Canis_familiaris Locus ENSCAFG00000006781
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000006781
Canis_familiaris
ENSCAFG00000006781
28
SNORA74
22163..22361
35534
ATACACAATTAGACTTCCTTAACAACTAAGGCAACTTCTCAGCAAACCCGAGGAAACCA
AACAGGTGGAGTCTACTGCCATTTTCCTTCTTGTGAGTGACTACTCATTAGGGTTTCTCA
CACCACCAATCCCAACGGGGAAAACGCGGCCGCATTCCCCTACTAGTGGCCTTAGTGGCT
TAGCAAGAGGACCTCAGACTGGCAGACACAAGACCAGAAAGGGATGTTGTCCCTGTGTCC
CCTACAAAGACCAAGATGAGGTTTGGGCCGAAGCGAAGGACAAAGTTCTTTATTTCCCCA
CGTACCAAGCGAGGTGGAGCTGCCTCTGTGCGGTCCCGCCCGCCCCGGGACGCAGCCTGA
GGAGGACGGTGGGACCCTGAACTGCACGGGAGCGTCCTTGGGATCGAGGACGCGTCTCTG
CCTGCTGGGGAAGCTCCGGGCGTCCGAGGCGGCCGGCGGAGAAGTTGCAGCGGCGCCCCA
GCGGGGTCGCTTGGTGCAGGGCTCACAGCCGGGGCCCGCACTCATGCTTGGGACCCGCAG
CGCACAGTCCCCGGGCCGGCCGCGGGGAGAGCCTCATTCACTAACCCTGAGAGGGACGGA
CTGCGCCTCCTCGCCGGCGCCTCCAGGCACCATTCCCTCTCTGCCGCTGCCTGCTTCTGC
AGTTGCTACTCCGCCGGCCTCCCGAGCCAAGCCCTAGCCAGTCGCCTGCCTTCCCTCTTC
CACAGGCACCCCCACCTGCCTCAGGATGCGCCGCTTTGATTCCGGCTCGGCTCACTTTCC
CACCACCGGAAGGCTGCCATCAGGCGCTTCCGGCTTCCGGGACGTACAGTGTCGCAAAGC
GGAACTGCAAGGATTAGCGGGTGCCGGCTCCCGGAAGGTCACCGTGTGGAGGAGGAAGGG
GTAACCCGGGTCGCCCTGCTGTTTCGGGGGAGCAACGGCCGAGCAGACGAACCCGGCCTA
AGGTGGTGGTGATAAGCAGACGGGCAGTTTCCTGCGACACCATGGAGAGCGGCGGGGGAA
GCGGGAACAAAACCACCGGGGGCTTGGCCGGCTTTTTCGGCGCCGGCGGGGCAAGTTACT
CGCACGCGGATTTGGCCGGAGTCCCGCGTAAGTATCAGGCCTAGCTTGTGAACGAACATT
TCTTACTGGTCCTTGCGACTCTTCCGGACGAATAGCGTCCTCTGTCCTTTTTTTGGCTGG
CGTTCACTCCTTTCGGTACCACTGATGGAGTTCGTGTGTTTGCGCTGCCGCTCGTTCAAC
GTCGAACGAGTTTTTGCAGCCGTGGATCCCCGAGCAGGTCTGGCCGACCTGGACTCGGGA
GACGTTGCCTCTTTTCTTCCTTTCATATCCAAGCCTGGTCCACAAATTCCTCTCTTTCCT
CTCACACATTGCTTGTGCTTTGGGCTGTGTGCTCGACTCTAGATTAAGAGGTGAGCCTCG
CTCTGCAAGTAAATACAGTCCAAATAGCTTGGAAATAACTTTTAAGCACAAAGTCTCGTG
TTTCGAAGCTGAAAGGTAGCCGTCAGGTCAAAGCATTTAATATTGAATATAGGCAAGAAA
GAAATTTGAATCGTGCCACCTGGAGGAGCTGAGAAGTGAGCTGCACTTTAAAGGTCGTTT
ATGGACTTGAAAAAAGAAGCCAGGTAAGAAAGGAAAAATACAAGATCAAAAGTGCAGAAG
CATGAATACCCTGCCTGTACCCTCGATCCTGTGAATACATCTTCCACGAGTTTCAGATTT
TATAGGTATTCACCTGGATGAATAGAACTTCTCCAGGTCTTTTATGCTCAAGAACAAAAG
AGCCCTAGTGTCATTTCTGTCAAAACTGAATCTGGAACACATTTTTCATCTAACAAGTCC
CCTGAGGTCTGGGTTTTGGAGCGCAAAGGGCACTCACTTCCTTAATGTGATAAGCATTGT
TACATTAATTTGATTACGATTTTAAGGTAAATTAAGAGGTCGAGGGTGAACACCATTCAT
TGAGCACCTGGAATGGGCCAGTGACTTTTCTGGGTGCGGGACTACCGATGGTTAAAGGAG
ATGATTGCTGCATTCGTGGAGTTTACATCGTATTGAAGTGAGCCAAGTAACACAAACACT
TCAGTTAGTGATAAGTTTATGTAAAGGCATCAAAACAAGATCGAGAAATGATGAAAGCAG
CACACCATTTTAGAATGGGTCAGGGAAAGCAGCTAGAGGATGTTGACGTTTGAACTATGA
CCTGAGTACAGTACAAATGCTAGGAATGGGGGGCAGGTGTACAAGGGAAAGGTTAGTCCA
AATGCCCTGAGGAAAAAAAAACACTTGACACGTTTAAAGGACAACTGATAGGCCTGTGTA
TCTACAAAGTTGCAAGGAAATTGGAGCTGTAGGAGGTCATGAGATCAGGAGGACAAGGAA
TGGCCATTAATGCAGTGTTTTATAAGCCATGGTAAGGATTTTGGATTTGATCGCAAGTGT
GAATGGAAGTCATTCGCCCTGTTTTCTTTTCTTTAAAAAAAAAAAAAAAATTCACTTTAG
TTGTTACATAGGAAATGAATCAAAGGGACTAGAGCAAGTTAAGGAGTCTGTTTAAGTAGA
TTCTTACTGTAGCCTAGGTGAGATTTAGTGATTGGACTAAAACGATAGCAGTAAGGGTGG
TGGTAAGGAACAGTTCAGGATGAATATTGAATATAGAATTAGTAGGGCTTTCAATTGATG
AAAAGACTATAGTCATGGGTATTTCACAGATTTGTGAACAATCAACAGATGTGCAGGAAT
TCAAGAGTTAAATTTAGAATGTGAGAAAGTTATTTTCCCGGGTAGATTTTTCCATTTTCA
AAGTTAGTGGGATTCAAATCTGGCTCTCTGAGAGTTTCCATTTTCTTTTGTCCTTACCCA
CATTCCTTTGGTGATAACCCAAGAATGCTCTGCACTGACACAGCAAATGACCTTTGTCAG
CAGCCGTCCATACTAAGATTTGAAGGAAGTACCTTAAAATATTTCTGTATAATACATAAC
CTGAGCACTGTTTTTCCCATGGAATTGATTGGTCTCTTATCAGTCTTATTTTGCAGTTTG
TATAGATGTCAAGCATCCTTGTGACAGAGTAGAGGAAATTAGCTTTATAATTAACTTGAG
CTATGCTTCCTGCTGCTTTATTTGATCCACATTATTGCCAGTATCTTTTTGGTATGAGAG
CCTGAGCCACTCATGCAAGACCTGGTTTGAGGACCTCAGGAGGAGACAACCCTAAAACTG
CCACGCAAGACAGGAGAAGCATAGAAAAGCAGAGAATTTCATATTCAGTGACCCTGAAAA
TCAAAATTGCAAAACACAAGAAACAGCATAATTAACACTGAATGAAATAACTTTTTAAAA
TTTCATTGCAATGTGATGTTTTCTTTCTAGTGACTGGTATGAACCCTCTGTCTCCTTATT
TAAATGTGGATCCACGATACCTGGTGCAGGTAAGATTAAGGCTAGTCCCTTTATGAATTT
ATTAGTTTGGTCATGTATCTTACCGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAACAGGT
TCTTAGACTGACCAGATCTATGATACAGATTTCTGGAGGCATTAACTCTGGTCTCCATTC
ACCCTTTTTCATTTCCTTGGAAACTCTGGAGATTTGACTTGCATCTCCCTGATACTAATT
AATTAATTCCCTTTAAAGGTTTTTTGGGGTCTCAGGTGGGTAAACGATAGCAGTATCGTT
TTTTTTCTTTCCCATTTAAAGGTATTAAATATTTTCTTTCCCATTTAAAGGTATTAAATA
TTTTCCCATTAAAAATTAAAATATACTAACAAAATTTACCATCTTACCTATTTTTCAGTG
TACTGTTCAGCTTTATTAACTACATTTATAATATTATGGAAGAATTACCACCTCCCATAT
CCAAAACTCATTTCATGATGTAAAACAAACTGTACCTATTAAAAAATAACTTCATTCTAC
CATTCCATTCACCTATCCCATGGCAACCACCCTTCTGTTTCCTCTAATTTTGATAACTAA
ATACCTCAAATAGGTGGAATCATACTGTATTTTTCCTTTGTGATTGGCTTATTTCATTTA
GCATACTGTTCTCAAGTTTCATCTATGTTATAGCATGTGTCAGAATTTCCTTCTTTTTAA
GGCTGGAGAAAATTAATCGAATAATATTCCATTTTGCTTATCCATTCCTCAGTCCCTAGA
TTGCTTCCATATTTTAGCTTTATGAATACTATTATGAACATTAGTGTACAAATGTCTCTT
CCTGATCCTCCTTTTGATTCTTTTAATTATATATCCAGAAGTGAAATTACTGGATCGTAG
GGAAATTTTATATTATTAATTGTCTGAGGAACTACCATTCTGTATTCCATAGCACTGTAC
CATTTTACATTCCCAAGAACTGCACAAAGGTTGCAATCCTCACCAACACTTGTTATTTTC
TGTTTTTGTTTTTTAATCATAGCTATGCTAATGGGTAATGAGGGTGGTGGTCATTGTGAT
GTTGAGCATTTTTTTATAAGCTTATTGCCCGTTTTATACTTTGGAGAAATGTTTATATAA
ATCCATTATCCATTTTTTAATTGAGTCTTTATTGTTGTTGAATCTAAGTTTTCCATATGT
TCTGAATGTTAACTCCTTATCAGATCCATGATTTGCAAATATTTTCTCCCATCCTGTGGG
TTACCTTTTTACTATTCTGATACTGTCTTTTGAGGCACAAAATTCTTTAAATTTTACAGA
GGTCAGTTTTTCTATTTTTTTCTTTTGTTGCCTGTGCCTTTATGGTCAGATCCAAGAAGT
CATTGCCAAATCCAGTGTCACAAAACTTTTCCCCTATGTTATCTTCTAAGAGTTTTATGG
TCTTAGATGTTACATTTAGTTCAGATCCATTTAATTTTTGTATTAGGTTTTAGGTAATGA
TCTAAATTCATTTGATTACATAGATATCCAATTTTTAAAGCACTATTTGTTAAAAAGAGT
GTCTTTTTCTCTTGGAATGGTCTTAGCCCTCTTGTTCAAAATCATTGGATCAGGGACGCC
TGGTGACTCAGCAGTTGAGCATCTGCCTTTGGCTTAGGGCATCATCCTGGAGTCCCACAT
CAGGCTTCCTGCATGGAGCCTGCTTCTCCCTCTGCCTATGTCTCTGCATCTCTTTCTGTG
TCTCATGAATAAATAAATAAAATCTTTAAAAACAAAACAAAATCATTGGACCATATATGT
GAGGATTTATTTCCAGGTTCTGTAATTTGTTTCATTGGTCTATATATCTGTCTTTGTGTC
AGCATCACACTTTTGATTACAGTAACCTTACGGTAAGTTTTGAAATCAGGAACATGATGA
TTGTTCTTTTTCTTTTCTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTGTTCTTTTTC
AAGATTGTTTTGGCTATTAGGGATTCATTGAGATTCTGGGATGGGTTTTTCTATTTGCAG
AAATATCATTGGTATTTTGATAGGGATTGCATTGAATCTATAGATTCTTTTGAATAGTAT
TGACATCTTAACAGAATAAAGTCTTCCAACCCACAGACATGGGATATGTTTCCATATATT
CAAGTCTTTAATTTCTTTTAAGAGGTTTTATGGTTTTCATTGTGTAAGACTTTCACCTCC
TTGGTTAAGTTCATTCCCAAGTATTATTCCTTTTGGTGCTATTATAAAAGGAATTGCTTT
TGTAATTTCTTTTTCAAATTGTTCGTTATTAACACATGGAAATCCTTTTAATTTTTTGTG
TTGATTTTTTTGTATCCTGCTACTTTGCTAAATATATTAGATCTAATATATTTTCTTAGT
GCCATGTGTAGGATTTTCTATGTATAAGATCATTTTATCTACAAAAATAAGAAATTTTGC
TTCTTCCTTTCTGATTTGGATACTGTTTATTTCTTCTTGCCCAATTGCTGTGGCTAGAAC
ATTTAGTACAAGTATCCTTCACTTTTTTGAAATTCACATCGTTCCACTTTTATGAGAGAC
CTACATTATGTAGATCTGAATCTAGTACCTGTTTACACTGGCCAAAAGAAATCAGAAGAG
GATTTTTGCTTTTACCAAAAAAGTGAAAAGCAAAAATAGCATTCAGCATTTGCTCTGCAG
TGAACTCTTCTAATGGCACCTTTCAGGCTCCTTCCTGGGGGGTCTACACTCAGCATTTCA
GCATTAAGAGATCGCAGCTTTGAACTATGTGAGCGTCTGTGCTTTATCTTTGTGCGTCTG
ATAGCAAGCTGTGTCCTAAAGTATGAGAAAAGCCTGAGAGGTTATCTTTTGGGTCTGGGA
ATAATCCATTTTTCCATGTAAGTTGATGAGAATTGCTTCTTCACTTTATGCCATTTTGAC
TCACAGAAGGTTTCATGGGAATGCTCTACTCATAGATATCAGGGGAGGCTTGTAGTATCT
CGAACACAAGAGACAGAAATGGTCGTCCTTGCCTTTTCCTGATCTTGGAGGGAAAGTTTT
TATCTTTTACCTTGGAATAAGATGTTCATTCTGGGCTTTCCTTATATGGCTTTTATTATG
TTGCATTAGTTTTCTTCCTAGTCCTAGTTTGTTGAATTTTTTTAGTCATAAAAGTGTGTA
GGATTTTGTTAGATGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGCAGTAGTTGAGG
TGATCATGTGCTTTTTTTTTTTTTTTTCCTTCTTTCAGAGCGTTGTATTATGTTGATCAG
TTTTCATGTATTGGACCATCCTGCATAACATTAATAAATCCCGCATGGTCATAGTTTGTA
ATCCTTTTAGTATGCTACTGAATTTGGTTTCCTAGTATTTTATTGAGAATTTTGTATCAG
TGTTGATAGGATATAGTGTTGATAGGTCTGTAGTTTTCTTGTAGTGTCCTTGTCTGGCTT
TGGTATAAGAGTAATGCTGGCCTTAAACAAAGTATTGCCTCCACTTTAATTTTTGGAAAA
GTTTAAAAAGAATTAGTGTTTTTTCAATGTCTGGTAGACTTCACTAGTGAAGTCATTAGG
TCCAGGGCTTTTCTTTGTTTCTTTTTTGAGAGAGAGAGAGAACACAGGGTGGAGGTGGGG
CAGAGGGAAAGGAGAGAAAATCTAAAGCAGGCTCCAAACCCCGCACAGAGTCTATGTGGG
ATTTAATCTCAACCCTAAAGTCATGATGAGCCAAAATCAAAAGTTGGACCCTTAACCAAC
TAAGCCACCCAAGTGCCTCTGTTGTGACAGTTTTTATTCCTGATTTCAGTCTTCTTATTA
GTTAGTTTTGGTGTATTTGGATATTCTGTGTCTTGGTGAGTTTTGTATCTCTAGGAATTT
ATGTATTTCATCAAGATTATCTAATTTGTTGGCATGCAGTCTTTCATGGTATTTTTAATT
CTATAGAATCAATAGTGACTTTCATGTCTGATGTTAATATTTTGAGTTTTTTTTTTCTTG
TTCATTTAGCTAAAGGTTTTTCAATTTTGTTTCTCTTCAAAGAACCAACTTTTAGGTTCA
TTGATTTTTTTTTTTCTCTACTGTTTACTTTTTTATTTTTATCTTCTCTAATCTTTATTA
TGTCCTGCTAGCTTTAGGTTTAGTTTCCTCTTTTTCTAGTTCCTTATGTTGCAAAGTTAG
GTGTTTTTTTTTTTTTTTAAGTTAGGTGGTTTATTTGAGATCTCTGATTTTTTTTTAAGA
TTTTATTTATTTATTCATAAAAGACACAGGAGAGAGGCAGAGACACAGGTAGAGGGAGAA
GCAGGCTCCCTGCGGGGGGCCCGATGCAGGACTCGATCCCAGGACCTGGGATCATGACCT
AAGTTGAAGGCAAACGCTAAACCACTGAGCAACCCAAGCGTCCCTCTTTGATTTTTTTTT
TAATAAGCATTTATAGCTCTGAATTTTCCCCTTAGCACTGCTTTGACTGGATCTTATAAG
TTTTGATGTATTTTCTTTTTTATTCATAATTATTTTCTAATATCTCTTATGATTTCTTTG
ATCTTTTAGTGGTGTACAGTTGTATTTAATTTCCATGAATTTGTGAATTTTTCATTTTAT
TTCTGTTACTGATTTCTAACTCATACTGTTGTGGTTGGAGAAGATACTTTGTATGGTATC
TTTTAAAATGTATTGAGACTTAATTTGTGTCTTAACATATAATCTGTCCTGGAAAACGTC
CCACATGAATTTGAGAATAAGGTTTATGCTATTATTGTTAGGTAGAGTGTCTTGTATATG
TCTCTTAGATCCGTTCTTTTTTTTATTGTGTTAAGTCCTCATTTTTATTATCTTCGGTCT
GGTTATGATAGTTATTCATTATTGAGAAGAGAGTATTGAAGTTTCTAATTCTTACTGTAG
AAATTTTGATTTCTACCTTTAATTCTACTATTTTATACTTAATATATATTAATGATCTAT
TACTAGGAATGTAAATGTTTATGATTGAATCTTTCTGTTGTATTAAACCTTTTATTAATA
TTCTCTGTCTTTTGTGACTTATTGGATTTAAAATCTATATTTTCTGATATTAGTATGGCC
ACACTACTGTCTTTGGTTATTATTTGCATGGAATATCTTTTGCTGTCATTTCACTTTGAA
TCTTTTTGTATCTTTGGAATTAAAGTAAACCTCAGTGTAGTTGGATCCTGGTATTTTATC
TATTGTGTCCATCTTATATCTTCAGTTAGAGAGTTTGATCAATTTATATTTCAAGTGATT
GTCTATAAGGAAGGATTTCTATCATTTTGCTGTTTGTTTTCTAGCTTTTTTGTCCCTCAT
TTCTTGCATTACTATCTTTTCTGTTTGCTTGATTTTTTTTCCAGTGCAATGTTTAAATTT
CTTAATTTCCTTTTGTATATATTCTATAGCTATATTCTTTGTAGTTACCAAAGGGATATC
CTGAAATTTTAAAACTAATTTAAAATCTAATTAAATCTAATTTGATCTAATCTTAAATTT
GAATTTTTACTAGTTTAGCTTTAATAACATACAAAAACACTACTTCTATAACAAGTGTGT
ACCCCTTCTCTCAGTTGTTAATTTCATAGATTTACATCTTTATACATTGTGTGCCCCAAG
ACATAAACTATTCTTTTTTTTTTTTTTTCTTAAGATTTTATTTGTCCCTTCATGAGAGAG
ACAGAGAGATAGGCAGAGAGAGAAGCAGGCTCCCTGCAGGGATCCCAATGTGGAACTCAG
TCCTAGGACCCAAATATCATGCCTGAGCCAAAGGCAGATGCTCAGCCACTGAGCCACCCA
GGTTTTCCCTAATGATTCTTTTATATATTTTAATATCCAAAATTTTGTGGAAAAGAAAAT
GTAGAGTTTGAAACCAAAGTTACAGTAGTGCTCTTTTTATAATTGCCCATGTATTTGCCT
TTATTGAAATCTTTCTCTCTCCATAAGGGTTTGAATTGTGATCATATCTTGCAGGACAGG
TCTAGTAGTCAAACTTCCTCAGCATCTGCTAATGTCTGAATATTTCCTTCACTTTTGAAG
GGCAGTTTTGGTGGATGTAGCATTCTTGGTTGACAGGTTTTTTTCTTTTAACATTTTAAA
TGTATTGGCACCTTGCCTTGTGGCCTCCAAACTGTCTCTCTCAAGAAATCTGATAGTCTT
ATTGAGGATCTCTTATATGTGACAAATTGCTTCTTTCTTGCTGCTTTCAAGATTCTTTCT
TTTTCTTAGGCTTTTAAATTTTTACTTTTAATGTGTCTCAATGTGAGTATCTGATTTTAT
CTTGAATATTCATTGAGCTTCTTGGATGTTCATATTCATCTCTTTCATCAAATTCCGCAA
GTTTTCAGCCATTATTTCTTCAAACATTCTCTCCTTCTTCTGGGACTCTCACAGTCTGTG
TTACTCAAGTTTGTGGTATTTCACCAGTACCTTAGGTTCTGTTTGCCATTTTTCAATCAT
TTTCTTCCTGTTGCTAAGACTCAGTAGTTTATATTGTCCTGTCTTGAAGTTTGGTAATTC
TTTCCGCCTACCTAAATCTGCCTATGAATCCCTCTAGTGAATCTTTCAGTTACTGTACTT
CTCACCTCCAGAATTTTTTTGTTTTTTTTTGTTTGTTTGTTTGCTTGGTTTTTGTTTTTT
TAGATTTTCTTTTTCTTTATTAATATTTCCTTTCCATTCTATTCATACATTGTTTTGACA
TTCTCTATATCTTCTTTAGTTCTTCAACCATCTTTAAGACAGTTGTTTTAAAGTCTTTGC
CTAGTAGATCCACCATCCGGACATGCAGGTGGTACGTTTTTGTTGATTTTTTTGTTTTTC
CTTTGGATGTCACACTTTTCTATTTTTCTGTATGCCTAGTGGTTTTTGTTGTTGAAAATT
GACATTTGAATCTAATAATGTGCTTCTGGAAATAAGATGTTCTACATTCCCCAGGATTTG
CTCTTTAATTATTACTTTTGTTTACTCTTTTGAGGTTTTTTTTTATTAATGTGGTATGTC
TTTGTGCCAAGGACCAGCGTATTTCTTAGTTCTTTTCTGAGCTTGCACTTTTCCAGGTCC
TGTGTTATTACTTTCTTATTTTACCTTTATGCACAGTTGCTTTTGAATGTCCAGTCTTTA
ATATCTGGCTCCCAACAATGGGGAAAAGAGAGCTTGAAAGGGAAACAAAAAGGGGAGTAG
CTCTTATTCAAATTCCCTGGAAGTCTGTGGGGGTTGGAGGACATGCAACAATAGCTTTGT
ATCTCTGTGATCAGAGCACAAATTAAAGGTTTATTTTTTAAAACAACAGGAACTAATTTT
TAAAGCACACCAATAGGGCAGCCCTGGTGGCTTAATGGTTTAGCGCCCTTCGGCTCAGGG
CATGATCCTGGAGTCCCGGGATCGAGTTCCACGTCGGGCTCCCTGCATGGAGCCTGCTTC
TCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTTTCTCTCTCTCTCTGTCTC
TAATAAATAAAATCTTTTTTTTAAAAAAAAGCACCCCAATAAAAATATTGGAGTGTATAG
TTGCAAAGTTCTAAAAAATTGTTAATGGTAAGTTATTTAAGTGGGAAATAGTGACATAAA
TAGTAATTAAATTCTATAAATGAGAATGTAAAATCTGGCAATCTTAACGAAATCTTGAAC
CAGATATTTACGTTAAAAAACATGTATTGGGGCAGCCTGGGTGGTTCTTCGGTTTAGTGC
CGCCTTCAGCCCGGGGTGTGATCCTGGAGCCCTGGGATCGAGTCCCTCATCGGGCACCCT
GCATGGAGCCTGTTTCTCCCTCTTCCTGTTTCTCTGCCTCTCTCTGTGTGTCTCTTATGA
ATAAATAAATAAATAAATAACCTTTAAAAAATGTATATTTCTATTTGAATTCATTTTGCT
TTATATTAGATTATTAATCTAATATATTAATATTAACTAATAATATGTTATGATATATAA
TATATTACATATAATAATATATTAAACTATTAATCTTTCTATTAGATTATGAATTTATTT
ATTTGAGATATAAGGGAGAGGGGCAGAAGGAGAGCGAACCTCAGACTCCTCACTGAGTGC
AGAGCCTGACAAGGGGCTCCATCCCAGGATCCTGAGATCATGTCTTATGCCAAAACCAAG
AGTTGGAGATCCCTGGGTGGCTTAGCGGTTTAGCGCCTGCCTTTGGCCCAGGGCACGGTC
CTGGAGTCCCGGGATCGAGTCCCGCATCTGGCTCCGGCATGGAGCCTGCTTCTTCCTTTG
CCTGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTCTGTCTCATGAATAAATAAATAAAATC
TTAAAACAAAACCAAGAGTCAGAAACTTAACTGACTATACCACCCAGATGCTCCCTATAT
TTTAAGGTTTACATTTGCTTCAGCCTCTCTTTTTTGTTATTTGGAGAAGATGGTAATTCA
GCGCAGGTTACGTTGCAAATTGCAGTGTTTTTTTAAAGCTCAATTATAACAACAGGATAT
TAGACTAAACTGATCAAGACACTACAAAGAGTATTGGATATCTCAGGAATGCAAGATTAA
TTTAACATCTGAAAATCAACATGCTAAGTTATATCAGGAAAGAATAAAAGAAGAAACTCA
ATAGACATAGAAAAACATCTGACTAAATTCAGTGTTCCTTTGTGATAAAAACATTCATTA
AGCTAAGAATAGGGACATCTGGGTGGCTCAGCAGTTTAGTGCCTGGCTTCAGCCCAGGGC
ATGGTCCCAGAGTCCCAGGATCTAGTCCTGCATCAGGCTTCCTACATGGAGCCTGCTTCT
CCCTCTGCCTATGTCTCTGCCTCTCTCTATATATGTCTCATGAATAAATAAATAAAATCT
TAAAAAAAAAAGCTAGGAATAGAGGGAAACTTCTTCAAACTGACAAGTGGCATTTGTAAA
GTAACCAAAGCTAACATCAAATGTAATGATGAAAGACTGAATACCAGTAATTAGGAACAA
GACTCTTATCTACTATCTTCATTTCTGTTCAGTATTTTTTTTTAAACATTTTATTTATTT
ATTCATAGAGACACACAGAGAGAGAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGGC
TCCATGCAGGGAGCCCGATGTGGGACTCGATCCCGGGTCTCCGGGATCACGCCCTGGGCT
GGAGGCAGCGCTAAACCCGCTGAGCCACCTGGGCTGCCCTGTTCAGTATTTTTTACCCAG
GGCAGTTAGGCAAGAAAATGAAGCGGCATTCAGATTGATAAAAGTAGAAGTAAAACTAGA
TAGATATTTGCAGATGGCATGGTCTTATCTATAGAAAATTTTCAGTGTGCTCAGTCAGTT
AAGCCTCCGACTCTTGACTTTGGCTCAGGTCATGATCTTCAGGGTCCTGAGTTGAGCCCT
GTGTCAGGCTCCATAATCAGTGTGGAGTCTGCTTATCTCTCTCCCTCTGCTCCTCCTACA
TGTGCTCATGTGTGCACTCTCTCAAATAAATAAATAAAATCTTTAGGAAAAAAAGGAAGA
AAGAAAATTTTTACAGAAACCACAAAATACTATTAGAAATAATAACTTCAACAAAGCTTC
AAGTTAGAAGATCAATGTACATACTCAAGTTATTTTTTAACCAGTAATAATAGACGCTAC
AAAAATGAAAGTACAAAAACAATTTGATTTACAACATCATCAAAAAGAATAAAAAATTTA
GGAATAAATTCAAGGAAATACAAAAGTTATACTCTGAAAAATATGAAACATTGAAAAAAC
CTGAAAGAAGACTTAAATAGAAAAATCAGAAGGTTGCATTTTTTGGGTAGAGAATATTAT
TAAAATTACAATAATCTACAAATTTCTATGCAGGTTCAGCACAGTTCCTTTAGAAATCTC
AGCTGACTTTCTAGAAAAGTCAGTCAATTTCCTTTCCAGAAATTGACTGGCTGACCCTAA
AATTCATATGGAAATTCAAGGAATGCAGAATAACCACTAATCTTGAAAATAATTCCACAC
TTCTCCCTTATAATCTACAAAAATTAAGACATTATTGTACTAGTATGAGGATAGCTCCAC
TGATCAACAATATAAAATTAGGGGCCCAGAAATAAGCTCTCACATTTATAGTCCGTTTTC
AAGGAAAGTACTAAGACTGTTAAGTAGGGGGAAAATGGTCTTTTCAACAAACTGTGTTGG
GACAACTGAATCTGTACACAAAAAAATGAACTCAGACCCCTGCCTCATATCATATTCAAA
TATTAACTCAGAATGGGTCAAAGACATAAATATGAGAGTTACAAAACTGTGAACTCTTAG
AAAAAATTATAGGTATAAATATTTGTGACTTTAATTTAGGTGCTGATTTCTTAGATATGA
CACCAAAAGCACAAGTGATTAAAAATAATTAGTAATTGGATTTAATAAAAACTTAGAACT
TTTCTGCTGCAGACTACAAAGTCAAGAAAAGGAAAAGACAGTCCACAAATTGGGAGAACA
TAATTATAAATCATATTTGATAAGGACTTACATCAAGAATATTTAATTTGGGCAGCCCGG
TGGCTCAGCGGTTTAGCACCGCCTTTGGCCCAGGGCCTGATCCTGGAGACTCGGTATTGA
GTCCCCACGTCAGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTC
TCTCTCTCTCTGTGTCTCTCATGAATAAATAAATAAAGTCTTTTTAAAAAGAATATTTAA
TTTTGGGGATACCTGGGTGACTCAGTGGTTGATCATCTGCCTTTGAGTCAGGACATGACC
CCAGGATTCTGAGATTGAGTGCCACATCAGTTTCCCCATGGGGAACCTGCTTCTCCCTCT
GTCTATGTCTCTGCCTCTTTTTCTCTGTCTCATGAATAAATAAAACTTATCTTTAAAAAA
AAGAATATATAATATTTTAGGAAACTCTTAAAACTCAATTTAAAAACGGATAAAAGATTT
GAATAGACATCTCTCCAAAAAGATACAGTAATGTTCGATAATCACATAAAAGACATTCAA
CATCACTTACTAGGGAGATGCAAATTACAAAACCAAAGTGAGATACCACTTCACCCTTGG
TACAGCAATAATCAGAAACACGCACTAACTGGTTTTGGTGAGGACGTGCGGAAATTGGAC
CTTCATGCACTGCTGGTGGAAATGTAAATTGAAACAGCTGCTTTGGAAATAGTCTGACAG
TTTCTCAAAATATTAAAAATAGAGTTACCATATGACCCAGTAATTCTACTCAGAGATATA
CCCAAGAGAATTAGAAACATATGTCCACAAAACAAATTGTACATGAATGTTCATATCAGG
TTTATTCTAACGAGCCAAAAAGTAGACACAACCCAAATGTCTTATCAACTTAAGAATAAA
CAAAATGTGGCTTCTCGTGCAGTGAGATATTTAGCAGTAAAAAAAGGATGAAGTAATGAT
ACATGCTGCATCATGGGTGAACCTTGTAAACTTACTACATAAAAGAAACCAAATCATAAA
AGACTCTATATTATATTATTCTACTTATATAAAATGTCCAGAATTGACAAATGAATGAGA
CAGAAAACAGATTGATGAGTAGCTGCCAAGGGTAGGGGATAAATGGAGAACTGACTATTG
CTCCCAGGTACCAGGTTCTTTTTGTGGGATAAAGTATAGTCTTTGTTGTAGAATTCTGAA
TATACTAAAAACTATTGAATTGTGCACTTTAAATAGGTGAATTATATGATGTGTGAATTA
TATATCAGTAAATTGAGTGGGGTTTTGGTTGTTTTTTTGTTTTTGTTTTTTTGTTTTTAA
GAGTGATGGTTAGGACTTTTTGTTTCAAGTTGAATCACTAACAATATTTGACTACCTGCA
TTTCTTGAGTGTGTTTCAATAAAGGCAAGTTGTTTAGGACTTGTATAAAACTTGTTTTTG
CAGGAAATGTTTGCCAAATGTTTGTCAAATGTCAGTGTTATCTACACTGTATGTTTATTG
ATTTATTTCAAAAGTACCTCGTTAGTATTTTGCTCAAAATTTTGAAACTATGTTTGCTTA
AATGTTGATCTTAAGCTTAAAGGGTGTACTGTAGCTCCATTAAAAATACATTTTGAGGGA
TCCCTGGTTTTGGTCCCTGCCTTTGGCCCAGGGCGTGATCCTGGAGTCCCTGGATGGAGT
CCCGCATCAGGCTCCCTGCATGAAGCCTGCTTCTCCCTCTGCCTAGGTCTCTCTCTGGGT
CTCTCATGAATAAATAAATAAAATTTTTAAAAAACTAAAAATTAAAAAAATAAATAAAGA
TACATTTTGACCCTACATTGGTAGGTGAGGCCTGGTAAGGTTAGATATCAAAGAAAACTC
TGCGTTTTTAAAAAAATTAGGATTCCTAAAAAAAAGAAAAGAAAAGAAAAATTAGGATTC
CTGCTTAAGCACAAACATTTGTGGTAACCTTTTCCATTCAAATGCAAAAGGGACTTCAGA
ATTAAAAAGTTTCTCTCATCTCATTGTTAAAAAAAACCATGGGAAGTCTAAATTTAAAGA
CTACCTTAATCAGAGTTGTACTTTGAGGAATAATTTTCCGTACTTTTGAAGGGCAAAGAC
ATCTTAAATACTACCTGTGAGCTCACTGTATACTAATTTTTGGCAACAACTTTTATCCAA
GGTACTATTTGTGGTTTCTCTCTCTCTTGATTTGTTTATTTTAAAGAGAGAGAGAGGGCA
TAAGTAGGAGGGGCTGAGGGAGAAAGAGAATCTCAAGCAGACTCCATACTGAGTGCAGAA
CCAGACACAGGGCTCATTCTCAGGACTCTTGAGATAGTGACCTGAGCAAAACCAAGAGTT
AGACGTTTAACTGCACTGCCCAGACACCCCTTTGGTTTCTCTTACTGTTGTTTTGTGTTG
TCACCATATTTGCATCCTCACTGGTACATTAAAAATTATATTAAGTAAATCTTCCACTTT
TTAGGCCAGATGAACATCCAATATAAACAACAGTATGAATTTGAATATTTCTAACATCCA
GTGTCATCCAGTTGAAATATAAATATTTAACATAATTTCAGCCTTCATACTATTTTATCA
AGTACAATGGTGCCCATCCTTGGATGCATTTCTCTTCTATAGTAGCAAACAATGGTATTG
GTGATCTTCTAGTGACACTAGTGTCCTACAGTGTCAGCACATAAGAATTTTTCATTGTAC
AGTGTTTGTTAACGTGAGCTTTACAGTGTATCTTCCCTAGATGTGTAAGGATACTTCAAG
ATCAACCTTGCTAAGTGTTTATTTCTTGGAATTCAAATTTGGTTAATAAGCTGTTAATCA
TACTTTTGTTAGAAACCAAAACAGGATTTTTTTAGGATTAATTTAGCCAGTGTCTGCTCC
CTCAAAAATCTTTGCAAATTTTTGTTATATGAAACAGTACATTTTAGGGGCACCTGGGTG
GCTCAGTTGTTAAAGCATCTGCCTTCAGCTCAGGTCATGGTCCCAGGATCCTGGAATTGA
GCCCCCTGTCAGGCTCCCTGCTCAATGGGGGTCTGCTTCTCCCTCTCTCCGTTCATGCTG
TCACTCCCTCTGTCTCTGTCTCAAATACATAAGTAAAATCTTAAGAAAAAATTTAAAATG
AGGGTACATTTTAATTGCATTTAAGATTAAGCCCACGCCAAAAAATAAAGGATTAAGCCC
TAATGACAGCTAACGATGAAATTGTTTTCTTTTTTTTTTTTTAATGAAATTGTTTTCAGT
TGATGTACATTTGCCTTCAGTCCTCGTAGTGCTTTTATTATGGTTGAACCTAGCAAAGAG
TAAGTACATGCACTTGTGTTTATTAATATTCATCTTGATCATTTTTAAAAATTTCCTATT
TGTGAGCCCTGGGTGGCTCAGTTGATTAAGCATCTGCCTTCAGCTTAGGTCATGATCCTG
AGGTTCTGGGATTGAGTCCCACATTGGTATCCCTGCTCTGGGGAGCTTGCTTCTCCCTCT
CCCTCTCCCACTCACTCACTCCCCTTGCTTGTTCTCTCTCTCTCTCTCTCTTTGTGTCAA
ATAAATAAAATCTTTTTTAAAAAGAAATCAATTTCCTTTTGAAGTCAGTGATCCATTTCT
AGTTTGAAAAACTATACACCTCATTAATTCAAATACAACATTTCTAAAATCCTCAAGCCA
GAAGCATAATTTAAAACTAAGTCATTAATTTAAATATCTTTTTTTTTTAAACTTTTATTT
TATTTATGATAGTCATACAGAGAGAGAGAGAGAGAGAGAGAGGCAGAGACACAGGCAGAG
GGAGAAGCAGGCTCCATGCACCGGGAGCCTGACATGGGATTCGATCCTGGGTCTCCAGGA
TCGCGCCCCGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCCTAAGTC
ATTAATTTAAAAGTCAGGAAGCAGGGTGCCTGCGTGGCTCAGTTCATTGAGCCTTTGATT
CTTGGTTTTGGCTCAGGTCATGATTTCATGGGATCAACCGACTCCGTGCTCAGCTGGGAG
TCTCCTGAAGATTTTCTCTCTCTCTCCTCCCTCTGCCCCTCCCCCCACTTTCTCCTTTCT
CTCTAAAATAAATAAAATCTTTTTTTTTTTTTTTAATAAATAAAATCTTTAAAAAAAAGT
TAGGAAGCATCCAAAATTTGCAAAACTATATATAATATAATATGGGATCTCTTCAGAATT
TGCTTATTATTGCCCAATAGACCATTTCTGAGTGATGAAAGTAAATGTGCTTGCTTTGAG
TAAATTTATGACTTTTTGGTGAGAAAGTATGCAAACGCTAGAAATCAAGAACCAATGCAG
AGCTACAGTTTTCCTAATCAGGAATGCGTTTACCAAAGTTCTATATTTGGTGAAGGGATG
TTTATTAGTTAGCAAATTGCCAGCCATGTGTGCTTCTAGCTTATTTTAACCAGTTTTTAT
GGAAAGCTTGGCAAATGTGTACTGAATGTGTTCTTTATAAGAGTGTATTGTATTATAGAA
CAATCATTGTGCTCTTACAGTAGCATTTTCAACTAAGGATTTTTGGGTGGCCTTCATGGC
CATATTTACTGATATATATAGTTCACATACCATATTTACTGTTTCCAGTAAATATCAAAT
TTACTGGAAAGAGAGACTATATAGCTTTCTAAGATTATCAAAAGAATATATGCGCCCCCA
AACAGTTGAGAATTAAGAAGGTAATTTTGCTTTTGCATAATTAATCCAAACTGTTGTACT
TCTGTAGTTTCTGCTTTTTTTTTAATTGAGCAGATTGATAAATAAATAGCTATAGAATGA
AAGTTTTCTTTTTCCACAGTTATGTTTCAGTTGAGTAAACTATTACTTCTTATGCTTTTC
CATTTACCTTTTTCTTTAGCTGTCCTTCCTAAACATTCTTGCACTGTTGTTTCATATTTA
ACATTAAGTAAGGCAAATTACATACCCGTAGAATCTATCAAACTTAATATTGAGAAGCAA
AGTTCTGATGAGAATGCCTCCTAAGAACTAGTGAGTATAACTACATATGTAGCACATTTT
ATTTCACTTTGATTTAGGTGTTAGTATTGTTGTAGAAACTTAATTTTATTTGACCAAGTG
TAATTGAGTTTTAGTTGACTTAAGGTTTTACTTTTTGTGAAAAACTAGTTTGACAAATTA
AAAAACACTTTGCAACTCCTGGGTCTTGAGGGGAGCTCAGCTTGGATTTTGTTATTACCC
CTTTAGGATACTGATGAGTTTATTTTACCCACTGGAGCTAATAAAACCCGGGGCAGATTT
GAACTGGCCTTCTTTACCATTGGAGGATGTTGTATGACAGGTGGGTATGATCACTTTTTT
CACTGTCCTCAATCCAAGTAATCAAAAGTGTGTAAAATCAAAAGTAATTCAGATATTGGT
TCCAGAGTTTTAAAAAATCATTTAGGGGTACCTGGCTGACTCAGTCCGTTGAGCATGTGA
CAGTTGATCTTGGGGTTGTAGGTTTGAGCCCCACGTTGGGTGTAGAGATTACTTAAAAAT
AAAATCTTTTAAAAAATTATAAATAATTATTATATACATCTTTCATTTTCTCCTACTAAA
ATTAAAAAGAATTCGAAGTGCAGGTTTTTAATGGAAAGCTGTATTATTTGGTTGAATCAT
TACTGTGAATCACTAGGGGCTGCATTTGGAGCAATGAACGGTCTACGGCTAGGATTGAAG
GAAACCCAGAACATGTCCTGGTCCAAACCAAGAAATGTACAGTAAGTCTTATAATCATCT
GATGTAGTGATGTTTCAATATTAACCTCTACTTTGTTGGCTTGATGAGCACAACCTTGAG
ATTACAAATGTTTAGGGTATTGACATACATTTTGATTGATTTTTTTTTTCTTAAAATAAA
AGTAATTAAGGAGTCAGGTTACTGAGGCTTAGATTTTAAAAGGAGTGATTTTTGTCAGTG
TCCCTCAATTAGCTGTTGCTTCCCCGACCTAACTTCTCTACTTTTTCATTCTATAGGTCT
CTGTGACTTGCTTTTCTAGTGGTTGAATTGCTAATACATTAGTTAGATTGTTCAAGGGTG
TGCAAAACCATAGGACATGATAGTAAAGAAAGAAGCATGTAAGAGTGATTACTGGATCTG
CTGTCATTTGAATTGAACTACTTAACTGACTTCACTCACTGTTTCTGAAAGGAGAAGGCT
AAAAAAAATTTATCACGGAGTCCCTAGAACTTAGGGATAGTTCCCTGAGTCTTCTCTTAG
GAAATTGAAGTTTGTGGAGAAGGAAAGTAGACATCTTCACCCTGCCCAAGAAATAAACAT
GATTGGTCCATGTAGATATTCTCTAAATAATATGATGTTTAGTTTTGGATGTTTTTACAC
TTTTTTTTTTTTTTAAAGATTTTATTTATTTATTCATGATAGTCACAGAGAGAGAGAGAG
GCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCATCGGGAGCCCGACGTGGGACTC
GATCCCGGGTCTCCAGGATCGCGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCAC
CCAGGGATCCCTGTTTTTACACTTTATATGGGTGAAGTCACACAGTATATATTTATACAA
TGGCTCATCATCATTTTTTTTAAAGATTTTATTTATTCATTAGAGACACACACAGAGAGA
GACGGGGGCAGATATAGGCAGAAAGAGAAACAGGCTCCATGTAGGGATCCCAGTGTGGGA
CTCCATCCCGGGACTCCAGGATCACGCCCTGGGCGGAACGCAGGAGCCCAACCGCTGAGC
CACCCAGGCATCCCTGTCATCATCTTTATATGTAGTTTAGCCAGCAGGTGGCAGCAGGTT
TGCTAAATTAGACCTTGGGAATCCTGTCAAGTTTTTCATATTCTTGTTACTATGTGGATC
TTGCTTTACTAGGCCAGATCCTTGCATATTTTTACATTTTTATTAATGCTTGTCCCTTAC
TCCAGAGCATCTGCATGGGGATACTTAGCCGAAGTATCTGCCTTCTGCTCAGGTCATGAT
CCCAGCGTCCTGGGATTGAAACACCTTCCTTCCATCCCCCTGTCAGGCTCCCTGCTCTTC
CCTCTCCCTCTGCTTGCCGTTCCCCCTGCTTGTGCTCTCAAGTGCACTCATGTTGTCTCT
CTCTCTCTCTCAAATAAATAAAATCTTTTTAAAAAATTTGTCCCTTACTCCAGTACTTTT
TTTTACTTTTTTGTGTTATGCAGAATTTTGAAGATGTACAAAAGTAGACAGAATAGTACA
GTGAAGACCCATGAACCATAACCCATCCTCAGCAGTCGGCCAAGATTGGGACCAAATGTG
CCCCATCTTATTCTCCGCTCGCATGTTACTTTAAAGCAAATCCCTAACATCACATCATTT
AATACCAATTTGAAAGTGGAGGATATGCTAGAAAAGACAACCTTTGTTGCTTAAAAGTGA
TAATTATTAGTGTTTTAGAGAGAGTAAAATTGATTTATATTTTTTTAGGTAAGATTTCTA
AAATATATATTCTTAAAATATATATAATTTTTTATATGACCATTCTAATCTTATTGGATA
GGAAGCATTTAAAACAGGAGACAACCGGGGTAATAGGTGGCTCAATTGGTTAAGGTCCGC
CTTTGGCTCAGTTTATAATCCCAGCTTCCTGGGATTGAGCCCTGTGTCAAACTCCCTGTT
CAATGAGGAGTCTGCTTCTCCCTCTCTCTTTGCCTGCCCCCCACCCTGCCCCTCTTATGC
TCTCTCAAATAAATAAATAAAATCTTTGAAAAATAAAATGAATAAAGTAGGAGGCAGCCT
CTAAAAAAATGGAAAGAAAGTAAGGTTTGGGGCCAGTCAGATCTAGTAGCTTCAAAGCCT
AGTTTCTTACTTACTGTTTTGTGATTTTAGGTAAGTTTTTTTTCTACACTGAAGGGTTGT
TGAGAGGTGATTAAGGTAGCTAAATAGGGGCTCAGTAAGTGGAGATATATTTCCCAATCA
TATCCCAGACAATTTCACTAACTTGCAGTGCTTCCAGCGGTATAATAAAAGTAATAGTTT
TAAAAACTTGTTACAAATGACAGTATACTGAACTTAAAATAAGTTAGTAAATATGTAACA
ATTAGTTAGAAACAATATACTTCATTACTAATTTTTAAACAGCTTTTTAGAGATAAATAG
AAATTTTTGTTATTTGGACATTACATGAGTTTTTTAATTGCATTAAATGAGTTTTTTCAC
TTTGTTACTGGAATTACATAATTTCCAGCAGTAGTCAGCTGTCCGGATAGACCCATTCCT
GTGATGGTGTTACACTGCTGGGAGAGGAATGTCTTCTTCCTCCAGTTGCCTCTGTCACTG
TTTTGGTGGCGCCTGGCACTGGTACAAGGCAGAACTATGCTTCCTTGAGAGTATGCTGAG
CGTTCACTCTGGCCGCTTGGTTCTAGTCAGGGAGCAGACATAGTATGTTTTCTGTGTGTA
TTCTACTGAGACAGCTTTTTCCTTCTCTTTGAGTATTTCCCCTTATTTCTGCTTTTTTTT
TTTTTTTTTTTAAGATTTTATTTATTTGACAGCACAAGCAGGGGGAACAGCAGTGGGAGA
GGGAGAAGCAGGCTCCCCACTGAGCAGGGAACCCAATGTGGGGCTCAATCTCAGGACACT
GGGACCATGACTTGATACTTTAACTGACTAAGCCACCCATGCACCTCTATGTTACTTCTT
TTATGTAAATCAATTACTATAAACTTTTTTTTTAGTAAAACACATTCTAGGCTGTCAAAT
CCTTTGTGTATTTGATTTATATTTAATAATAAGAACTTTCCTTACTGCCCAAAAATGTTA
GAGGTTTAACCTTCATTTATATTTATATACAGTAAAAGTCATCCTTACTAAATTCTGAGG
AGATACTAAGGTAAGTCTTAAAATTAAGAAAACTTCAGGGGGTGCCTGGGTTGCTCATTC
GATTGGACATCTGACTCTTGATTTTAGTTCAGGTCATGATCTGGGGGTCCTGATACCAAG
TCCTGCCTCAGGCTGTGCACTCAGCGGGGTGTCTGCTTCTCTCCATCGGGTCTCTGCTCG
TGTTCTCTTTCTTTCTAAAATAAATCAATAAATCTTTTTAAAAATAAATAAATTAAAAAA
ATAAAAATAAATTAAGAAAACTTCGGGTATTGGCTTTATACATTATAAATAGCTACAGTA
ATGGTTTTTCAAATTACTAGAGAAATGGTAATTCTAAGTACAAATTCTTTCTCTCTCTGC
CCTGGTAGGATTTTGAACATGGTGACTAGGCAAGGGGCACTTTGGGCTAATACTCTAGGT
TCTCTAGGTAAGTAGAGATCTCACTTAATAAATCATTAATGCAACAAAAGAATGTGTATG
TATCATGAACAATTTGGTCAACCAAAGTTCTGGCCCTAGGATATTAAACATTTTATTTAA
ATCTACTCTGATGAGTAGTGTAGACAATACTTAGGAAAAGACCATGAACAACATAAAGTA
ATTCCAGATGTTAAAGCCTTTTCTCAATGTTTTAAGTCTTTTTAAATATTATATACTCCC
CTGTCCAAGCAAGATACCAAATCATGTTTTAAGTAGATATGAAATCCAGGTAACTTAGAT
CTAAGTCCAGTGCCTCTTTATGTTAAGAAAGGTTCAGGGTCCTGTAGTAAGATACGGTAG
ATTAATTCATCCCTCTTGCTCTAGTTTCCTAATAGCCCATTCAGCATTCTATTTACTTCA
GTAGATTTCTCAGACCCTATTTCCAGAGTTATAATAGGACCTTTGTAGATAATGAAAACA
TTTGTTGTTCTAAGCAAAGGGTAAGTTAGTAGGACTTAGGACCAAATTCTTTCATATTAT
GTTGTTTATAAATGATTAACTCTTTTGGTTACTCATAGCTTATAATAAATGTACCAGTGG
TATTTATACTGTAACAGCCAAGAATGTCTTTGTAACTTAGTTGAAAGTCTGAAAATCTTT
TAATTGTGGCAGATTAACTAAAGGAAAATGTAATCATCTCATTGAAAAAACATAGAAAAG
GCGTCTGTTGTGAAAGAATAATACCCTAGCTTTGTCATGGGATTTGGAAGCAGTACATTT
TCACACCATGAAGTCAAATTGACATTTGAGATTCTAGGAAATGACTGCTTCAATGTGCTG
CTCATATACAGTCACCCTTCTTTGTTTCTGTTTGGTTGCTTATGTAACTAGAGTAATCTG
CCATCCTGGTCTGCCCAGGGGACTGTCTTTGTTTTAGCATTGCAAATCTCATGTTCCAGG
AAACTCTCTTCCTGAGTGAACTGAGATGCTGACCAATTACCTTGTGTGTTCCTAGTATCA
TATGATCAATCACAATGTTTTGCTCAAGTTCAGTTTCAGTTAAAGAAGTTGAAATGGCAA
GAAGAGCCTTTACAGAAGTATAAGAATATCACAACAGAAGTGTTGTAAGGCAGTTTGGTG
TAATATTGAAGGGTCAAATAATGGCATAATTTTGAGAAATGATAAAAGGATTAATCGGAA
TCTTTACAGGAATAGGAGAAAGGTAGTTTGGGGGATGATTTTGTTACAACTATATCATGC
TAGTGTTAATAGTTTTTTACATGTGAGGGAACCAAACCTCAAATTTTTTTAAGTTAACAT
CTTTGTTAAAATAGAAATGCGTGTGTCTTAGTTTCTAAATCCAAAGTATATAGCTGTTAT
GAATAAGATATAAGTGAACATTAAAAATATTTTTCCTGGGACTCCCCAGCGGGACTTTTT
ATTAGTAGCTACTATTCTTGTTGCTTCTGAAGCTTTCCACAGAATTTCTTTGCATATCCC
CAGTTGTACACACATGTGCCTGCTTTTACATGCTAGTGATACGGTTTTTCCTGCTTTTTC
TTTGGAGTGTGTAGTGTTCCAGTATATGGAAAGTCCACTTCTTGGTCTATACCCTTTGAT
GGGCATTTGATTTGGTGCCAGGCTTTTGCAATTACAAATAGTGTTCCAGTAGTCATTCTT
TATATATCTTTGAATGCTTGTAGAATGTCTGTAAGATATATTTATCTAAACATAATTGCT
CTACTGACTTTTAATCACTTTTTTATTACTGATCAGTTCCATTTCCCCTTTAGCTTTGCT
CTATAGTGCATTTGGTGTCATCATTGAGAAAACACGAGGTGCAGAAGATGACCTTAACAC
AGTAGCAGCTGGAACCATGACAGGCATGTTGTATAAATGTACAGGTAGGTACTACTGAGT
GAAGAGGAGCTCTCAGTAGTTTTAAAACTAAGTAGCCACAGTTTTCAAAGGATACTTGAC
ACATTTTTTGCAGTATAATGGAGAGCTGAACAAAACTCCTGGTTGTTTTGTATTTTTCTT
TTTTTTTTAAGATTTTATTTATTCATGAGAGGCAGAGACACAGGCAGAGGAAGAAGCAGG
CTCCATGCAGGGAGCCCGATGTGGGGCTAGATCCTGGGACTCTAGGATCACACCCTGGGC
CAAAGGCAAGTGCTAAACTGCTGAACCACCTAGAGATCCCCTGGGTTTGGGTTTTTATTT
GTTTTTTTATTAAGTGTACATTCAGTAATATTAAGTGTATTTACATTATTGTGGAATATC
ACCACCATCTAACTCCAGAACATCTCTTCATCTTGAAAACTAAAACTGTGTATCCATTAA
ACAATTTTCCCCTTCCTTTTTATTTTCTAACTATGAATTTAAACTCTTAGGTACTTTAGG
GTACCTCATATAAGCAGAATCGTACAATATTTGGTCTTCTTATGACTGGCTTGTTTCGTT
TAGCATACTATCCTCAAGTTCATGTTGTAGCATGTTTCAGAATTTCCTTTTCAAGGCTGA
ATAAAAACTCCCTTGTACATATCTACATTTTATTTATCCATTCATCTGTCAGTGGATATT
TGGATTGCTTCCACCTTTGACTACTTTGAATAATGCTCCTGTGAACATGGGTGAACTAAA
TACCTTTCAACTTTGAAAAAATAAACAGAACCATAAGAGTTGAACCAAAATGACCTGACT
GGAGATCAAATACCAAATTCTCCTCTAAGATGGAAAAGAAATTAACATTCACTGCATTAT
GATTATGCCCTCAGCTATAAGCACTTAATGTAACTTACTTAAAACTGTGAAGTCATCATC
ATCACACCCCAATTTTATAGATGAATGCAGTATTAAGAGGACTTTTCAAAAGGTCACATA
ACTGGTGATAGGCCCAAGTTTTTCATCACATTTCTGCTTGAAATAGCTTAAGCTACATAT
GTACTCTACTTATACCTCTGAAAATTACATTTGTTTCATTGTTTTACTATGCATTAGAAA
TGATTAATGGAGTAATTTTGTTTTTTGGAAATTCCTCCACCACAAATATCAGGTAGCACT
TTTGCTTCATTTTTAATAGAAGAAAGAAAAGCTTCAGTGGGATCATGAAATCCAAGATTT
CCTGATACATCTGAGAGTGAGGGGTTTTTTTTCCTATATTGAAAATGGATTGAGGGTTCC
TGGGTATTCAGTTGGTTGAGCATCCTACTCTTGGTTTTGGCTCAAGTCGTGATTTCAGTG
TCATGTGATCAAGTCCACCACCCCTCTCTCTTCCTTCAAAATAAATAAATTTGTAAATCT
TTTTAAAAAAGAAGAAAATGGATCATATTTGGAATTTTATTCCTAAGAGTTCACAGTATT
TCTTGCACCACATGCACATGTATGTACTCAAATAAACAGAGCTCCAGGTAGATTGAGACG
ATAAATGCCTTTTATGTCTATGAAGATGTTACCTTAGCTAGAAAAACTTTCTTAAAAAAT
CTAAAAATACTTCAAGTTGAAGATCTTTAGGATCAGACAAAAGAATTTAAAACTTTAATT
GGCAGCACAAGGGTGCATTTAGCAAGAGTTTACTTGGCCCAACCTGTGTTTAAAAAGATC
AAATTAATATTTAAAAAACAAGAGATTTCACATAGAAATCTGGAATTCCAGCTTCTTTTG
AATAAATGGAAGACAAAAAGCTTACATTATTCAAGTTGACATATGGCTAGGGCTGAGTGG
GAGCTGTTTCTGTACCAGTACATGGGCACTAAAGCTCCAGTTCAAAGAATACATTAGGGG
TTGGAAAGTCCCGGTCTTATTCAGGGTAAGCCACTGTGGGATTTCCCAAGCTCTAGGCAG
GCTTGAATATAAGAATGTACTGAATTATTCATCTTAGAACATATTATACATATTTAAAAG
GGAAAGGAAAAGGCTGAATTCTTGATTTTGGAGGAAATGGGAGCCTAGCTTTCTGTGTCA
AGGACTTCCTTGCAGTAATAGCATTTATGACACAGGCTGAGACACCTCCTGCATAAATTA
TAAAAGAGAAAGGTCTTGGTTCAGAAGAGAAGAAGCAAAAAAAGAATATCCATAATTCTA
TGTCAGGTGACTGCAGATTTCATTTTCCATTACAGTGTGAAACATAGAGGAAGTTAATAA
TCTGCTGACCAAGAATTCCAACGTCGGCTCATAGTTTCTGGCTGAACAATTTAAATTTAG
CTCAACACATTGAAATCAGTCTACAGAGGAGTCTTGTTGATTTCTGGTTTAGAATGAATT
TAATAAGTACAGAATTACAAATTTTGTGTGATAGGAATACAAATACAACTTCAACTTCTA
GATTCAGGGATTTGGAAAAGAGTTGAGGCACTCTTGGTCTAGAGCCAGCATAGACTCTTA
AGGACAGAAGTTTACATTTAGGGAATAGCTGATTCTTGCTGACATAAAACATTTCCAACC
CCCAATGTATTCTTCGACAACAGAAATGAAAATTAAAAAGGTTAAAGTAGTATAACTCAA
CTTAGGTATGGAGCTCCTTTAGTGGAAAGAAAACTCATGAGGAAAAACACATGAGAAAAT
GGGTAGTTATCAAACTAAAAGCTTAGAGACTAATTTAAATGAATAATTCTCTTGAGTGAT
TTTAGTTCATATCTGTTTATTTAATGAATTTATGTAAATATTTTTCAAAGGGTATGAAAT
GTCATTATTAGATTTTCTATGGCATATGAAAATCTGTTTAATAATGATCCATATTGGGGC
GCCTGGATGGCTCCGTCCATTAGATGCCTGCCTTAGGCTCAGTCGTGATCTCAGGGTCTT
GGGATTGAGCTTCCTCTTAGACTCCTTGCTCAGCAAGGATCTGCTTCTCCCTCTGCCCTT
CCCCCTTGCTCGTGCTCTCTCTCTCTCAAATAAGTAAATAAAACCTTGGAAAAAAAATAT
TGACCAGTATTCTACCAGAAGAGGAACAGCTGTAGTTTTGCTATTGTTCATAAGCTTAGG
ACTAATGTTTAAAAGGCTTGGCTTGGTCACTTATCTGAAATCAGGAACAAGGCATCAGAG
ACTAAAAGATATGGGCACCCTTTTCTCCCCTCACAAAAAATCCCTGACCTGTTCATTCTG
TGCCTTCCATAAGATTGTATTAGAGAAGCAGACTAAATAAAATTAAGGATATTCAAATAC
ATTTCTTCATATTAAGCAAATATTATCAGGGTTATTGTTAAAAGGGGTACTTTTATCAAT
GAGTGCCAGGCCTTCAAAATTAAACTTTGAAGATTGTATTAGAGAAGCAGACTAAATAAA
ATTAAAGGATATTCAAATACATTTCTTCATATTAAGCAAATATTATCAGGGTTATTGTTA
AAAGAGGTACTTTTATCAATGAGTGCCAGGCCTAACAAAATTAAACAAAGACTTTCTTGA
TGACTTTCTATTAGTGGCAGCAATATTCTTCCAGTAAATTAAAATACACATATAATAGGC
AGAGGGTTAGCTGCTGTAATATACAGAACATTTTGACAGATCACTTAAACCAACAGTCCA
ATAAAAAAGAGTAAGGATTGACAGAGCGCTTCAGGGAAAAATACAAACTACTAACCAATA
GAAGCTATTCGGTGTCCCAAGCAACCAGGGCAAAGCAAAATAAAACATTAAGTTAATATT
TTTCACCAACTGCCTTTAAAAAAAGTGATGACAAGTAACTAACTGATGGTCACCATAGGG
GAGTTGGGTGGGCGGATGCGTTGAAATAGGAGTAAGGAGTGCACTTGTGATGAGCATCAG
GTGGCTAAAATAAAAACTTAAAGTGATGGTAGGTGATACTTAATATTGGCAAAGGGAAGC
AAACAACTGGCATTAGTATTAGTATTTTGAATATGTAGATCCTTTGCTGAAGTAATCTTT
CAGCAATTTATCCTCCAGCAAACTAAGGCATACACACAAAACTGTATGCACCAAAGTTTA
AGACTGGCTTCAAGGAGAGGGCATATTTGAACAAAGATGAGGGAGCATGTGAGATGGCTG
TCTGGAAAGAGTGATTTAGGTAAAGGCTAACAACAAAGTCCCATGGGGATTAAAAGGCGG
CCGGGGTTGGGGGGGGGGACTGCGGGGTGGAGAGCAGTAGACTCTGGAGTTATCGTAAAA
GTGGCAAGGGACTAAATCATATAGAAAATAGAGCAGCTTCATAGGCCACTGAAAGAATCT
GACTTCACTGGACTTTGATTCTTATATTCTAAATATTAGCATTTCCATTTACTTACAAAC
CTTAAATTGTTGATCATAATTATCAGGTAAACTTTCACTGTTCTGGGTCCAGAGTTTTCA
TGGGAGATGTTAAGTCAGTGTTGATAAACCCTCTTAAACTTGCCTAAGATTCTCAAAGGG
GACTGGGCTACCATACCACCACAGGAAAGCAACCTCCAAAATGACTAAGAATCTGATGAG
AAGAAGAAAAAAAGTCCTAAAACGATAGTAATGTGGGGAGTCAAAAACTATTGAGAAAAT
TTAATAAGTGTAGTCTTGTACAAGAGAACTGGGATTGCTGGGGAGGGACTGGTGGTGGTG
GGAGGGACTCCCTCACCATGGGAAGCCCGAAAGGCAGCTGCTCTGCTGCTAAGAGTCACA
CATACTGCTTCCACTCTGTAACAGAGAAAGTGAAGGGGGGGGTGGTGGAAGGGAAGCAGG
AAACAGCATCTTGTAGTGTTCCAGTTGCCATTGATAACCCACTTTCTCTCACCATCCCCT
CATTTCATCATCCATGAACTTCTGTACCTACTTCTATACTATAAAGTATTTTTATTTTTC
ATTGACCATTTTGACTTTAGACTTCTACCTTCAGTATGTCTTGTCTAATCACTATTTCTG
GCTTAATCTTCCTCAAGTATGGTACTAATTCTAATACTCCCTGTCCAAAAACTTTTGATG
ATGACATACTGCTTTTCAACTTAAATTTCTCATCCTAGCCTTCCATGCTCTAATCCTAGC
CTACATTTTCAGACTTTTCCCATACCTTCCTTGCATATATCATATGACCAAACACATAAA
TTTGAAATCCAGTCCTTCTATAAGGCCTAGATCAACTGTTATTACCCCTTTCAATAGATT
TATCTATCTATCCTGGAGGCAGTTAAATGTGGTGTAAAAAACAAAGGGCTTTGGAGTCAG
ACTGGGTTTGACTTGACTAGCATTAGATCCCTAAACAGCTACATGTGCAGAGAAGAACTT
GTCTGAATTTGTTACACAAGGGTATATTCCCTTCACAGACTTGTAAATGAGATAACTTAC
ATAAAGTAAGTTACTTACATCCCACCATAAGCACATTTTATGTAATTTTTACAAGGCTTA
ACAGTTTTCCTGGTAGGAAGTCAGTAGATAAAAAGATTGAAAAATCGAGAACTAGCAAAG
TAGTTGTGTTATTTAGAAACATGAAGGTAAAAAGCAAAGAATGAAATGGTTGCCTTTGGG
AACTAGGAATTAAGGTGAAGATGGTGTGTGTACTACATTGTTCATCACTAAAATCTTGGT
ACTATTTTGACTTGAAATTTTTCATATGGACTATAATAAAATAAAATTTAAAGTGAGCAA
AAACCTATGTATCAATTAGGCATTAGAAGAGAGGAGTGAGGAGTTACTATTTAATGGGTA
CATAGTTTCAGTTTGCAAGATGAAAAATGTTCTCTGGAGATGGATGGAGGTGATAGTAGC
ATGATGCCATTATACTTGATGCTACTGTACTGTGTTGTCAAAAATGATAAAAAAAATTTT
TTATAGTATTTAGTAGTAGCCATGTCAGTGTTGTAGGTAAGGCTGGAGGGGCCAGCATCA
TCTGCTGGCCAGATGCCTATCCACTATCCGGAGGCTGAGAATGTTTTATATTTTTAAAAA
TGGTTGACCCTTGAACAACGTGAAGTTGAACTGCATGGGTCAACTTATATATAATTTTTC
TTCAATCAGTACAGTACTGATTTTGTATTTTCTCTTATGATTTTCTTAGTGATCCTTTCT
GCTTCATTCTAAGAATACAATATATAATACAGTACATACAAGGTATGAAATATGTGTTTA
TCAACTATATATGTTTTCAGTAAGGCTTCCAGTCAACAGTAGGCTATTAGTGAAGTTTTT
GGAGAGTCAGAAGTTGTACATGGATTTTTGACTGTGCAGGGGGTGGGGTGGCATCCTGTA
ACCCCACTCATTGTTCAAGGGTCAACTGTAATTACATTTCAAGTGGTTATGTAAATACCT
ACATAATAGCTTTTGGGACCTGAAAGTCTAAAATATTTACTTTCTGGCCATTCTAAGAAA
AATTTGCTGGTTCCCCAGCTCTAAAGTAATTGTCAGTTCAGTGTATTAGCTCTGCCACTG
TCCAGCTCTATACCCCCACAAACAAGGTACTTTAGTATTCTGGGCCTCATCTTCCTATGA
TCAGAAGATTTGCCCTTTCTGGCAAGAGTTGTGTAAGGACCAAAAGATAGAAGGTAAAAC
TGAAACACATGTCTGGTGTTTGTTTTCCTTTATAGAGATTGACCATTGACCTTATTTGGT
TACTTTGTTCAAAGCAAGAATATTTGCTGTCAACTTCCTGTGCTTAGTTGGGCAGAAGTT
CTTTACAGAAAGTCTAAAGCCAAGGCCTTCAAACGTTTAATAGAATAAGTTAGAAAATGC
TGGAATTAATGGAAAGTTACAACTAAAACCTGGCTTGGTATGTGATAAGAGGCTACGCTT
AAATCAGGATTAGCTGTGCTTAGTAAATCAAGCACTGCCAATGTTTAGTGTCTGCTTGCT
GCAAATAACTGTTGTCCAACCTTCAAAGAAGTGACTTGTTTGAATTAAGTTGGTTTCATT
TTGGTCAGAAAGTAGAAAGCTTTCTAGGAGACAAATTGTTGTTAAGGGACACTTAAAATG
CCACTGGTGTCCCAAAAATCTGAGTCTTGCAATTCTGTTTCATTGTTACCCCTAGTGCAC
CTGCCCAAGGAGGCTTGTTATTTGATAGCTGAGAACTAATAGGAGTCTTTCAAAAAAGTG
GCTAAAGAGAAACCATGTTCTTAGGCACACTCAAAGCAAAGGGCCAAGTGTAAGGAACAG
TTTGCCGGTATTTCCAGACCAGTGTGCAGAGTTCAGAGCTCTGTAGATCCAGGGGAGTTC
ATCTGAAGTTGAATTTTGGTCCCAGGAAAACATCTGCAAATGTAGTGCGCTTCCAGGTAC
CTGCCCTCCATCATTTTTCTGCTAATAAACAGCAGTGAGGCCACCTTTCGTTTTTTGTTG
AGTCAGAATGGAGTACTGTATGTTTGTAACCTGCTTGAAAGAGCCCTCATTATACTCAGT
TTAGATCTAAAGCAGCATGTTGATGCTGTTGCAAGTAGTAGTTATTCTCCTGTACTTCAT
AGTTTGTTTTTTTCATCTTAGTAATTTGGTCTAATTATAATTCACCTTTAGTCCCTAGAA
CTTTTTGTTGATTTACTAAAGACATGAGAGGGAAGTCATTATTGGGCAGACTGTTTTAAC
TAAGGTTGAATTTTTCAACCTCATTGGATACAGTTGCAAAGTCAACTGCTATACTTGGTC
TAAATGTAGCAAGATGATATAGAGATGATATGGGCTTCAAGGAGAAATCTTCATTGAATT
TTTTTCTGATTCCTGCTTCCCACATATTTGATGATGTTTATAAGTGATGCCTGCAGTTTC
TGTTTCAGTCTGTTTGAGAGAGATAATTAGGGCACTTCATGGTGAAAACCTACGCAGGTC
AGCTATCAGACCTCTTCAGACCAGAGAGGCTCCTGGAGGGGGTGGCTTTTTAATCAGCTG
AAGCCATCTGGCAGGACAGGACATTCATTGCAGAAATGGTAGTCTGAAGTGTTCTAACTT
GGCAGTGTTACTGAATTTCACAGAGTTTCCTGGTTTGTAGCCAAAGGGCCTCTGGTAAGG
TAATCACTGGACCACAGCTCCATTCCAACTTTGCCTTCCTAACAAATATGTAACTTGGAA
TGACTATTCCATAGGTATAGACTCCCTGAGGTTTATGGTATCTACTCGTTTGTGAAACCA
TAAGAACATTGAGTTATTTCCTAAAAGCTTATTTGGGTACCCCTTAGTCCTCTTGGTAGA
CTCCGGGGATTTTCAGGTAACTGATTAAAACATTTTTGTTTTTACGTTTCAGGTGAAATA
TATATTGCTACTTGTTTGTCACATGAAAAACTTGTTCAAAGTTTAATCTTTCAATGTTTT
TCAGTGAGGATGATGAAGCTGTGTGCCTTGTTTCTCATTAGTTATACTAGATTGGCAGAT
GTGTCAGTGTAGGAATGGACAGGGAGGAGGGTGGGGACAGGTGGTCCTTTATCAGCACTT
AACACAAAAATTTGATTATAGCTATCTTATCACCACTACTTCTTGAGTCTTCAAAGTTAA
TAGAGGACCTGTCCAGAGTCCAAAGGTTAATATTGTTTCCAAAGAGGGTGTCACCTTGTT
TATATTATAGCCCTGAATCAATTTGCAGTGCCTATGAGGTCCTAAACAGTAGGACTGGCA
GGAAATTATTCATCTGTTTGGGACTTCAATAATAATATGCATAAGATCTTGTCTGAATTA
TTGTAGGAACAAGTGAGATGGAGAAAAATCAAGAAATTATTAATGCTTATGATCTTAGCT
ATAAATTATTAAATTAAAAGCGAAAAGATTGTGAATGAGAATACAATATATGTATTAAAC
AAGTGATTTAAGGGAATCTCTTGAACCTCTCTTGGTTTCTTGTATTATTTTTAGGACTTA
ATCTATTTGAGGTGGAATATTGATAAACATGAATTATGTCTTAATTTCATGATAATGTTA
CTTAATCCTTTGATGCTAGGACACTATGCAATACAAGGCTGTTTCTCCCCCTCCTACTCT
TTTCCAGGTGGTCTACGAGGGGTAGCACGAGGTGGGCTAGCAGGACTAACGCTTACCAGC
CTCTATGCACTATATAACAACTGGGAGCACATGAAAGGCTCCTTACTCCAACAGTCACTC
TGAAGATTTCGCCAACTTATGAGTGGAGGACACTTTAGTAGTCATCCAGATCAATTTATA
TGTCAGTCTGGAGTTGCTCTCTCTTCCTACAATTAGTTTGAAAAATCGGAGATTCCAGTT
TGCTGTGGTAAAGATCACGTGTGGTTGACCAGGACTGGCATCCTGCTAGCCAGAGTGGAA
GCCCAAACTCCTCTGGTGGCTGAGTAATGTGGTTCTTCCCTACCCCCTCTGAACTGAAAA
ACTACTTAGAGGATTCAGGTCATGATTGTTGTCTATACCGTATCCCCACATTTATTTAAT
GATCTGAAACTGTAATGTTGCCTTGTATTTCCAATAAAGGGTGAAAATAGAACCGAAGTG
TAAACACAGTGTTTCTATTTAAAAGCATTTTTCTGGATATAAAGTGAAAGTTATTCTTAG
CATTTTTGTCTGCCCCAACTGGCCAACTCATTTTCTTGGTTGTGTTGAAATAAAGGGTTA
CTTGACATCATTAACATCTAGGTTACAAATTTTCTTCAACAGAATTGACACTAAACCTCA
GGATACTTGATATAAACCATCATGCTAAATTCTCACTAACTCACCTCCCTATGGAGGATA
ATTACAGGATAGAAACAAGCTACAGGGTTTAAGGAAGCCTTGGGAAAGCTAAAGGTGAGG
GCAAGTTATTTGTTTTCTCACCTATGAAATGAAGTTAAATAAAACTGCACTGCAGGTCAC
ACATATACATAATACATACTAAAACAACTGGTGTTTATTATGAAGGGAAAGGGTAAAGTA
GGGCCTTCCTGCATGCACCCAGTAAGGACTCAGAGAGAGAGGAAAGCACTGAACCTTAGC
TGAAGGCCTCTAGTTTTTTTAAAAAGAGAGTTTAATATATTTCATAAAAATTAAAAGAGC
AGATCTGAAGTCTGCAGGAAAAGACTCAAAATGAAACTGGTAATATACCTAGCTTTTGCT
ATATTAAGATTCATAAGATACACTTGATATTTAAGTTAATATAAAAGTTCTTAGCTGTAC
TCCTACCCAAAGGTCACTGTGGTAGAACAGTCTGTGATAAGGCAGTTTTACAGATACACA
CAACTATGCCTGTTTGTGCTTTTAATGAAGGGAGGTACAAAATGCTTCAACACAAAAGAA
TGTTTTACATACTTATTAGCATGATGATGAATATAAAATTAGGAACACATCATTAAACTT
CAAAACTACAAAGTTTCCTGCAACATAAGATAATGGAAAAGGCTCCTTAAATTTTTACCT
GCCACCTTTATTATTAAAGTTCTAAGTGGTATTGGGGGAGGAGCGACGACCAAAAAATAG
GTTCTTTTCAGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 3390..3448, 19146..19239, 19576..19660, 23168..23226, 25013..25123, 34087..34534
1001..1106, 3390..3448, 19146..19239, 19576..19660, 23168..23226, 25013..25123, 34087..34199
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved