACCTGCAGAGTCTCTCTCCCTGTTTATG
AACTTGATACTTCTGGTATGAGTTGATGCAAATGTAGAGAATCTGAGAATTAAAGCAGGA
TATGGGGCTCTTAATAGATGCTTAGTTGCTTTTTTAAAAAGTAATGGATGCGTCTGTTGT
AACAATGATTCGGCCTCGGTGGGTTAGGGGAAACCTTGTGTCTCCTTACCTTCCATGCTA
AAGGAGTAAGGTACTTTGGAGTCCTTTGAAATGATGTCAGTAAGAGACTGATTTATATTA
CAGTGCCTTCAGGTTAAGCCTGACTTTAACGTAGATTTGCCTTGTAGTAGGAATAATTCT
CAATAGTGGTAGTTCTGCCCTCAAATGACCTAAAGGAATAAAATGTCTATAAGGGAAGGG
GTTTAATCCACCATGTGAAAGTGAAGGGCTGAGTTGTCTTAACTCCAACAATAAATTAAC
CAACTAGTTAGTGATTCCAGTGCCTTTAGCATTCTGGGCTGGGTTCTACCACGAATAGCA
TGGTTTCAGAAGTTTGGATGTGTTTTTTTATATTCTAATAGGGAAAGTACTGGTGTGGGT
TCTAAATTCCAGTTCTGCTATCTAGTAGCTTTACTGTTAATATAAATTCGGCAGTTTTGC
CAGAAATCTTATGTGCCAAAATGATGGGGTTTTACCATTTATAAGAAATACTGATTGGTG
AGTCAGCTTGCTACATTTCTTAATTCTGTTGCTCCTATAGTGCAAGCATTAGACGTTTAT
AGGATTGTTTTTTGTTTGTTTGTTCGAAAAGACAAATGTCAATTTTGCGTTTGCATTTCA
CTTTTATGCTTTCTATTTTCAGTAATTCGCCAAAATGACCAACACAAAGGGAAAGAGGAG
AGGTACCCGCTATATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGTAGATTTATCCTCT
TAGAGAGCAAACATAGCGTACAGTCATACAATGCATTCTTACTAAATGACATTAATTAAT
GGCACCTTCCTAACTTATTTTTGTAATAAATGAAAAGCATGAATTTCATATAGTAATTTC
TTACCAGCAAGATTTAAAAATACAACTGTCAAAGATAAGTATGTTGAAAGCTAGTAAGCT
TACGTGTTTCTTTTATACTCTACACTTTTTAATCTTGATACTAACTATACTGATTTTTTT
GGGTGCAGGAGTTGTTCCTTTGGCCACATACATGCGAATCTATAAGAAAGGTGATATTGT
GGACATCAAGGTAAATTCTAAAGTTGGGTAAATAGCCTACAGAATAGTATTAGAAGGTAG
AAAAGTTTAGTCTGGTATTGGAATTCAAATACTGATGTATGTTGAATCTGTTGGCCTTTT
TTCCTAAATTGGGAAAATCTTCAGTCCAAATAAGAGCTCATAAATGTAGAATGGCTAACT
TAACTTTCAGAAACCAGGGTTATTTAAAGTGCTGTTCTTGAATCTAAGAACTTTTGTCGT
TACTTGTTAACAGGTTGTGGAAAAACCAAGAGTTTGTTGACGTGGAAAGGGGTAATAGCT
TAGTGCAAAATTCAATTGTTAATGGAGATGGAGGGTTTTTTGTTTGTTTGTTTTGTTTTT
TAAACAAATTCTGATCTTTTGTGACCAGTATTCAAATGTGTCCTGATACTCTGGAGCTTA
ATGATGATTGTCTTTTTGATTGCTTGAAGCAATGTGAAAAACACATTTCACCGGCTCTGA
AAGCTCTTGAGTTGCCTTTAAAAGAAAATTTTAGAATATCTTAGTTACTTTAATAAGAGT
CCAGATATAAAGGGAAGGGGACATTGCTGGCATAACTTTCATCTCCTTTCTTAACAGGGA
ATGGGCACTGTTCAAAAAGGAATGCCCCACAAATGTTACCATGGCAAAACTGGAAGGGTC
TACAATGTTACTCAGCATGCTGTTGGCATTGTTGTAAACAAACAAGTTAAGTAAGTAATA
CCAGGATTCTTTCTCGCTGATCAGTATCCCCTCATACCTACCCCCTTTTCACTTTGCCAA
TTGGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAATGAAATATCCTTTTAAAACTC
AAGCAAACTGGGTGTTTGCCTTGTATCCTGTCAGAGGAAACAAATTGAACTAGACTTAAG
TAAGGGAAAGTTTGATTAGCGTTTGGTGATAAGCAGTTCGAGTTTTCGGAATATAAAAGT
ATAATTAGTAAGTTTAGATCTGGTTTTGGTTAAATAATATATCAAGGTCTGTCACCTCAT
CAAAGGAAAGCTTAAAAGTTGGGGATTTTGAGGGCATATATGTGACACAATCGGTTAAGT
GTCTGACAGTTGGTTTTGCCTCAGGTTGTGGGATCCAGCCCCGAGTCAGGCTCCATGCTT
AGCATGGAGTCTGCTTAAGACTCTTCCTTTGGTCCCTACCCCCAGTAAATAAATAAATCT
TTTGTTTATTTATTTTTAGAGAGAACGTGAGCAGCGGGGAGGGGCAGAGGGAGAGGAGAG
AGAAAATCTCCAGCAGACACCTCACTCAGTGCAAAGCCCAACCTGGGGCTCGATCTCATG
ACCCTGGGATCATGACCTGAGCCAAAACCAAGAGTCAGACACTCAACCAACTGAGTCACC
CAGGCACTCCTGTAAATAAATCTTTTTTAAAAAGTGGAGATGTTTGCTTCAAGGCCTCTT
CCAGTACGATTAATGGTTATAAATTATCCATCACCTTGCTGAGTAATCCTATCTCTTGGT
AAAAGGTTCGTGGTTTATTTAATAAATGAAACTACCAAATAAAATTGGACTGTTATATTT
TTGCCAAAGCAGTTACAGGAATGTTTATTCTCCCCAGGGGCAAGATTCTTGCCAAGAGAA
TTAATGTCCGCATTGAGCATATTAAACACTCAAAGAGCCGAGATAGCTTCCTGAAGCGTG
TGAAGGAAAATGATCAGAAAAAGAAGGAAGCCAAAGAGAAAGGTACTTGGGTCCAACTGA
AGCGCCAGGTGAGTGCTTGACACAGATGGTTTCTTGGTATTGACCTTGGGAATTTTAAAA
CTTGCTCCAGTGATAGTTTTCTTTTATATGAAAGTTAATGAAAAAAAGTTGATGAATTGA
GTATGTTACTTGTTTCTGAGAGCACTTTGAAATTGACTACTGTGCTTGATATAATTGTTC
TTTGCATTTTTTTTTAATAGCCTGCCCCACCCAGAGAAGCACACTTTGTGAGAACCAATG
GAAAGGAGCCTGAACTGCTGGAACCCATTCCCTATGAATTCATGGCATGATAACTGTAAA
AAAAATAAAAGACCTCACGATTGTAAAAGTGTTTCTCTTAATTGAGTAGGAGTGTGGTTG
GTGTCCTTTCACTTAAAAAAATATTTAAAGCAAACTCTTGTTCTAATTCATTGGGTGATA
TTTTTATTCAAGGTGGGAGGTGGTTTATTGTACAACAGAGTATGCTTAATTGGTTAGAAA
ACTGCCAGGTATTACTTTGAAAATATTTATAGTAGTTGGGAAATAGTCCCTTTAAATCCC
TAAGGGAAAAAAAAATTAAATACATGAAAGGTTACCTATCACACTCATTACATTTAAGTT
CAGGGATAGCTACGAGTACTTGTAATTGTATCCTGTCATACATAGCTGTGTTTTGAGGAT
AAAGAACTTGCCTTTGAAGTCAACTACTTATAAATAGATTGTTTAAAGCACTGGTCTGGT
TCCTACCAAATTGTTTTCCCTGTCATTTCCTGTCACAATTTTCCTGTATGGTGCTTTAGC
TCTTAGGAAAACTTTGTTTTCTTGGAGGTGTTCTTTCTTACCCCAATTCTTTTGCACTTT
CCTTTGCCTGAAATACTTACACTTTAAGTTGCTGAATTTTCTCATTTCATCTTGAGTGTC
ATAGGTGAAACTTCCCTGATAAGAGTATCTTAAGGAGAGGAATGAAAGTGCTTGGAATCA
GGAGAAAAATTATTTCTGATTTGGGATAGTAGAATAAAGTCCTTACACCTGTTCCCACTA
CAGATGTGTTTGCTTTTTTTATGATGTTTATAATTTTTAACATGTTCTCCATTAAATCTG
ATGTTAGAGACTTAGTAAACTTTGCCCTCCTAGGTACTGGCACATAATAGGCATTGCATA
AATGTTCTTTGAATTGAGGTTTTTTGTTTTTTAATGAGCAGATGTTTTCTATTTCTGTGT
TTAACCTTGTTTTCCTGTGGATTTTATCAAACTAGAATGTTTTGGATTTTAGAGGGCTCC
TAACCATTTTGTAATTGGGATTACTAAGTCTCCCACATGATGTGGAAAGATCAGGAAACC
TCAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 2902..2980, 3242..3309, 3897..4009, 4897..5047, 5240..5366
2905..2980, 3242..3309, 3897..4009, 4897..5047, 5240..5326
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved