Canis_familiaris Locus POGK
snOPY snoRNA Orthological Gene Database
Canis_familiaris POGK
Canis_familiaris
POGK
7
SNORA52
2144..2278
11712
ctcgcgcgccggagcgggcggggcaggccgcggccaagttggggcccgggccccggggc
cccgaagcccggcccgctcttccccagacccgccgccttcgcccgtcctttctggaaatc
tcgaagaaaggccactttgcgctctgcgggggtcttcgccgcggcggccccgagacgcgc
ccgcccgcccccaggagttgcccgcgcccctagagggcaggagctcggccctttgtacgc
gcccgcggctcggcccggccgggagggcgtccgcggccccgaggcgctgcccggcgcggg
tgggccccggccgtggctgcctctgcctctccgcgggcgctcggggcgcgcctcactagg
tgcccctgaggctcgggctcggaagatccctgaaggcaggcagagcggctctgtgtcctg
gaccagctcatggacagaatctttgactttggaaaatccgggtgatgggtgttccgggcc
gggcctaccaaccccccagtgccgaaccgggccgtggagacaaccccgttgagcaagtgt
ccgccctgtctgtattccagcaccttcatcgataggaagccaacacccctttcccgccac
ttatttcgcgtttgggtggcactggctgtgagaaagttctggcttgcagtgctctttaaa
acctcttccaggaatgtttacccaccaggcctgttccgctgctgggtctctacagaacca
gtctggtctcttccacaggtagctttttaaatatttgaagacagtcaggtatgctgtctg
cctgcagcccctcttctcataattaaatacgtcaccttccagcttcctagtgcttttcct
gaatctattcctccccagacctgacctgactctgtttccttcccttactccagcctgaag
agtgctccaggctaagaggtttgtgcacgctgcccccatcctagcctttgaagagtgtac
actcgtacctgatttttctcaactgaatcttgcttgcagagATGGAGTCCACAGCCTACA
CTCTCAACCTGACCCTAAAAGAAGAAGAAGAGGAAGAAGAGATTCAGAGCCGGGAGCTGG
AGGATGGCCCCACAGATATGCAGAAAGTCCGGATCTGCTCAGAGGGTGGATGGgtaagta
agaaggtgtgaggtccacacagctctgaggagagaagcaggcctgagccaggcttgtgtt
aagtctcctcctcaggcagacataggaagtaaaaatagcccagcccagcccggtatgttt
gcattcctgagaaaacagtcctgtggctttaaaaggcactgtgaagaatggaggagctgg
ttatgggaacagtctccagccatgtagcttatcatccttcggggtggaaatccgagaggc
agagagagcttatctctctgtcctacccctgaatcccctacatcctgctcagtgccaggc
atgctgcagacaccaactaaatgtttgctgacctatgttcaagaaaaaaatattctgacg
tttgtgaagatggtaagaaaaattctgttcaggactgttgagtcaggtgtcaggactgtt
gcagtagaggagggagctggggagctggggtcaacactgaatacagtgaggcgagcgggg
atttctaaccagaaaatcctccagagtggaggggtcaggggacagaaaattactaagagg
aaacttcaagaatggggggattcttgctaaactgacttaacaagattcttgctaaaggca
ggctaggttgatcacatgtcagggggtgggggactctttctaaagtgacttagcaggatt
cttactaagattgggctgggctagctgaggacaggaggggcgcccacatggtagcctggt
ggagaagagggttcagactaaagttggggaaggagagagtctgctgctgcttgaagggaa
ccattttaaataagacttggggcgttgagctgacatgagagctgcaggaggtgaggacaa
ttggttctgtgcgaacatctcttgtgttagcacactcaggagagctgcacatccagcagg
cctgaattgaagggttggggtgatgggcagcagagaatctggaacatactcaaacagaaa
agtttatagaagcagagtacattcatgaacatgtagacgcagcattgtccgtcccgatct
ctgcctgtctgctgtggcccaccaggttgcacctgtgggcacggagcactctggaagcct
cacccaaagaagtgagcagggctgcagtgggcttgtgccaggggcgcttcaggaaacacc
ggggcgggtggctggtggtggtggtggtgtaatagagaattattgttataattgcgtatg
attattcatagtacatactggacaccctgacatttgggcatgaatggtgaaaatcttaaa
catgcaacaaattgacatttcttttctctgcttagttctatgtgtgaacattatcagtat
ccgttatattctttgtttccaataggagatgtgtattcatagaatcctggtactcccaaa
tgtcccgcccagctcccctcccacacgagggaattggggagcagatgagttatctacttt
gccccaaggatacgcatgcacactgacatttgttcttaaaaatgcctgttgagctggact
cttaagagtagtgcattttgttgtatgttatacctcaatttaaaaaaagaaaaaataata
atacactaccagcccctgggcttgcagcctggctctgtaggctgcattgcccttgtcttt
ttgtgttctctccctatcccatccttctccctggcctgatcccttgcagctggggagacc
ttgaagacaggagtccctcccatgtagcatggagcaagacttcccggcagtagagacctc
ggactttaaggctaaattggctatcccagaacatcttgatagcatggaaaaccttagaaa
atgagtacagggatggtggacattgaagtatggcaggacagcgagaagagatcaaggtga
agaccatgcttggctgagaaaggaggcaggggcctggcttttggggcctccaggccatct
gtagttactgagcacagtggtgatgttcttaggacaagatctctagtctcctgcagttgc
cactcttgtgaggaaggtagggaagtgaatgcaattcatagtatggtattcagagtgtag
tgggggaagttggctcaggtgtggggtgtcattcagactggagaactcaagagactcttg
gcagaagggaagcatggacctacctagtcttgagcagtaggcaggttgactcccaggccc
atcccctcctggggacatttggcaatatctggagacatttttggctctcatgatttggat
aggggttggggagtggaagatcctactaggcctctccccagaacactgctaatccatcta
tagtacccaggacagcccccaccacaaagaattatctggctcaaaatgtcattcatgcca
aggttgaaaaacccttctttaggacattacgctaggggaagaaaagaaatgaatctgttc
cttaaatagatattttggttgtagagaattgtgttagggtgatcaataaaagcccttcca
acataagaaccttgctacgtattaggataatattccataggagagttggagtagaaatag
agtttcaagtagagaaaaggaaaaacacgccttgaactgaatcttacgagtggcactggc
cagggggagggacagggcctgcactccagactcccgaaagcatatgcaaaagcatcggag
aggaaagctgtgtgcagttaggagcagcccctgtagctaagtggcctgctgaaaaagcat
gggctttggaagtcagactctctaactctgactgcaggcaagttacttagcagctgtttc
ctcactcataataaatagtgggtagtgattctcatatcttaatattatttaaaggattca
ataagataaagggttcaacaaggtaatctatttaagcgtgtaagaaggagcgccctgccc
ggtgtctgacatccagcaggcaccatcttggtgcactggtaacaaccccttgccctgaga
tccctgccaccctcattgggtagttaggccacttcatcagtgaggctgtgcagtgttacc
cttggagatgagcattagaacgccagcttgccagcagagtaaggcagtacacggctagag
gcaggagtgcctatctgatgtgtcctggatcttctgaggaaaggaaaggggacgggggcc
aagaaagggtatctggggattgaacacaggctgcctgacttctgagtgtggcccagggct
ggccctgtttaccttctgctgtgcttagccagatgaaaagcctctgtggagagaggggag
gcatgcaccacagggcctggctgaaggcttgctcaattctcacagagggttgctgtgagg
ggaatttctaagccactgtactgtgtgtctccagagcataatgtgggcttgtttgaagat
cctctgtggatcagtcataagtgtatgaggagacgaatctggccccagccagcctctagc
caccttctcacaacatcagggctcctggtgtttttaccaggccaaggatgtgttaccttt
ctgagtatcgatagcccctctgaaatgacaggcatggctagtcctgtgtcccattttatc
agcaaagggaaagggactataaataggtctggcctagatctggaatttcctagggagaga
aaaggccagagggagggttgttcaaaagtctgggaagtgggcaggggtggggtagagaat
ccctggctgcctggctttccagattgatgaagcctgcggaaggcctagagatccgtccac
ttttacctcctagtgtctcacacatactccaaaggggaggcttacttctgtgacagataa
aatttaatgatcatttgaagccgttctaagtggaataagggaagggaaattcggatattg
tttgcttaaatcaaaaggacatttttaagtgattactgtctacgagaagtgtgttaggct
gagggaaatggaataaccataggttttgcactcagtgagcttgtactgcagaagaagaag
ctgacaaggaaaccaaaagaatactgcgttgtgataagtgccaccgtagtgttgagccca
ggtatcatgggaacgtgtaggtgggcacacagcccaggtcagggtgggcttcccagggaa
caggacatctaggctaagtcttggaagatgggtgggacgggggggatgtgtgggtgttag
ccagatcaagaatgaggaggagctctgaggcagtgggagagcaatgtgcagggacgtgaa
aggtcaaagagtaagcatggagtatagctgtgcacggaggtgggggagagggggcggctg
gccatcagggaggacagtttactttgtaggggctggagccttgaacccagagagtgccag
gtccaaatctccaccctgccatttattggccgtgtgactttgaccagcagcaaggcctct
ccgagcccatttccttcttgattaaatggggttgttggaaaaaacagataaagcagttac
aggggcctttccctaagaagtgctccctgcatatagggtgctgagagtgggaagggagga
tgtggactttgggaataaggggaaatgccagtatgtcatgccagtcacatgactgatggc
tggacacctgaagaagctacagacagtgcagacatgaattttctaagctgatgaaaactg
ggttcatcatcacccaggctctggattcagccttggagaatagctttgaatgcagtaatg
caaagaaaccagcccaaaaccctggcccagtgatctccgatcactgaatatgatgaactt
tggaggctttttagtgactgaaagaaacatcatggttaaaaaaaaaagatatgtagttgg
atgagcaagaggaggttggtgtgggtggcctagctgccggtgccccctcccactgtgtcc
cctcccacagtgctgggggagggggaacagtggggagagccttggagctgccttctctgc
ccttagggctttctgcagaaggtctaggcatgaaagcaaactagtttgctctggtgtctc
attacataaatttaagctctaattagctctcctctcagatcgtaggttggaaaaggccaa
atgaggccccctcactggttcctccccgggctttgggttctgagtcaaacgctaaggctg
gtgcccctggaaaaggaaacagtacccaggaccccccccggcccccccccccgnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccccg
gccccccccccgtcccccctcccccgcccccactgggctagggatctgcagatgagaaaa
ggcaggggacgtgttgtcttggtgggggaactgccccagggtgtctgcttgggtgtgggt
gctcctggctccagagtgggggggctaagccaagaccagctgtccccgcagtggatgtcc
ccgcctggtgacctggtgatctgtgctggggagtttttctcctcggggtgctgctctgcc
tgtctgtgggccaaggcagtgatgggtactcagcagggcaggcggggcctgtgctgtgtc
ctagggtgcctctaggagctgtggtgaatgtgatggagcatgtcgaggcccctcccttct
aggatgaaagggtgtgagtctgtgtctgcgtgtgcctgttagtcgttgagaaaggcctgt
tcgctatttcagGTGCCCGCCCTATTCGATGAGGTGGCCATATATTTTTCCGACGAGGAG
TGGGAAGTTTTGACGGAGCAACAAAAGGCCCTCTACCGGGAAGTCATGAGGATGAATTAT
GAAACTGTCCTGTCCCTGGgtaaagctttgttttcctttgtctcctggaagccctgagcc
cagagaattgtttccatgtctcttctctggtgtccaacatccctttctcctgaacttgga
ttctgtccccttgatgcctgtgcccgtttaatttcctgtttttgctttaggcaggatata
aatattgtgtcctcctactcagcaacttgtgccagctctctgaaccatcctcattcaacc
caggtgttcacatagagtcataacctggggcatctgggtggctcagtcggttaagggtcc
gcctcttgatttcatctcaggtcatgagatcagggtcgtgagatcagagccctgcatcgg
gctctgtgtggtgtctgcttaaaactttctctccctctccctctgccccctacccaccac
atgctcgtgcacgcattctctttctctctcaaataaataaataaatcttaaaaaaaaaaa
aaaagacataacctaagaaatgtcaccacaagtctggacctgtgttccatatattcctta
ggaagcctcattcttgccctgtccagcctcagttgcgtgggaacataccaccagagaatc
ctggttcccctcccagcattgataatctacatagttagagtgtaaccagttggaagcatt
tcctgagttgctcatacatgtaccagaatgtcactggatccaccaagtccctgctaaatg
cagctctttttttgttgttgctagtaccagccctccttagcaaagatccataaattccct
tggacagactaacttcctattatattttttctttaagtacccctgagccctttcccccat
cttttgtgtatctccacattgagaatagcatgtgcatgggagggtatttcttaagtatta
taaagtactacttttggcagtgtttcaagacagtaacacacagctgttacctgttttatt
tcctataaacagAATTCCCATTCCCTAAGCCAGACATGATCACTCGATTGGAAGGGGACG
AGGAGTCTCAGAATTCTGATGAATGGCAGCTCCATGGAGGAACCTTTGCAGgtactacaa
ttaaaccactccagcatccatccaataggggagcattgtgaggctggatcttccatatac
gttgtgtggtgtatttaacagtaaggcagggttatgaggcagaatgattatgggctttgg
agtttcaaaatctttccagtgctgtgtgactttaggccatttcattcacctctctgagcc
tccattccttcctctgtcagctgtgggtgatatgtctcaatgtgcagtgttgtatgtgca
tgcagcatactgaagcttgtatggcatctggtccagcgcacatcctaggggaaggaggcc
acctcagtagtacaccaagtacctctgaaagccaaggaaaatcacatgacgaagcatgtg
gccagcaagagcaaatgtagtacatatgtgagcaaatatatctgagaagcacatggtcct
ttatcaggcatcatagttaggacaacagttggataaatacagctttcaagcagccactgg
ttttattcatcttctctatagctaagagtttaaaatgccacatttcattgattctaagac
gtgctttcccccccaccccatcttgttaacatctctgaaattaagaatgcctcttagaat
taatggcattttttccttttttagtggtatatcttacaactgatggcatcttagttttgg
tgagataggataattttccaagtcctattcagtttctgtgaccaccttctaaatacatgt
atacaatgaaacccagttctgacattagtagaaggaactagttttctgccttaaaagctt
agctgtgctaagtatggttttgccatagatttttttggtttaaggaatatgatgcaggcc
atgatgcatctaaattctggactcttatatggtagtatgggttttatttgacttctcccc
cacataaaaatattttgacccaaacatggcccacagagcaaccatgtgatccaggtttta
cctgtgttcagttccccactctggcactttctagctcacctacctggatttatcacttca
gcttcatctgcaaagcaggagtaatgatgatatataggtattattggaattggatgtagc
agtccgtaagaattggcatgtgagtaaggacttaggaaatgctatctgttattaaagtta
ctgctttgggtaaacttcagattaagatattcttagtatttgaatccaaaaaatcaggga
actggccagaaactattataagtactgtcattatctttgcccctccccgtttgtctccca
gAAAATGAGGAGTCTGATGTCAAGCCCCCAGACTGGGCCGGCCAGATGCATGCCACCCCA
CAGTTTGCTCAGCCCCAGCACCTAGACGGGTTTGGCCTCCGCCTGCCTCGAGACCTCACG
GATCTGCCCGAGTGGAGTGAGGGGTACCCCTTCTACATGGCCATGGGCTTCCCAGGGTAT
GACCTCTCGGCGGACGAGATTGCCGGGAAGCTCCAGTTCAGCAGGGGCATGCGGCGCAGT
TACGACGCGGGATTCAAGTTAATGGTGGTGGAGTATGCCGAGAGCACCAACAACTGCCAG
GCGGCCAAGCAGTTTGGAGTGCTGGAAAAGAATGTGCGAGACTGGCGCAAAGTGAAGCCG
CAGCTCCAGAACGCCCATGCCATGCGGCGGGCCTTCCGCGGTCCCAAAAACGGTCGCTTC
GCCCTGGTGGACCAGCGTGTGGCCGAGTATGTCAGGTACATGCAGGCCAAAGGGGACCCA
ATCACCAGGGAAGCGATGCAGCTGAAAGCTCTCGAGATCGCCCAAGAAATGAACATTCCG
GAGAAGGGGTTCAAGGCTAGCTTGGGCTGGTGTCGAAGAATGATGCGAAGGTATGACTTG
TCCCTGAGGCATAAAGTGCCTGTGCCCCAGCAGCTGCCCGAAGACCTGACCGAGAAGCTT
GTCACATACCAGCGGAGTGTCCTGGCGCTGCGCAGGGCGCACGACTACCAGGTGGCTCAG
ATGGGCAATGCCGACGAGACGCCCATTTGTCTAGAGGTGCCGTCGCGGGTGACTGTGGAC
AACCAGGGCGAAAAGCCTGTCTTGGTCAAGACGCCTGGCAGGGAGAAACTAAAAATCACA
GCGATGCTCGGTGTCTTGGCAGATGGGAGGAAGCTGCCTCCGTACATCATTTTGAGGGGC
ACGTACATCCCCCCCGGGAAGTTCCCCAGTGGGATGGAAATCCGCTGCCACCGGTACGGG
TGGATGACAGAGGACTTGATGCAGGACTGGTTGGAGGTAGTGTGGCGGCGGAGGACGGGT
GCAGCACCCAAACAGCGTGGGATGCTGATCCTGAACGGCTTCCGTGGCCACGCCACTGAT
TCTGTGAAGAGCTCCATGGAGAGCATGAACACCGACATGGTTATCATCCCTGGGGGCCTG
ACCTCGCAGCTGCAGGTGTTGGATGTAGTGGTCTACAAGCCGCTAAATGACAGCGTCCGG
GCCCAGTACTCCAACTGGCTTCTGGCAGGGAACCTGGCACTGAGCCCCACTGGCAATGCC
AAGAAGCCGCCCCTGGGGCTCTTCCTCGAGTGGGTCATGGTGGCGTGGAATAGCATCTCC
AGTGAATCCATCGTCCAGGGGTTCAAGAAGTGCCACATCTCCAGCAATTTGGAAGATGAA
GATGACGTCCTGTGGGAGATTGAGAGTGAGCTTCCAGGAGGAGGGGAGGCGCCCAAAGAA
TGCGATACGGAGAGTGCGCCGGAGGGCAACTGAcagccgaggggagagctaaggtaacca
ggcagccatcggcacatacctggcgcccgcactgacggcccggtttgtggtccacagata
cccttcctcttgccgttactttcttgtgcttccgagaactctcaagcctatggtatagta
ccctatgtaacaggccagcagcctctcctttatgtcagtcttgtgttgcgtggcttactc
tgtgggtgttttgctctgaggcccggacctgggagcacttgtatagtacataacatgagc
caagagagagttaccggaacatttcatctgagagccatcgtgctcaaagaaatgatttgg
gcctgaaagagcatagttagcaagaggttttgccagaaagccgactggcctgtaggacca
tgatgtagggagaacactctggtgtaggggagagcactgtgtgctgtgggcctcacctcc
atgcttgagtggtctgcagaagcccacgggggtgtgaaaacggtagcttagacttgcttt
tcccatgaagttcaaaagtgtttttaaaacatctcttagtctcatcatgaccttcacatg
gatggaatgagcaattgcaataatttcttatagcccactgatgtctgaagggagatattt
ctaaattgaatctttgcaccaaaaaaagaaaagaaaacagggcacatatctgggactaca
gtgaataaagtccaaggcctggaattttcagagttgaatatagaaggggagcagctttaa
gaggaatcggggagtgcagatgaacacaccactggtggaggcaagtctacaccacacaca
cacacacacacacacacacacacaccttgagatgagagagcggccaaccaggtacactga
gggaacatgtggaaagaacatacaattcattttaccctcttgctcttgtctccctgatgg
tcaatttatttccctatttaatatgaagggtcattccattttctacagaggacccaaaac
taccttgacattt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 6792..6918, 7872..7970, 9241..10712
1001..1132, 6792..6918, 7872..7970, 9241..10712
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved