Canis_familiaris Locus EIF5
snOPY snoRNA Orthological Gene Database
Canis_familiaris EIF5
Canis_familiaris
EIF5
8
SNORA28
4059..4182
11218
cgctttcacggtagcaactcaaactcttaaaaatgagtttctgaaagaacgggagagct
tctgcaatcgcttcaacaggatgaaaacatcactaaatgatcaggcaatgcgacctcatt
aggaacacctgctttgggctgtgcttcgcccacagcaaggaagccgcggtggatcccccg
agaggtgggtgcggggaattggaacccaatgagatgcttcgtttgagcaaagttactgtg
gaggacgagtatccgggggcctcttcccagacgcgctttctggagggtcccggggtccgc
ctctttagaaggcgggtgcacgggagcgcccagccccgccaggcctgcaggcggggggcc
ggggagagagccaggccggcgggcccaggcccgcagcacgaccccccccccccccccgag
gtgacacccggaccccggcctgggagcttaggaggcagcgctcaggatgaaagacccggg
cccgcccaccaccaccggccgcccaggcccaggcccaggcccagggagcggggaggaaga
acaacttcctcctcgagccccggcgaccggcatcccccaaggggcggaaagggcagggaa
gacgtcccccgccccgcccccgggcgaggctgcgcgcccgccgcgagaggaactcggcgg
gaacgagaccaggccgaggcggcgggggaggggagccaaccgccatcttcccccccgcac
ccaaaccgacaaagcgcggccccgcggccagctcccgccgcggcctgcagctctcgcgag
accgcgaaggcctctgggacgggcgggggaggggagggcaagggaagagatccgggaccc
ggggactgggggcgggctgaggcggcgaacggagccttaggaagcaggaggggcggagaa
agacgcaattgacgcggcacgtggaccaatcacgagcgagctcgggcgcgcctcaggcca
atgagcggtgcggcctggcgcggggggcgggcgctggggctGAGGGTAGCTTGAGCGCGG
CGGCGGCGTTGTTCAGTCAGAGCGAGAACATTCCAGAGgtgagtccggtggaggggcggc
ggccccgcgccccttccccagtcctccccgccccctcgacccccgcgggccgctggctgg
cggggaaggcgccccgacgcccgcggctcacggtgccgtctctccgcgccagGTCGCCAG
GCCCCGGGCGCTGAAGGGTGTGGACCCCGGACGTCGCTGGGACAGCCCCTCCCCGCTGCT
CGGCGGCGCCTGGCCCGGCCGCTGCTCGCTGCGCTGCTCCGCCGCCTCCGCCGCCCCTCC
TCGGACTCGGGTTCACACGCGCCTCACTTCATCCCAGTCCCGGGCGAGCAGCGTTGGGTT
TATGTCTTTATTTGACGAAAACGgtgagtttgcgggcgggccggcggggagatggcggcc
gcacaagatggcggcgcgccgcgtgacccgcgcgcgcgtgtggcgcagttcgggcgggcg
ggccccgcgcccccgccgcccagccctccgccccggcccgggcccgcgcccccgcccctc
cgcgcctcccctctcccacggccgccgctacgattttattgatgagtaaagaaattacct
taatggccgtacaacttctctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnncaccggagcgaaggttgactgcgcgcagagcggggacggggcggag
cggcggcggtccgtgcacactcccgcgagaccgcgagtcccggattggggcagggctcct
tcaggggcgcgctcggtgttgagccggggggcggcagggccgggggtcgaggctgcgaag
tttgtccgaaaacccagcctgggtctgccttcgtctccacggcggttgttagaacatggc
cgctccgtcgaagcaaccctgggacgggcgggtggtgtgggcttcggggtaaaccccggg
caggcagccgaagccgggctgctcgtcgtgggaagtctggcagctcccagctggaggccc
tttagattgcgacaggtgttctgtgttcgaggagaatgttagcttctcacgtgaactgtg
atgcttcctaatgtggcagaacgaggcgtccttaactgggaggcggagggaggtttcctc
ctgcgggaatcacgttaaacgttgggggttgtgtgtgcttttcctttctctttcagAGCT
GTTGCGCAGCCATTGGTACCTGTATTGGGGAAACATAGCATACAAGCAAGAAGCTTACAG
CCTCAGTGGCGAAAATTTTTTCATGTCAGAGACCGAGAACTCTTGCAGTCGTTTATGTCA
TCCCTTCTTCTCCAGACAGAAGATACCAAAAAGTTGCAATCAAAGATCTCTTCATCTTAT
TGATAAAGCCACTAATAAGCCAAAATGTCTGTCAATGTCAACCGCAGTGTGTCAGACCAG
TTCTATCGCTACAAGATGCCCCGTCTGATTGCCAAGgtaattaatgctgatcttcatttt
agtaatgaaacctaagctctcttcctagattgttaaagactgcatctcctcaggtagata
atgcaaaattaaagcttttttttttccttagGTTGAGGGCAAAGGAAATGGTATCAAGAC
AGTTATAGTCAACATGGTTGACGTTGCAAAGGCGCTTAATCGGCCTCCAACGTgtaagta
atgcttcttaagaggagtttgaaaaagcatattatggatatgatcgtgacaagcttcaat
ctgtgtatcttgattgagttggggtttttttttttttttttttttttttaagattttatt
tattcatgagagatacagataggggcagagggagaagcaggctccatacagggagcccta
tgtgggactcaatcccgggtctcccgggtcacatcctgggccgaaggcggcactaaaccg
ctgagccatccctgctgccctcttgattgacttgtatgatagtttgtttcagggttaagt
ggaattttgggcttgaaaacccaactgatgtgttagttgctattagtaaacaaaactacc
caagtaagacatatttttagctgtgtagaagtagcaaaagtgttatttgtaggagggtga
gtcagtcaaaaacttaattttctcccccaccccttccaccaccccgccatagATCCCACC
AAATATTTTGGTTGTGAGCTGGGAGCACAGACCCAGTTTGATGTTAAGAATGACCGTTAC
ATTGTCAATGGATCTCATGAGGCGAATAAGCTGCAAGACATGTTGGATGGATTCATTAAA
AAATTTGTTCTTTGTCCTGAGTGTGAGAATCCTGAAACAGAGCTGgtgagtcctttttga
gatttttgtcagaaagaggaaaacctacacctgcttttgtgatcagtcctttgatattac
caaatttagtttaagagatcgcaaatttagttggaaattaaagcagcaaattttttagaa
attttcaatgttggcttttctaagtagatcattttgttaaaaacaattttgtatgttagg
ctggaattacatagttaagtatttcaacactttgttttttgcaaaattttattgtagggc
aaagataacacttgtctttaccccttttttggcagCATGTCAATCCAAAGAAGCAAACAA
TAGGTAATTCTTGTAAAGCCTGTGGCTATCGAGGCATGCTTGACACACATCATAAACTCT
GCACGTTCATTCTCAAAAACCCACCTGgtgagtctttatgatcaacttgtaagaacttaa
cagtaaagcaattgattgctggaaacaaagcagaagtttctttactgctatgaaactaga
agataaggaatttcctatttttgtgccttgatctgttggatctgttaccttgaaagatgt
actgttaaagatagaacaggctgccaaattaagactggtcacttaggaagaaatagattt
gtgtaaaacaaattgtgcaattccagcaaaggatctcctgtaatactcttgtgaacgagg
gtcctgactcattaagcctaactggctttagaacattgcaagcaacactctgtggcagat
gatgggagttgtctgacacaatttgagcttgctatagcaagaaagtctaacctattccag
tgttctcctcaatgagaccaactgttatatagacttaaacaacgttccagcttttactta
aagtgcatttgagatgtactgttatttgggtatatgagggatgagagggtcaggagtgcc
aaccttcactatctggtctactgagacatcatcacttcattttaatcctactgaacagtg
aatgcctctactattctgggacatttcattcttaccctgaattttttatataggaaatga
tagtggataaatttggtctgtaaatcctactagaattacaagtagcgttgtgtatgtata
tggatttcaagggaagattccaaagcagaagggagcaaggtttttaaatgtttatgagaa
atagtgagctgtgataaaactattaaattttttgtttctttttttgttctcctgtagAGA
ATAGTGACAGTGGTACAGGGAAGAAAGAAAAGGAAAAGAAAAACCGGAAAGGCAAGGACA
AGGAAAATGGTTCTGTGTCCAGCAGTGAGACGCCCCCACCCCCACCACCAAATGAGATCA
GTCCTCCTCCACATGCTGCGgtgagtgcagggatgagggtggtgggcaccaaagttgagt
tgagtgggggcagaaataaggaaagtcatcttcatttttttaaagatttttattatttat
tcgtgagagacaggcaaagggagaagctggctccccacaggaagcctaatgtgggatttg
atcctgggactctgggatcacaccctaagctgaaggcagacgctcaactatggagccacc
caggtgtccctatcatccattttattatttatttttttttatttatttacttattttttt
taaagattttgtttattcatagagacacaggcagagggagaagcatgctccatgcagaaa
gcctgacgtgggactagatcccgggtctccaggatcacaccccaggctgcaggcggcgct
aaaccactgcgccaccgggtctgccccctatcttcattttaatactgcaatgataccagg
gatccctgggtggctcagcagttagcacctgcctttggcccagggcatgatcttggagtc
ccgggatccagtcccacgtcaagctccctgcatggagcatgggtctccttccgcctctgg
ctcttcctctctctctctcataaatcttttaaaaaatttgcaatgataccttgggttcct
ggttctgtaggtaagtccaatatttatggaaaataaatccagtgccattaacgtgactag
aaatctggaatgttttttggggttttttttttttttttaatttatttatttacgatagtc
acacagagagagagagagaggcagagacacaggcagagagagaagcaggctccatgcacc
gggagcccgacgtgggattcgatcccgggtctctaggatcgcgccctgagccaaaggcag
gcgccaaaccgctgcgccacccagggatcccgttttttttgcgtttttgaggcatttgac
aacaatgctgttcttgacagGAAGAAGAGGAGGATGATGATTGGGGGGAGGATACGACTG
AGGAAGCTCAAAGACGAAGAATGGATGAAATCAGTGATCATGCAAAAGTTCTAACACTCA
GTGATGATTTGGAAAGGACTGTAGAAGAGCGGGTCAATATTCTGTTTGATTTTGTGAAGg
taagaacttcaagagcagctaaacatttttttgttaatcaccctcaagtcttgaggtttt
aagatatttattactttatatttgtgatctggcacataatttttcctcatgatgtctttt
gaatactcaaacttatttactgaaattactttttgcagtgcttccaggtactatctttgg
catgtgcatattaactaaaaaatcctgaagctataatgggaaaagtctgaaagcggggag
gaatgagcatctctagagcaaaatgtgtctccattttgctgaattgctccctttatttgc
agAAAAAGAAAGAAGAAGGTATTATTGACTCGTCAGACAAAGAAATTGTTGCTGAAGCAG
AAAGACTGGATGTAAAAGCTATGGGTCCTCTTGTTTTGACTGAAGTTCTTTTTAATGAGA
AGATTAGAGAACAAATTAAGAAATACAGGCGCCATTTCCTACGAgtaagtgaattatttt
gtgagatttagagttgaatgaccctgggaagatgtctgtcatcctaaaacgagagataat
tgacctaccttatcaagcataggactaagtagaaaatgctgtataatagtctcttagaga
gtaatgcatagattttatgcattgactttttgaacttgaaccactgtttaagcccgtagc
cttaaggaacaattttgagagatgagtatacttaaaacttctttaaaagtttgttaatat
cgggatccctgggtggcgcagcggtttggcgcctgcctttggcccagggcgcgatcctgg
agacccgggatcgaatcccacatcaggctcccggtgcatggagcctgcttctccctctgc
ctgtgtctctgcctctctctctctctctctatcataaataaattaataaattttaaaaaa
aataaaaataaaagtttgttaatatcaacatgtttgtttccagTTTTGTCACAACAACAA
AAAAGCTCAACGGTACCTTCTTCATGGTTTGGAGTGTGTGGTAGCAATGCATCAAGCTCA
GCTCATTTCCAAGATTCCCCATATCTTAAAGGAGATGTATGATGCAGATCTGTTGGAAGA
AGAAGTCATCATCAGCTGGTCAGAAAAGgtggggaatagatacagcctcttgaagatcag
ttgttggggcacttttggaagaagtaattcctgatacttaagtttcttctacattgaaat
gcagtccttggtataactcataggtgattcccacaatggcaactttctactaatagtgga
aggaagtatttagattcttggttacttgtttgctgaatacatgtatctgttgagtcaaga
ttaggatgtgacccagttccttcaaagagctcagtgtgtaggtagttatataaattaatt
tttagatttctccaactaaggaaattgtattgaactttttttagGCCTCTAAGAAATATG
TCTCAAAAGACCTTGCCAAAGAGATTCGTGTCAAAGCAGAACCATTTATAAAATGGTTGA
AGGAAGCAGAGGAAGAATCTTCTGGCGGTGAAGAAGATGATGAAGATGAGAATATTGAGg
taaactacgttatgatttgggattatgaaatggtaatcaggtaattttaaatttttagat
ggagcaaaacatggtcttgataatttgggaaattatcgtgttgatataaaggattggggg
aaatgtctcctgcccctaaacaggattggaaatagggtttagttaacagccggttgagta
tagaggtgctactttgtccgtaagaattaaggtggtatcagactggagagagaaaactcc
attttcatctaacaaaaagtttgaaaaaatggcagctgtggggcgcctagcctaggtggc
tcagttggttaagcatccaactcttgatttctactccggtcatgatctcacaagggtgtg
agattgagacctgcttgaaaccagtgtggagcctgcgggtctcttccctttcacccaccc
ccatttgcacacactttctcaaaaaaaaaaaaaaaaatgggtagttttttctttgttgac
cattgatttgtattgctgtttttatagataggtttattaggatacagacttaacacaatc
aataaaattgttttatcagGTGGTGTATTCGAAGACTGCCAGTGTACCTAAAGTTGAAGC
TGTGAAGTCTGACAACAAGGATGATGACATTGATATTGATGCCATTTAAAGGGGTGGGTG
CAGCCCAGCTTAACGGTGTAATGCTGCGAATCTTTCTGCATCATCAGCCAGAAGTGCAAC
ATGTATGTGCAAAAGCTAAAATGGCTTAACATCATGCTACACTTTCTACTAAAAATGTAT
TGCTGTGAGTGGTCTGTAATTAAGCCCAACAAGACATCTAGGGAGTCCATACACATATCA
GTGAGCAGATATAGTTTGCTTATTTATAGCATGTTTCTTTTTGAAAAATTAGTGGTGGAC
ACATTTGGATCACATGTATACAGTTAAATAAAGATTTGATTTTGGTCATTCTTCAGATAT
TGGCTCTGAATGACTTAAGCTGAAATGGCTCCTTTTTTTAAATACTGCACCACCATTAAC
CTGATAGGATTCTTGGAGCCTGTTAGATATTGTTAGATGCTGAGACTGTAAAGATGTTCT
CAGCAGAATGTAAACATAAGCTTACTTGTAATTATCTTAATCAGCCATTGAAAAATATAG
TACTTTTCAAGTGTTCAGTCCTTCAAATTGGCATATGGTAATGTACATTCTTTCCATGCT
GAGGTGGACTGATCATCAAAATGGCAGTGCAACATCTTTATCTTCTTGAGAAGTGAAAAT
GACCTGAGTGTCCTATAAATAATTTTAAGAGCAGGTTTTGAAACTTGAATTGTGTTTTTT
CAGTTCGTGTATACTTAACCCCAAATTGTAGTCTTTGGAGTCATGTGCATTGCACGTTTG
GATGAGCCAGGGGAATTATTACATTAACAAACAAGCATTTTATGTGTATGTAGCTGTTGC
TTTGTACTAAGAAAATTCTGAAACTAGGATGTGATTATATAGTAAGCTATGATTTTATTT
GGGGGAAGCAGGAAAAGGTGCACTAAATCTCTAGCAAAAACTGAGCATAATTTTTCAAGT
TTTATTCTTATGGTTGAATTAGTTTCAAAATGTTAAGGCATACTGTATCTTTTGTTCATT
GTGGATTTCCTCTTGATAATATGGTTTGTTCTTTAATGCCTTTTACATGTCGATAATAGC
TTATGCTTTTTAGGTTTTGGTTGCTATCTTGCCAAAATAAGTGTTCCTGTGTCTCAAACT
TGATCCCCTCCCCCCCCCATGTCTTATTTAAAGCAAAACAAGACAAAAAGCTAAAAGCAT
ACTTCAAGTTAAAGCCTATATTTTGGTGTAAGACTGAAGGTGTTCTTTATTTCACATTGA
ATATAGCCAGACACCCAAGAAGTCTGATGATGGCCACTGAATGCAGGTGATCAGGGGCCT
GACCCCAGCCCATCCTGAGGTGTTTAGACTTGGGAATAACTTGATGAATTCTTTGCTCAG
TTAGCTGATCTCAACTAACTGTATGGGTTATGGCTTTATCTGAGAAATCATCTTTAAGGG
AAAAACCTGTTGCATTTCTTCCTTGCCGCAAAATACACTGGGAATCAACAATCCAAAGGG
TTAATTTCATTGGGAACACTGTCTTGCAGCATCTTTTTCTTTTGTCATCCATTTTCAAAG
ATTATAATGAGACCTTAATGTATGTAAGAATTTTTCACATTGGAAATTATACAAACATTT
GATATGCTAAAATCTTGTTAGCTGGATATTTCAAGGAGGTAAAATCAAGTAATCTTACTG
GAGACATACAGATTTGGTCCTCCGCCCCCCTGCCTTTTGATGGATTTTATGAGTGAAGCA
AAAGCACCAATCTGGAGGGAATGTGTTTTGTCACACCAAAGAGATGAAATTTTTGTAAAT
TTACATCTCACTTAGGTTGGAGATTCTTTGCCATAGGCCAATTTGCTTTCATCTAAAATT
CTATGGGAGATAGGGATGACTCAAGCCAAGTTGCATTCAACATAATGTTAAGCTAATGAG
GTTCTGTTAGTTTGGGAGTTTTTTTCTTTTAACCTGAAGGAAAACCTGTTTGGGGCTTCT
AAACACTAAAGAGAAAATTTTGGCTTAGACTAGTATTCAGTCTGGTGCCAAACTTCCAAT
GGAATTCAAATCCACGGAATAGAAATTTTATCCATAGAGGCTATCCTAATAAATTAATCC
TTCACTTTGATCTATTTGATGGTCTTAAAATTTCCTGTTTCAAACAGCTACATTACTTGA
TTAAAACAATGTTAAAATTATATTTTGTCTCTGCTTTAATATTAAAACTAATCTAGATTC
TTATTTTATTAAGATCGAAgcattgaactttcctgtgttttgtagctaatgctttggata
tgtgttgggatgttttcatggttgccagtcccactcagaaaacagatgctgctcattact
gtgggtcagtggctttccttaggttttgttctctctcaaactggaaacggtctgccttga
tttgggttcttgacatcttgatgggtggttactttaggaaattgaaatgtcaagtatata
attctataacagatgcctagtttaagaaagggaaataagagattgcattccaaacaagtc
cactctgaaattgatgaacctacgaacctagaagtcaaagaagggaaaggagtgttctct
ataacgtaatgcttattgctttttaggtcaggctgtgtatgttgcaattgcccccactgt
ttactccattgcagtaagcacgttgacctgaagataacttagaaatgaaaactggccttc
taaaagagtggaaaatccagaagggtattgatgctgaggagccacctatctgcattttgg
gtttgttgcattaatcctcccagtgatcctgagatggctagtattgtcccaaggtaactc
accagattcctgtgctcaaccactttgttgtgcactgcaaagctaaagatgtgtttaaaa
ccaatatgaagggggcagcccgggtggctcagtggtttagtgccgccttcagcccagggt
gtgatcctggagacctgggatcgagtcccatgtcaggctttctgcgtggagcctgcttct
ccctctgtgtccctctttctctctgtgtgtctcatgaataaataaaatctttaaaaaaaa
aaaaaaaaaacaatatgaaaatattctcctgaaatctacttagaactttagcaaaacaga
cgaaccataatggaggtttaatttttgtttttaagatttcacttgtttattcatgagaca
gagaggcagagggaggagcaggctccatgtagggagcctgatgtgggactccatcctag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1192..1402, 2216..2495, 2611..2692, 3172..3344, 3635..3746, 4557..4699, 5660..5818, 6122..6283, 6763..6927, 7244..7378, 7939..10218
2424..2495, 2611..2692, 3172..3344, 3635..3746, 4557..4699, 5660..5818, 6122..6283, 6763..6927, 7244..7378, 7939..8028
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved