Canis_familiaris Locus ENSCAFG00000019044
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000019044
Canis_familiaris
ENSCAFG00000019044
7
SNORD58, SNORD58, SNORD58
1418..1483, 1850..1915, 2863..2928
5958
AAGTGGAAGACCCAAAGCCAAGCGCTTAAGTAACACCACCAAGGGCTGCGAGGGAATAA
CCGGATAGAAGACTTGAGCGAGTAGACTGGGGAGATAGTGCCAGGGTTTTTTTTCTGCAC
CAGAAGACCTAGAAATGTCATTCTTCAACCACTGAACTACCATTGACTTGGTGATCGTCC
CCTTCTGAGACTTTCCTGAGGATCATGATCACATCCCATCCTTTGCATCTTCTTAGTTGT
CCATTTGCCGACCACTCTTAGGGGTACATGATCACATAATCCAATCTAACAAATGCTGAG
AAATAAACGCCTCGTCTATATCTCATACATAATACGTGGTCCTGTCCTAGAGCTGTAACC
CTGTTTTTAATTGATTGGTATTTCAATTTTTTCTTTTTTTTTAATTTATGATAGTCACAG
AGAGAGAGAGAGAGAGAGAGAGAGGCAGAGACGCAGGCAGAGGGAGAAGCAGGCTCCATG
CACCGGGAGCCCGGCGTGGGATTCGATCCCGGGTCTCCAGGATCGCGCCCTGGGCCAAAG
GCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCCTTGATTGGTATTTCAAATCCATAA
CTGCGTTTCTGGATACGAAAAAAGGAGAATATTGAGATATTTTTTAAAAGATTTGACTTA
TTTATTCATGAGAGACATGAACACAAATTACTCATTTATTGACAGAGGGAGAAGCAGGCT
CCACGCAGGGAGCCCGACGTGGGACTCGATCACGGGTCTCCAAGATCACACCCTGGGCCG
AAGGCGGCGCTAACCGCCGAGCCACCCAGACTTCCACGTTTTTTTTTTTTTTTTTTTCGT
TTTTTTCTTTCTAAAGGAGTGATGCTCTTACAGACCCTCTAAAACGTATTCCACATTCCC
TTTCTCGCAGCGCCCCGCCTCCCGTCAGATCACGTTCTTTCGGGAGGAAATCTCGCGAGA
GGCCGAGTTCTCATGAATTCTCCCAGGAGCCACCGCTCTTCCTCTTCCCCCGAGCGGCCT
GAGGTGAGTGTCGCGGGGCGGTGCGTGTCCGGCTGCTGAATCCCCCGCCATCGCCGCCGC
CCTGACTCCGGCGGCCTCGATGTCCAGCCCCCGGGAGGAAGGCTCCTGCGGCTACTGATT
CCCGGCCGAAGGGGATGTCCCTCTTGGCGGGGGGACGTGTCGGAGCCGAAGGCCGCGATG
GGCGAGAAGGGGGGTTGCGGGGGTCCCGGCGGCCTGTGGTCAGGGCCGCTTCCGAGTACC
GGGCCCAGAAGTAGCGGGAAGACGGCCGCATCCTCCCTGGGGGGCGCCCTGCCGCGCCGA
GGCCCCCGCTTCGGAGGGGGTCGGGGGCGCCGCTGAGGTCCCTGTCCCCACGCTGTCAGC
CCCGCCGCAGTCCGGGGGACGCCAGGAGGAAGGCCCGGCCGCGATGATGGCATTTCTTAG
GACACCTTTGGATTAACCGTGAGAACAGCTATCAGCTGAGCGGCCGTCGCTCGTAGTCGA
TGTAAACTGCATCGGCGACCGTGAGCTCAGGGTTGACGGCATCCCTTCCTGCTCCCTCCC
CAGGTGACCTCCGGAGATGGTTCGCTACTCGCTGGACCCAGAAAACCCTACAAAATGTAA
GTGAGCCACGAGTTCCTTATTAGGGGGGGGAGGTGGGTGAGAGGACCAGCGAGGCACCCC
AAATTAGTCAAGACCTACTGGTTTTGCGTTTCTTTGTTTTGTTGCTTTCATGTAGCATGC
AAGTCGAGAGGTTCAAATCTTCGTGTTCACTTTAAGGTATGGGAATCTTTAATGTTTTAA
GAGTCGTGCACGTGTTCCTGCAAGGATTTGCTGCTGCTTTGAAAAGGTGGCTGCGGTGAT
GCATCTCTTAGGACACCTTTGGATTTTACTATGAAAATGAAACTGTTCTGAGCGGTCACC
TTTGGGATAGTGATTAAAATCATGAGCCCTGTAACAAGCACGTTAATTTTTTTTTTTTAA
TTTTTATTTATTTATGATAGTCACAGAGAGAGAGAGAGGCAGAGACACAGGCAGAGGAAG
AATCAGGCTCCATGCACCGGGAGCCCGATGTGGGATTCGATCCTGGGTCTCCAGGATCGC
GCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCAACAAGCACGT
TAATTAAGGATTATGGAATTGGGTAAAACTGCAAGAGAACTGCCTGAGAAACGAGCACAG
AGATAAAGACAGAGGGACACAGAATTACAAGATCCTGGGATTAAAACTATACAGTCAGGA
ACACCTGGGTGGCTCGGTGGTTGGACGTCTGCCTTCCGCACAGGGCATGACCCCCCCCAG
GGTCTTAGGATGAATTCCACATTGGGATCCCCGCAGGGAACCTGCTTCTCCCTCTGCCTG
TGTCTCTCATGAATAAATAAAATCCTTTTTAAAAAAATCATAATACAGTTAATAGAGGTT
TGGGATTTATTTTTCCCTAACTTCAATCCTCTATGGCTTTTAATCAGATTTTCTTTTTCT
CTCATTTTACCTCACCCTTCAAGAATGGGAAACCTTTATGTGTTGACATTTGGAGAAGCA
GAGAATTGAATGCTTGCCTGAAGAATTGTTAATCCCTGAGCATGGTTAACTCGCAATTTT
TATTCTTTATGCTTAGAACACACGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCG
AAAAGCCACCAAGTATCTGAAAGATGTCACTTTGCAGAAGCAGTGTGTCCCATTCCGTCG
CTACAATGGTGGAGTTGGTAGGTGTGCGCAGGTGAGAGTTCATAGTTGCTATCTGAAGTC
TTTAGGTGGGGTAAGAACCCACCTTTAATCAGGTGCTTTCTGGTTGCTGTGATGACCATC
TTAGGACACCTTTGGATTAACCATGAAAAGAAACTGTGTTCTGAGCAACCTTGATAGTCT
TGCTGTAACACTGATTTAAATTGGGGAAAATAACTGATTGCCTCTCTTGAATTTCTTTCA
GGCCAAACAGTGGGGCTGGACACAGGGTCGGTGGCCCAAGAAGAGTGCTGAGTTTTTACT
GCACATGCTTAAAAATGCGGAGAGTAATGCTGAACTTAAGGTACCCAAACCATTAACATC
TTGATATGTCACAGTTTGGATGATTGTTCAATTGTTGTTGATGTTATACAGATTTATGTC
TTTTTCTTTCTCCGTAATTAAGTCCCCCCCCCTTTTTTTTAATATGAATCTCTACCTCCA
ATTTCCAGAAGACCAAAATTTTGCCTGTGAAGGTCTTCAAAAGCATGGTCTTTTTCCCTT
ATAACCCCGGTGCAAGCAAAAGAAACATTTTTACTCAAGGGTCTATGACTTTTCTGGTAC
CATAGACCCTTTTGGTTGTATGACTTGTGAACTTCACAAAATACTTGTCAATACAAATAG
AAATCATAGGATTACAAAGAACAAGTAAAGGTAACAGTGATTGCCTTAGTGGTTAATGTG
GTTTGTTGCCGATGTTCATAACGCAGAGGCATTAAATTTCAGATTTTAAAACAATGCAGT
CAACAAAGTGGGGTTTATCTATCTTGTGTATTATCCATTACCCTTTGCATTTGGGAATCT
AGACCAGAGCTGGAGTTAAAATAGGTCTGGCTGTAACCCTTCTAGCTGTTAAGGTGTGCT
GCCAAAATCCTGTTTTTCATCAAGGCTTAGAAATTGACACTATCACATCCACTCCCCTTA
ATGACTGTTAGTCCACTTACAAACTGCCTACAGCATTGGGTTTTGATGGTTCCTTAGATT
TAAGAAAGGATGCTTAGAATAAAGGTGGAAGCAAATGACTAAACGGATAGGCTATTTTTA
AAGTCTTAGGGATTGCCTTGTAAAGGTGGGGACTAGACTTTGCAGTGATTGGGTTTGTGG
AGTTGAGATAAAGATGCTGATTTGATTTCATTCTCCCTCTTCCCAGGGTTTAGATGTAGA
TTCTCTGGTCATTGAGCACATCCAGGTGAATAAAGCCCCCAAGATGCGACGTAGAACCTA
CAGGGCTCATGGCCGGATTAATCCATACATGAGCTCTCCCTGCCACATTGAGATGATTCT
TACTGAAAAAGAGCAGATTGTTCCTAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAGGT
AGATTACTTAGTTGTTGGTCAGTTTTATTTGTGTATGATATTGGCTTTTTTGTATTTTCA
TTATATCAGAACTATATAATTATTATCTGCTGATGGCCCTACCCACATGTCCATAGCCAC
TCGAAATGCAACATGTGTGAAAAATGGGCCCTTCCCTTCTTCCCCCCTCCAAATTAATAG
CTTGTTTTCAGTAGATGATCTTACTCAGCTCTTCAAGCTGGGAATCTGGGAGTAAGTCTA
GACCCCCTCCCTTCATGCCTAATGAACTTCTCTTGATTTTATTGCTTAAATATATCTCCC
CACCCCCCTATATAAAGGTTTAAGAGAGTGAGATGAGCAGAGGGAGAAAATCTCAAGCTG
ACTCTGCACTGAGCTCAGCCCTCCTCCAGGTTCAATCCTCCTGACCCTGAGTTCATGACA
TGAGCTGAAACCGAGAGTCAGACACTTGAAGTTTGCCATTCTTTTTTCTGAGCTACAACT
TACTGTGCTGAGATCTGGGAGTTTAGGGCCCCTGATTGGCTCCATGTGTTAAGCTTTTGC
TTTGGCTTAGGTCATGATTCCAGGGTTTTGGGATCAAGTCCCACATCAGGCTCTATTCAG
TGGGAAGTCTTTCCCTCTACCCTGCTTGTGCATTCTTAAACTTTTTTTTTTTTTATTTTT
TTTAAGATATGGTGCTAGTTTCTCTAGGAAACTTACTAACAGCTGACCTTTTATTCCCTC
CTCCACCCCCAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAA
ATTCTGCATAGAATAAATGCAAATAAAAATAAAAACAGTGTTGGTTGTCTTTTATTATTA
AACATACTTTGGGGTACGTGGGTGGCTCCGTGGCTCAGCATCTATCTGCCTTTGGCTCAG
GGTGTGATCCTGGGAGTCTTGGGATCGAGTCCTGCATCAGGCTTCTCACAGGGAGCCTGC
TTTTCTCTCTCTACCTGTGTCTTTCTCTGTGTCTCGTGGATCAAATGAGTTCTTATGAAT
AAAATAGTCCCGTGGGATCCCTGGGTGGCGCAGCGGTTTGGCGCCTGCCTTTGGCCCAGG
GCGCGATCCTAGAGACCCGGGATCGAATCCCACATCAGGCTCCCGGTGCATGGAGCCTGC
TTCTCCCTCTGCCTGTGTTTTTTTTTTTTTTTGCATCAAATGGAATTTGAGCATGGGGAT
ATTTCTTAATTTTTTTCCAACCACGTTGAGATTTAACATTGATGTACCCAACTACAATTA
AATCAATAGCTTCTATTTGATTATGCATGTCGCCTGGTAAATTTTTGTACATTTTCGTTA
TCCCAGAGGAACCCTGGCAGTAGTTTGGGGTCACTCCTTACCAAACCCTATACAGCCCCG
AGCAACCCTTAGGGAGGTTCACCTAGATTTGCCTTTACTGGCGATTACATGCAAACCAGG
TCACAATGTGTGGCCCTGTGGCCCTGTCTTTTTAACTTTGCGCGGTATCTTGAGGGCAGA
TCGGTCCTGCGTGTTCCCATTTCTCTTGGGTCCATACTAAGCAGAACTGAGTAAAGCCGC
CGCCGCCGCCAAACCCAGCAGTGCGCTCAGCCGCCCGGGGTGGACGAGCGCTTAGGACGA
TTCCCTGCCCTCGAACTTCCAAGCAGCAGAGTGAGCAGCTGAGCACAGCGGCCCCTACGG
CGGCGGCCCCTACGGCGGCGGGCCCCCTGCACCGGCGCTGTCCGTCCCTCCTCGTCCCGG
GTTCGTGGTCCGCGCAGGACAGCCAAGCTCTGCCTCGCCGGCCGCGGGCTCTGAGCTCAC
GGCGGCCGCGCCGGAAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 1563..1615, 1735..1775, 2656..2790, 3001..3099, 3946..4137, 4872..4958
1576..1615, 1735..1775, 2656..2790, 3001..3099, 3946..4137, 4872..4916
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved