Canis_familiaris Locus TPT1
snOPY snoRNA Orthological Gene Database
Canis_familiaris TPT1
Canis_familiaris
TPT1
22
SNORA31
4372..4501
5779
CATGAATAAATACAATCTTGAAAAAAAAGAAAAAAAATTTGTGTGAAAAATTGTGTAAA
AAATCTGGTTTTAACTTGCTCACGATTGGGAGCTCCGTACAAAACCCGGTGCCACGGACC
TTGCAGGGCATAAAAGTATCTGTAGAATTTAACGAGCTCTCCGGTTTCCCACCAAAACGG
AAACAAAACGGCTTCCTTGAGCGTTTGCTCCGAACCGGACACCTGGACGTGAAGTCCCCC
CAGTTCCGTCCGACTCTGTGGCAGCTGGGCTATCCCTTCGAGGTCATCTTCGAGGTCATC
GTCGACGGACGCTAGAGCTCTTTTTTTTTTCTTTCTTCGCTCGGAGGACAGGGTCCAAGG
CCAAGCGCAAAAAGGGACGGGCAGGCTCCGCAGCGGCGTCCCCGACGGGCCGCGGCCTCC
TCACGCGGAAGCCCGCCGGGAGCCCCTCCCCCTCCCCGCCGGCGGGGCCACCGCAGCCGC
ACGGGGCGCCCCGAAACCGCGGCCGGGCAGGGAGCCTCCCCCCGCCGAGGGCCTGGAGCG
AGGCCGACTGCCCCGCGCCCCACCCCCTCCCCGCGGACGGCCTCGCTCCACCCTCTCCCC
GGGCCCCGACCTTCCGTAAACGCCAAGTCCTCCACGGCGGCTCGCTTGTGTTCCCGGGAA
CGGGCGGGCGCGGAGGCCTGAAGGGCCGCCATCCTCCTCGAAGCCGCAGCAGGCTCGGCA
CCTCCGCGGGGCGGGGAGGCCGGGACGCGGGAAGCCGCGGGAAGCCGCGGGAAGCCGCGG
GCGCGGCGGAGGGCGCCATTGTGTCCCCGCGGCCAAGTCCCCGGATGCTCGCCGCGGCCC
CGCCCCCCGCGCGGCCGTGCGTGCCACGTCACCGCGCGCGGCGCTTCCGGAGGCGCCGCG
GGCGATGACGTAGGGGGACGTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGGCCTT
TTCCGCCCGCTCCCCCCTCCCCCCGAGTGCCGCTCCGGCTGCCGCGCGCTCGCCCCGAGC
TCCCGGCTCCTGCCAAGCCCGCGCCGCCGCCGCCCGTCTCCAGCCGTCGTCATGATCATC
TACCGGGACCTCATCAGCCGTGAGTCGTGGCTGCACCCGCCGTGCCGCCGCGCGCAGGGG
CCCGGGGGAGGCCGCGCGGGGGGCGGGAGCGGGGAGGCCGCGCGGGCCTGGAGGACGCCG
GCCCCTCTCCGGGGCGAGGAGGGGTCGGGCCCGGGTGGGGGCCGGGGGCTCGGGCGCGCG
GGAGCGGCGGGCGCGGCGGGAGCAGCCGGGCCCGCGCGGGCGATGGCGGCGCGGGTCCCC
GAGCCCCGGGCGCGCGGTGACGGGCGGGCCTGTGTCCCCGAGCAGATGACGAGATGTTCT
CCGACATCTACAAGATCCGGGAGATCGCGGACGGGCTGTGCCTGGAGGTGGAGGGGAAGG
TGAGTCGGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGAGGCCGGGCGGGCTCGGGTTTC
CGCCGCTCGCTCCCCCGCCCGCGGTTGTGCAATCCTCTCCGCTGCCTCCTGGCGGAGGGG
ACGCTCTCTTCCGGGCTCTCGGGTTTTTCTAGAAAAGTGGAGGCGGAGCTGAGCCTGGAA
ATAGGTCCCCGCCGCCTGGCGCCCATCCTCCTCCCGGGCGGCCGGCCTTGCCGCGCACCC
TCCACCGGGGTGTGAAGGGCCCTGCCGCCCTTCTGGCCCAACAAAGAATCCTTGTTGAGT
CTCGGTGTTGGAGGAATTTCGAGGGGCGTGAGCGTTTTATTTTATTTTATTTTTCTCTTT
CTCTACGACGCCGTCTTCGTGGGTTTTAGCAAGAGTCCGAAGTGTTGGGTGGGAGGAGGA
TTGTGTGAACTGCTGACCTAGAAGATCTAGTGGGGAATGCCTTTATGCAAAGGTCCAAAA
CGTCTGAAACCGGACTTTTTTTTTTCTTTTCTCCTCCTCCTCTCCTTAATGTTTTTTTTC
TTTTCTCCTCCTCCTCTCCTTAATGTAGATGGTCAGTAGGACAGAGGGTAACATTGACGA
CTCGCTCATTGGTGGAAATGCCTCCGCGGAAGGCCCGGAGGGCGAAGGTACCGAAAGCAC
AGTAATCACCGGTGTTGATATTGTCATGAACCATCACTTGCAGGAAACCAGCTTCACAAA
AGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCGTAAGTGGTCCTGGCGCAGCC
CACCCTAAGGTCAGCCCTGCGGGATTTGGGGATAAGGTAACCTGGAGGTTCTTTAGCAGC
AGGCATGCTTGGGAAAGGCTTTCTTGTTGATGAGCTCACAGACTGATGCCTTCCTATAAA
TAAACTAATGTGAGCATACCGCAGCTGGAAGTGTGGTTTTAGCTCTTCAGAAGTACTTTG
GGAATAACTTGAAACCCTAAATTGTCAAGACTTGAAACTTTCATTCCTGTGAGCTAGTAG
TTTCTTGATTGTGCCATGTGAATTTTTGCCCGGTGACAGCCAGCTGCCCTTTTCAGCGCT
TGTTTGTTTGTTTTTTTTTTTTTTTTTTTTTTACTGAAAAAATTTGTTTTGCTGAGAACT
GAGTACTTTAACCTGTCAATAAAATACTGTTTTAGAATCAAAGGCAAACTTGAAGAACAG
AGGCCAGAAAGAGTAAAGCCCTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTT
GCTAATTTCAAAAACTACCAGGTAAATACTATAAATGTTTCTCAGAATTGTGCAATTGTA
ACTGCCAGAGCAACAAATGACTTGATAAGTCGCTGATGTAACGGGATTATTTTCTGGGTC
TTCTGAGCAGTTTAAATACTTCATAGATTCCTTTCCAGTAGTCTTCACTGTGGAAAGTGG
CCTTTCCTGCTCCCAAGTGTGTTTCTAGATCTTGCCTGCTGATTGTAGAACCTCATCCCT
ACTACTCTCCAGATGACAGGTTTCATTTCTCCCGGTCTAGAATTGCTTGGTAACCTCCTG
TCTTTTTATTTACAACTCCAGTCTCATTGCCCCTGGAGTTCTTTCTACACTTCTGTTGGG
AAACTCAGTGACTCTCCCTTGGCGCTTTATAGAACTTAAAGAAAAAAACTCCTTACAGCC
TGGCTCTTTGACTTTCCAGCTTTCACAAGTCCTCTGGCCAGAAGATAACTTTCCTCCTAT
AACCTGCTCTCTCGCTGTTTGATGACATAAACAGGCTTTTTAACAGAGTTGGAATTGTAT
ATGTGGGGTTGAGAGAGTGTTTCCAGAAAGCCTGAAGTGTTCTGGATTGCTCTGTACTCT
GGTCAATTGTTAGTGTTCTCATTTGGTGAACAGAGGTTTGAGTAGTAGTTTTTTTTTCCT
TTTTTTTCTTGTGAAAATCTCTTAAATTGTGTTTTGAATCCTTTGTTTTACTGTAGATTG
TTTTGATACGATCTGTATATAATGGCCTAATTCTGGGTGTTTGTTGTTTGCTCCCTAAGT
TCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCACTCCTGGACTACCGTGAGG
ACGGTGTGACCCCTTATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTGTAA
GTATAAGGAAGTGGGTTGAAATCAGTAATGTAAAAGTGGAGACATCTTCTGTGTGACTGT
CTCTTGCTGTTGGGTAGTTAGAATGGGTTTTACAGCAGTCTCCACAATGTAGGTCCAACT
CTGGTTTCTCTTTGGGAGTCTAAAAGGGTTGTGTTTTGCATACAAGATTTTTACGGCACA
GAAAAGGCATTTAGAAATACAGAAAGCTTTTCATGTAGATGGCTTAAATCCCAGCTTATG
TACTAAACTGGAGATAAACTGCATTCTGTTTTTTTTTCCCCCCATAGAAAGTCTTTCTCT
TCGTATTTTGCCACGCATACGTGCGTGAGTGGCATGTATGGCGCTAGGCCTTTTTCACTT
TGGTTTACTGATGATTGGCAACTGGTCACTGGAAGCCTTGATGTTACTAACTTTTAGTAA
ATAAAGTTAGAGCTGGCTGCTTATCCAGTATGCAGAATCCTTTAGTACAATTAAATGAAT
GTCTACTATGCAAGGAATTATTGGAGGCCGTACAGAAATGAGAGCATTCATTATTCTAGC
TTTCAGAGGCTTCCATATAAATTAGGAACAAGATAAACTTGAGGCTACCCTAAATAAGAG
AAGAGGCCTCAGCGGACAAAAATGTCTTCAGATTGCATGAGCTGCTACGGAAAGTATTCC
AGGAATATCTGCGGGTTTTGTTGGTAGAACAAAAAGTATGTGTGTGAGTGGGACTTGCTT
CAGAATGAGATTTTTTAGAAAATGTGCCACCCCTGCTTTGGTGAGGATAGTCCTGCATCC
ACTGATAGACCTTGAACAATTGGCTGTTGTTCTTTTGGTTTGCACTAGGATGCAAGAGAA
AAAAATCCCTGCGCTTTCTGTCTGTCCCTGTGGCAGCCCAGATTGAATAGGGGAGTACAT
CGGTGGCGTGGAAGGGTTAACTGTTTTCATACTGGATCAAAGTGGATTAATACCCTGTCT
TGTTTCTACAGTAACGAACTTGGCTGTTAACTTTGGATGTATCACCTGTTGTCCTAACTG
GCTGCTGCTCTTCATCCACACAACACCAGGACTTAGACAAATGGGACTGATGTCATCTTG
AGCTCTTTATTTTGACCTTGATTTATTTGGAGCGGAGGCATTGTTTTTAAGAAAAAAACA
TGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCATTTGAGAGAATGCCTCTTA
GTTTAACACATTTTTAAATCCATTCTGTGTAGTGTCCTGAAGAAGCTAGAGCCTGGTTGT
AGACTACTGCTAGAAAGCATAAGACTGCCTGCAGATAACTTCTACAGTGAAAGCTACTTC
TGGGACTGGAATATAAAAAACAAGAACCAAAAGTCTTAATTCTGAGTTCAAGTAAAGGGA
AAGACCATGCTCATAGCTGGGCCAACATTTGAAGTGGATTCCTTACACATTTCATCACCT
ACAAACGGAAGTAGTTAACTCTGGAAGAGATTGCCAAAAGAATAAAAAGAGACTAATAAC
AGTTGGAAGCAAAGTATTGTCTGATCTTATTTATCTTAAGTAGAGCCAAGTTCTAGAGAA
ATCTAGACATCTCCTGGAATGCTTGTGTCAAACTATCTGGAATGGGGCTGGCAAACTGGC
TTGTCCCGCCACTTGTTGGGTGACTTTTAAGGTGTTTATATTTTTTAAATGGAAAAAAAT
AGCTGGTGGGATATGAAAAGTACGAAGACTTAAAATTTGTATCTGGTTTTTTTTTGAACA
TTGCCATGCTCCTAAGAGCAGGGTAGGACAGACCTTAAGGCCTACATAGTCTAAAACAAC
CATGTGACTCCTTAGAAGGTTTGTCAGCCGTGCTTTAAAAGATGAAGTTGTAGATGGAAT
GTGGGATAGCTGGTTGTGTCCTGTTGTATCTGAAAGGGCTATGGGTGTCTGAAGGAGAAT
AAGGAAAATGCATCCATGTGACAGACCTAGAGCAGTTTCTATCTGCCTCTAAGGTTTCTG
CTAGAGATGCAAGAAAAAGGTATCCTCGCGCTTTCTAGCTGCCTGACGGTGGCAGTTGAG
ATTGAATGGGGGAGTACAGGGAAAAAAACTGCAGCTCAGGAGTGACTTGGTTAACAATGA
AGATCTTGTTTACTAAAAGGATCTAAAATTGGAGTTTACAAGAAGTGTTGGAAGATGGCT
TCCCAGATCCTTGCCTTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 1365..1438, 2008..2198, 2615..2720, 3479..3595, 4571..4779
1071..1098, 1365..1438, 2008..2198, 2615..2720, 3479..3595
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved