Canis_familiaris Locus TOMM20
snOPY snoRNA Orthological Gene Database
Canis_familiaris TOMM20
Canis_familiaris
TOMM20
4
SNORA14
1408..1542
17329
AAGGGTTCAAAAGGATCCCTCACGTTTATTACACAACCCTGTATATGCCTTCTCTTACC
CCTCTCTATTTTTGTAAGGATTTTATTAGTTTATGAGAGACGGGGTGGGGGTGCAGAGGG
AAAGAAGCAGGCTCCCCACTGGGCAGGGAACCCCGTGTGGGACTCGATCCCACAACCATG
GGATCACGATCTGAGCCACAGGCGGATGCTTAGCCCCTTAGCCACCCAGGTGCCCACCCC
TCTCAATTTACCGGTTTTCTATGCTTTCTGGTCAAGGTTTTGTCTTAAACAACCATGTTG
CCAGTGACTGTAAGACGACTCATGTTTTCAATTTTTTTCAATCTCCTTTCTCCGTTATTT
TTCCAGGAAGTGTCCAGCTTCATTTTCTTCCTCCCTTCCTGAGAGTATACTGCAATGTTC
TTTTGACACCGAATCACTAGATTATGTTGCTTGCTGCACAGCGGATGTGAGTGAACTTGA
AAAGCAAATTCTGTCCTAATCAAAAGAGCCACAGGTTGCCTCGTTTATAGAAGAGTAAGA
CGAAGCATCTGTCGTCAGCCCCTTCCACCTTTGTCTGAACAAGCACGCGTGTCAGCTGCA
GAGTCCTGAGTGCGTGCCGCGCAGCCACGCGCCACCTTGCTACGTCACTCTCAGCGGCTC
TAACAGCAGCGCGAGGCCACCAGCAAACCCCGACAGCGACGCACGCCCGGCCCGGAGGCG
CTGGGCGACCGCGCGTAGGCCCCCGCGCAGGCGCAGAGACGGCGCGGGCGCCGCGGCTCA
GGCACCGCCGCGGCTCAGGCACCACCGCGGCTCAGGCACCGCCGCGGCCTCGCGCAGGGC
CTCGCGCTGCTGGGCCCGGAAGTGCGTGCGCTCGGCCTTTCCGCGCCCTTCGCGGCGAGC
GTCAGGTCGTAGCGGCGTGGTCCGCGCCGAGGGGTCGCGCCAACTGCTGCTCCGCGGGCC
CCGCCGCCGCCGCGCTCGCCCTGCTCCTCGGTGGAGGGAAGATGGTGGGCCGGAACAGCG
CCATCGCCGCCGGTGTCTGCGGGGCTCTTTTCATCGGGTACTGCATCTACTTCGACCGTA
AGAGGCGGAGTGACCCCAACTTCAAGAACAGGCTTCGAGAACGTGAGTGGGTCCTCTGCC
CCGGGCCGCCGCCGCCGCCGCCCCTGGCCCCTGGCCCGCCCCCGGCGACCTGCACGGGTC
CCTCCATTTTGGACCGACGCTTTTTCCCATTTTGTGTTCCCCGACCGCTTGCCGTCGGAA
TGCACGGTCGATTGTGTCATTCGGGGGGGGGGGGGGGGGGATGGGGGGACTCTCTCCTTT
GAACCGCTCTATGTAACTCGAGAGTCGTGTGTTTTGTATTTTGCGAATCGGTGCCCGACA
CCGGATCCGTACATCAACGGTATCGTTGCCGCATTCTTAAACCCTCTTGGTAGCTTCCCT
AAAAAGGCTTCCAAGATATGAGTGAATGCTATAGAAATTGCAGGGGAGTCCAAAGGGCTG
CGCTTCCCATGTGGTTCAGTCTTATTTCATACCTGCGACATCTTTTAAGCGAGTTTTCAT
GAGGGAAATCGTGTCACCAAGACCTTCGTGGTCTTTACATTTCGAAGGCCTCCGTATTAG
CAACAGTGGAAGAGTAAATTTGTTGGATAAGAAATATTTTTATGACTTATCTAGGTTGCT
CAGTCAAAATAATCTCTAAAATTAAAATTGAGGGGCACCGGGGTGGGTCAGCGGGTTTAG
CATCCAGCTGTTGGTTCCAGCTCAGGTCATGGTCTCAGGGTCGTGAGTTCCCTCTCGAGC
GCGGAGTCTACCTCCCTGCCCTCCTTTGCCCCCTGCCCCTCCCCACACTTGTGTACTTTC
TCTAAAAGAAATGAATCTTAAAAATAAGATTGATACGTAAGGTATTAAAGCCCAGAAGGT
ATGAAGGTGTGATTATCCTCATTTAATTAAGCTCTAGTAAGATATTTCAAGTGTTCAGAA
GCCCCACGTGGCTAGTGACCTACCCTCTTGGGGGCATAAGATGATCTTAAATCATCTAGA
ACATGACATCTAATTCTAGCTGTCATATGTTTTGGGAGGGAAGGGATACAGAGAATTTAT
CTTATTTACAGTTAGATAGATTAATGGAAGGAAAGCCATTTTGGATTCAGACACTCATTT
TTCCAGGCTTGGGTTAGTCATAGATCAGCTGTGTAATTTTAAACTTGCTTAATCTTGATT
TTCTTTTTTTTTCTTTTTTTTTTTTTTTTATGATAGTCACAGACAGAGAGAGAGAGGCAG
AGACATAGGCAGAGGGAAAAGCAGGCTCCATGCACCGGGAGCCCGATGTGGGACTCGATC
CCGGGTCTCCAGGCTCGCGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAG
GGATCCCAATCTTGATTTTCATAGCTGGTAAAATCAGGTAATGTCCCCTGCCTCTGGTTG
TTTTTGTGAAGACGCTGTGTGAAGCACTCACCATCATTGCCGACAAGAGAAAGCCCTTCC
AGAAATGCTGGCTCTAAGCATAGCTAGAAATTTAGATCATTTTCGGGTAGTTTCAATATT
AGTTGGAGGGATGGTGGTGGTGGTTTGGCTACAGAGCTTAGTAAAGAATGGATTAAGCTT
TTCTTCCTCTGGAAACACTGTAATCTGGTCATTAGAAACCTTGAGAAAACTAATTTTTGG
TTGAGGAAACCGTAAGAGCTGTCATTTTAGACAAATTGGGAGATTATTTTCAAAGTCCCT
TTTCCATCATCTTCAGTCCATAATTTTTTTTTTTTTTTTCCTGGAGTTAGTGGCCTAATG
ATTTCAGTGGTCAGCCTTGAATGATGAGTAACCTTGGGCAAGCGACTAAAACTTTCATTT
CCCTCTTTTGTGAAATGTTCTAGTATGTAGGGACTTTAGTACGGTCCCTGGCATGTGGTA
ATAAATGGATGTGAAAGAATGTTTATAAATATAATTATTTGTTGATACTTTCTTTAGGAA
GTAAAATTTTTATTCAGAGTGATTCTGCAATCTGTAAGTTCATGTTTTATGTGTATGTTT
GAAAGTAGACAAGATCTGTTTTAACTTGTTAGGTTTATATAGTAGCACTTGGGATTAATT
TCTAGGTAATAACTGAGTCAAGGCTTGATTTTACTCATTGAATGTGTAATTCCATGGTTT
TTCAGTCTATTAGTATTCTTCCCTTATTACAGGGATAGTATAATATACTGATAAAATAAC
AAGTAAATTGTTTTATGAAACTAAAGCTAGAAATTTAATCTTATGCTAGAAATTAAAGCA
ACTAATCAGTCTTAAATTTGGTATTGGTATCAGTCAGACATTCAAACACAATCACTCTCC
ACTGAATTAAAAAAAAATTTATAAGATTGATAGTAATGGAAACTAAGTTTCTCTCTAGTG
GGTTTCATTATTATTTTTGTCATTTTCCAGAAATCTGGCTTAGCAAATTCTGTTTATTCC
ACTAACTTGCCATGTTCATTTCCTTTTCTTTTTATGGGAATGTGTTCACTTCTGTTAGAA
GGGATAGAAGGAGGGACCCCTGGGTGGCTCAGTGGTTTAGCATCTGCCTTCAGCCCAGGG
TGTGATCCTGGAGTCCTGGGTTCGTGTCCTGCATTGGGCTCTCTGCATGGAGCCTGCTTC
TCCCTCTGCCTGTGTCTCTGCCCCCTCCCCTTCTCTCTGTCTCTCTCATGAGTAAATAAG
TAAAATCTTAAAAAAAAAAAAAAAAAAAGAAAAGAAGAAGAAGAAGAAGGGATAGAAGGT
AGTGGAAGGGTAATAAAGTATCTCCCAAACTGAGAAGATACTTTGTGGCTGAAAAATGAA
GCTGATGACTCCATACACTTTACAGGTTTTTGCAGCTTATTTTGCAAGGGGAGGGGTGGG
CAGATGACAATCCGGCTGCACAGTTGCTCTCCACAAAGTCCAGACCTAAGTCCACAGATT
TTATAGAGTGAGGGCATTAACAGAAATGGCATTGTTGCAAGATTAAAAGGTTCGCCCACA
CCTCAGAGGATTTGCATGCACCCAAATGACAGCTAACCTTTCATTAGATATTGTGGCACT
GCCTGTGTCAGGAAGAAGAAATGCTGTGTTCTCTCTCACAGATTCATGGAAGGCCAAAGA
AAGACTGCCCCATTGTGGCCTTGGGCCTTTCTAGGGTATGTACATGAAACTCCAAGGGAC
CAGGAACACAAAGTCTCCAGAGAGGTCAGCCAGTGCACATGTGAACAAGATGGAAGGCCA
AAGATGGAGTCGTATTGTCGGTCAGCATTGTTACAGCTTTCCTCTAGCATATGGAGGCGA
TACAGAATAATGTTTGAGGACACGTGTTCTGAAGTTCATCTGCTTGGCTTTGAATTGTCC
CTCTCCCTGCTTAATAGTTACGACCTTGGTAAACGTTCTCATCTGTAAAATGGAGCTCAT
AGTAGTACTTGTTTGAGTGTTACTGTGAGGATCAAGCAAGCAAATTAATAGCCTTTATAA
TAGTGTCTGGCACGTGGCATCTAAAACTTGCTGAGTACTTACCCTCAACTTCTCATTGTT
CCTTTGCCTTCAGGTCTGCTGCTTCTGTGTAGCAGTAGTGATATTTAGTAATTAATATAG
TATAGTAGCATTATTCTGTGCCTAAGGATACCCTTAAGCAAATTGAAGATAGAATATTAT
GTGTTCTGTGTCCCCACAGTTAGTTGCCTGAAGATGAACACCCATGAAAGGTAGTTTGTT
AGAAAAATAGGCAGTCTTCAAAATTACATATAAGATCAGCCTATTTAATGTATATTTCTT
TGTTGAAGCAGCTAGAATTTAATCCTTAGAGTGGTAGCACTTTAGAAGTTTTCGGGGTTC
GAGTTGGCAAGAGGTACTGGTGTGGTTAAACCCAGTTTGTAAGGGTAGAAGAGAAAAGTT
TCCTGGACCACAATAAATTAACTCCTCTCCCTGCAGTTAGGTGGACAGGTCACTGTCTCT
TTAGTCATATATTGAGACTTGGATTTGTAGAATACATTAAGGTTTTCAGTGGACATTTGC
TTGTTTTCTTTTTTTTTTTTTTTTAAGATTTTTTTATTTACTCATGAGAGACACAGAGAA
AGAGGCAGAGAAGCAGGCTCCGTGCAGGGAGCCCGACGTGGGACTCGATCCTGGGTCTCC
AGGATCATGCCCCGGGCCGAAGGTGGCACTAAACCACTGAGCTACCAGGGCTGCCCTTGT
TTTCTGAAGCTTTTGTTCCTCACAGTAAAGTTAAACATGCCTTATCTTTAGAGAGTTTAA
GAGATTTGCTAAAGTCGCTGAGGTAATAAGTATTAGAGCCTTAACCTTTCTTAGCTATGC
CACAATCTCCACATCACTGTGACTAGGGAAACTTACTGTAGGTATTTAGCATAGCACAAC
TTCAGCTGAGTTGCTGGTAGTGAACTATCTCAATACCAGATGCTTACTTGAGACCATTAT
CGACTCCTCATATGGCACATTGTAAACTAGACCATATTAAAAAATACATGGTTGAACTAA
TTTCATTTTCACAACAACTCTGAAGCATGTACCATTCTCGGGCCAGTTTTACATATGAGG
AAAGTGAGGGACAAGTTACCGTAACTTGCCCAGGGTCTCACTGACACTAAGAGCTGGGAT
ATAAACGATGTTCCTGCTTCCCCTGTGCTAACACCCTTTCACATGGAGCATATCATTAGA
TAGCAATTTTTTTTTCTTTGAAAAAAATTTTTAAGATTTTATTTTTTTAAGATTTATTTA
TTGAGAGAGAGGGGGGAAGGCAGAGGCACAGGCAGAGGGAGAAGCAGGCTCCATGCAGGG
AGCCCGACTTGGGACTTGATCCCAGGTCTCCAGGATCACACCCTGGCTGAAGGTGGCACT
AAACTGCTGAGCCACCCGGGCTGCCCCCTTTGAAAACATTTTTAAAAGATTTTGAGAGCA
CGCGTGAATGCAAGTGGGGGCTTGGAGCAGAGGTGAACTAAGAGGGACAGTTGTATTGTC
CTGAGTGCATAGCCTGACTTGGGCCATCCCACAATCCTGAGATCATAACCTGAGCCAGAA
ACCCAGAGTCAGACGCTTAACTGAGGCCAACCGGGGGTCCCATTAAATAGCAACTTAAGA
TACTGTTAGGGTCTTTTACTGATTTGGCTTAAGGGTTTTAAAATTTTTTAATGTCACTCA
CTTTGGAGATACGTAGTTTTTTTCCAAATCAAAAGACCAAAAATTGAGCAAGAGTGTAGG
CAGAAGTTTTTTCTTTTCGTCAGCCAGCAGGAGTCAAGAATCTTGCAGTGCATTTCTGAA
CACTGTCCTCCTACCTTCTCATTACCTGGTTTAGGAATGTCAGATAGCTTTCAACATTCA
GGAAAGATTGAATCTGTTATATTTCAGTAATAAAAGTTTCTCACGGCAATGGCTTCTTTG
CTTGTGTTTTACGTTTCCCTGTGGAGCGGGGCTTGCTCTGCTTGTGGCAGTTAATCAGCT
GTTGGAATCGTCTCCATCTTGAAAATTGCTGATCTTGGTGCCCCAAAGGGAAGGTAAAAG
CTCTTGCCCAGAAATGTCATATTGTCCATGCACAGCTCATTGATCAGAACCCTGACCCTG
AGAATTCAGGAGACTAAGGAAGTAAGAGAGCCCTACTCAGCATTGTTTTGCAAATAGAAT
GAATAACTGCCACCGTTTGATTTCTTTTAATTCCCATTTTAATAATGGTAAAATGAAAAT
ACTCCATTTCTTGCAGGAAGAAAGAAGCAGAAGCTTGCTAAGGAGAGAGCTGGACTTTGC
AAGGTAATCTGTTTTTTTTTTTCTTATATTATATATTTTATAGAAAGAATAATTTTACAA
ATTACATCAAAGGTATTTCGACAAAGCTAATTGATACCAGACACTGATTTTTCTATTTTA
AGGTATAATTTGTTGTTTTTCGGAATAGTTAACTCAGTTCAACTGCAGATTGTTTGGTCT
ATCATTATTTCCCCCTTGTTGGCCCAAACAGCAAGACAACTTACTTACTACATGAGTGTT
ACTTTAGGGGAAATAAGATGATAGTCTCTAGAAGACAGTTCAAACTTTCTCACTCAGCTG
CTTCAAAGTAATACAGTAAACATTTATTAATTTAATTTTCCTGGCAGCCCTGGTGGCTCA
GCGGTTTAGTGCCGCCTTCAGCCCAGGGTGTGATCCTGGAGGCCTGGGATCGAGTCCCAC
GTTGGGCAGAGAGCATGGAGCCTGCTTTTCCCTCTGCCTGTGTCTCTGCCTCTATGTCTC
TCTCTCTCTCATGAATAAATAAAATCTTTAAAAAAATAATAATAATGATTTAATTTTCCT
CCCTTCAGCTTCCTTTAAAAGAACCACATACTATTTGCTTCAAAAGTTACACCAGATTAT
TCATACTACTGATCCAGAATCCTAACACATGGCAAATTTAACCTTGATGTAATATGTACA
TGCAGATAAAAATCCTTTTGGGGGGATGCCTGGGTGGCTCAGCAGTTGGGTGTCTGCCTT
TGGCTCAGGGTGTGATCCCACGGTCCCGAGATCGAGCCCCATATTGGGCTCCCTGCATGG
AGCCCACTTCTCCCTCTGCTTGTGTCTCATGAATAAATAAAAATCTTTTAAAAATCTTTT
TTTTTCTTTTCATAGATCCTGTGTTCATAATTATTTTTTTTAAAGATTTTATTTATTTAT
TTATTTATTCATGAGATACGGAGAGAGAGAGGCAGAGACACAGGCAGAAGGAGAAGCAGG
CTCCATGCAGGGAGCCTGACGTGGGACTCGATCCCAGGTCTCCAGGATCACACCCTGGGC
TGCAGGCGGCGCTAAACCGCTGCGCCACCCGGGCTGCCCCATAATTATTTTTAATGACTA
CATAGGTTTCTCTGCTTGATTAAAAAAATGTTTTTCTTTTTCATTGAAATCCGTTCCATT
GTTGGATTCCCAGGACTTGGACTACAGGATCAGTGATGATTCTTTTTAAAGAAAGTTGAG
GCTAAGAAAAATTAAATCAGAAAATGTTATATTTTATTATTTTGAAATAAGAAATCAACA
CAGCTAAGTAACTGGACACGATAATAGTGAAGTGAAACTGAGAAGCAACCACTTTGTCCC
ATTATGTCCAACTACCTTTCTGAACTATGTAGTATGTTCTTAATGTTTCATTAGCCTTTT
CTTTCTAAGGACAACCTAAGGTAGATAAAGACATATACATCAGTATGTATTTTTAGATAC
AGGCATAATCAAAACCTAGGCTGAGATAGTTGATAAAAGATGCCTCTACTTTGAGAAATT
TAAGTTTTTCATCTGTATTGGTATAATATTAGTCAGAAACCAAAAACTTCCACTAATAGA
AGTCTAGGTTTTTTAAATAAAATAGGACTTTTTAATAAGTAGGTTTATGTTTTTTTAATG
ATAAGTCATAAAGCTGATTACCATAGCTGGTAATATGTAACAAACTACAAAACAGGGACA
CAGGAATGGGAACTTATTTACATAAAGCTGCTTTGTAGTAGCTGCTTTTTGTAGCAGTTT
GTAATAGCAAAGAAATGAGAATTAGCTCAAATGTGCAACAACTACATCATGATTAAGCAA
TCCTATATTCCTTCAATGGAATATTCTATTACCATTTAAAATAATCCTGTAGATACATGT
AAAATCTATTCAGAATAATGCTGGAGGGCAGCCCCAGTGGCTCAGCGGTTTAGCGCTGCC
TTCAGCCCAGGGCATGATACTGGAGACCCAGGATGGAGTCCCATGTCAGGCTCCCTGCAT
GGAGCCTGCTTCTCCCTTTGCCTGTGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTCTCTC
TCTGTCTCATGAATGAATAAATAAAATCTTTAAAAAATAAATAAATAAAAATAATGTTGG
ATCAGAAAAACAGTTGACTCTAGTTATATAAAAATCTGTAATAACAACAATCACATTAAT
GTAAGTATGCATATTTTACGATAGAGATCGTTGTACTCCATTTTTTACTTTAGGTTTGAT
GCACAGCTTTCTGAGAACTGTTCTAGTATCAGTTTGATCATTAAGTATTTTTTTCTTGTA
TTCATTTAAATGTAGATTATAAATTAATGCTTGTAAGTATTAAAGAGTAAATTTCTTTTT
ATCGTTTTTTATGAGTTACTCAGTTTTTGTTGTTTTGTTTTTAGTGTCATGATTTTCTGT
GTATTGATTATATCCCCAGCATGATTTTGATATTATTTATTATTCTATTTCCAAACAGTT
ACCTGACCTTAAAGATGCTGAAGCGGTTCAGAAATTCTTCCTTGAAGAAATACAGCTTGG
TGAAGAGTTGTTAGCCCAAGGTAATATTCATTAAAAGACTAAGAAATTAGAATTTTTCAC
ACTAATATAAATTTATAGTGATAATGGGATTTTTTTTGTGTGTGTGTGCGTGTAGTGGAG
CTTTTATTTTTATTTCTTAAATATTTTATTTATTTATTCATGAGAGAGAGAGAGAAAGGC
AGAGGGAGAAGCAGGCTCCCTGTAGGGAGCCCGCTATGGGACTCGATCCCTGGACCCGGG
GTCATGCCCTGAGCCAAAGGCAGACGCTCAACTGCTGAGCCACCCAAGTGTCCCATGTAG
CAGCTTTTAAAAAAGGTTTTCTAAGTATTTCAAGACAAGTCATTTAGTAATGGGAGGATT
ATTTTATTTAAGGCTGGTTCTAGGGGTTCCTGGGTGGCTCTACCAGTTAAGTGCCTCACT
CTTGATTTCAGCTCAGGTCGTGATCTTGGGATTCTGAGATTGAGCCCCATGTGGTCTCTG
CTTGGGATTCTCCCTGTCCCCTGCCCTGGCTCATGCGGTCTCCCACGCTTGCGTGCTGTC
TCTCTCTCATTCTCTCACTCTCTAAAACTAAAAAGACTGGCTCTAGAAAAATACTTCTCA
TGGATCATCATTGTCCATAATGTTTTGAGTGAGTTTGAAGTTTATTTGCTATATGATACA
GATACTATGAGTAATCTTTACAAATGAGGGTTGTGTTTTTTTTTTTTTTTAAGCAGTTCA
GAGAATATAGTCGTAATATGTAAATAGTAACTGAATATGCTTCCTCAACTTCTTCATGTA
ATCTTCAGGTCTTTTCCAATATTTATTTATTGGAAAGAGTGGCTAATGTAAATCCCAGAG
AAGGTTAATTTACCTGTCAGAGCCATACAGTGAGTTTATGGTGCTTGATTTCAGTCAGTG
ATACGAATCTGATCTAGAGTTTAAGCTTTTGTGCTTTATGTATTCAATTAAGGACTAAGG
ATTATTTCTTTAAAACATTACTATTACGAAGTTAAAATGATCAAACAGGCCAATTGGAGA
ACTAGAATCGGTAGAGTCTTAAATGTATTTGTAAATTTTTAGTGTCAAATTAGCTTTTAT
TTATTTATTTTTAAAAGATTTATTTATTGAGATAGACTTTCTGCCTGGGGATAGGGAGGA
GGGGCAGAGATAGAATCTTAAGCAGGCTCCATGCCCCAGTGCAGAGCTGTTTAGCTCCAT
TCTTTAAGGATTCTTTAAGATCATCACCTCAGCTGAAATCAAATCTGATGCTTAACCAAC
TGTGCTACCCAGGTGCCCTCAAATTAGCTTTTATTAGAAAAATAGCTTCGAAGTATTTGC
TATCGTTGATAAAAATGGTTTTTCTTATGCTCATTGCTGTATCATAGACTTAGTATCATG
AATGTCATTTGTGATTTTTTTGTTTTGTTTTTATGGAAAGAATTAAAGGTTTGAAGTGGT
GGTGACATGTTATTTTTTGTTTTGTCTCCTCCTTCCTAGTAATTTCTATGCGTTTTTTGT
TTTTTTCTTTAAGAAATAATTATCTTCATTTGGATGGCATAGTAGGCTGATAATATTTAC
AAATAAAAATGGAAATGTCTTACTAGAAAGTAATTTTGGCTTTTTTACCTCATTACAATA
AGAAAAACCTGAGATTTAATCATAGGGTAATAGTAAAGCACTTAAATCTTCATAGAGCTC
ATTTTATAGACTGTATTACTGTCCTTCTCAAACTGAAGCTAACAGCTTAAGTCAACAGAT
GGCCGCAATGCACAGTAACTCATGGTGGCTGGGAGGAAGGACAGGGAAGAGTTAACTCTT
TTTCCTAAGCTCATATTCTACACTTTAACTCCACACCATCCAGAGGGTTACTTAACTCTA
CCAAGTTGCCTTTCTTCTGGTGGAAACTACCAACCAAACCTAAGGTTGAAGAATCAGGTT
GGTTAGTATTAGGGGAGAAAGTCAACATCTAAGTAAACCATAAACCATGTAAAGGTGTAA
GTTATTTAGGCAGTGAACTTCATTGCTTGGCATGGCCTCCACCATCTAGGGTCTTCCATA
AGCATATTCTGTTAACTGAACCAGATCTCATCTCAGGATTGATGTGAATGGACTCAAGTC
TACAATGTAGAGAAGAAATTGTATTGAGTTGCTATGGTGGTTCATTGACTATTTCCAGTA
TATTTAGAAATAATAGGAGGTGTCTTGGGATTCTGTGTTTTACATATAACAATCCAGTAG
CTGCTCTGATTTCATTTAATAATCAGAATTAATATCCCCAGACAACAGTGTTGCAGTCCC
ATATATTGCCTATAAATTCATTGGCTTGAGAATTCAGTGGCATCTTAATTTCTAAGTCAG
TGGAGCCATTGTGTCCTCTCATGGAAGTCCAAGCCCATGCAAAAGACCTAATCCTTTTGT
ATTTTCCAATTTTAATAAAATCTTTTAATGCTTTGTAGAGTTTTGCTTTATTCAGTTTGA
ATATCTCAGTCTTTAGATTTTCCCAAGTGAATTTTTTTTTAAGATTTTTTATTTATTTAT
GAAAGACACAGAGGAGAGAGAGAGGCAGAGACACAGTCAGAGAGAGAAGCAGGCTCCATG
CAGGGAGTCTGATGGTGGGACTTGATCCCGGGACTCTGGGATCATGCCCTAGGCAAAGAC
AGACACTCAACCACTGAGCTACCCAGGCGTCCCAACAAGTGAAATGTTATAGCAAGGCAA
TTCTTCTTCTTCACATGCCATCCTCAGTTCCTTTATTAGGTCACATTCTTATTCAGGGTT
GGAAAACTGTGTTTACTGGTTTATTATAAAGGATATGACTCAGGAGCAGCCAGATAGAAG
AGATGCATACGATGAGGTGTGCGAGGATGGGTGGGCAGGACATGAGAATCTTCTACTGTC
TCTGGATGCACCACCCTCTTAATACCTTGATGTGCTCACCAATCCAGAAAATAATCTTTT
TTAAAAAAGTAATATGTCCATTGTAGGATAAGTTTTAAAAGTCCTATCACTCAGAGTTAA
CCTCTTTTTGCCACCAGCTTCTTGCCACTTCCATTAGTGTGACTGTTTTTCCTACTAGCG
TTACTTAAAAGTTTTTTTCTTTCTTGTATTTGCATGTAGTAACATTTAAAATAGTATAAG
GATTAGTCTAAAGTGAATTTGGGCCCCCTTTTCTCCTCAGTTCCCAATCTTTGGGTTCTT
CTCAGAAAAGTTGGGTTCTGGGGCAGCCCAGGTGGCTCAGCAGTTTAGTGCTGCCTTCAG
CCCAGGGTGTGATCCTGGAGACCCGGGATCTGGTCCCATATCAGGCTCCCTGCATGGAGC
CTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTGTGTCTCTCATGAATAAATAAA
TAAAATCTTTAAAAAAAAAAAAGAAGAAGAAGAAGGGTTCTGTAGTTAGCAATTTCTGTC
TAATACACTGTTTCAGAAATATTGTAAGTCTGTAAGTAGGAATATAATTGGACATTTTTA
CACTTTAATTTCTCCCCTTTTTAAATGTGTTTTGAAGATACTTTCAATACTTGTGATCTG
ATTTATTCTTAGTAATGGTTTAATAATATCCAGTTATATATACGTATTATAGATTACTTC
CAAGGTTTTACTTGTGTGATATTTTTGGTCAGTATCACTTAGAGATATAATGAAGGCTTT
AGAGTTGAATTTTTGACAAAGGCAAAGGCTTTCCAGGTCACATGTTATTTTTACATAAAT
CTTTCAGGCGAATATGAGAAGGGTGTAGACCATCTAACAAATGCAATTGCTGTGTGTGGA
CAGCCACAGCAGTTGCTGCAAGTGTTACAGCAAACTCTTCCACCACCAGTGTTCCAGATG
CTTCTGACCAAGCTTCCAACAATTAGTCAGGTAAGGATTTGAAATGTTAATAAAAGTGGG
TAGAATCTGAGAATTAAATATTTTAGGGACATTGATATTGAAAAATTAGTCTAGTGTACA
TTATGAAATTATGAAACTTATCTTGGAATCAAAGTAGAATTAGAGATAGCAGTGCTTGAA
ACTTTTCTTCCCCTAATAATATTGACGTGATTGGGCATAAGATCTAGTTGTTGTGCCCCT
ACGTATGGGTCAGGAAATAAGTCTCATAGTACTAAATCTCAGGCCTTCGTATTTCAAATT
AGTCCACTGTCAGCTACTGAACCTAGGTTTCTATCAACTTTTGGGAGCCCATGCGTTCAG
TTAAGTGGCCAGGCGCAGAGGGCAGAGGAGCCAAGATGGCCTACCCTGAGATTATATCCT
AAAGGATTGTGGATATCCTCTGACCTCACTTGTCTAAAGGCCCCAGTGCCTCTGCTTCTG
CCAAGGTGGACTTTGAGCTTGGAGCTATTTGATTACATCTGCGTAAGACTATATCTAACT
TAAGAATTGATTAAAATGCATTCTGTTCATTTTTTAAATCTTTTCCAGGGAACCAAAATG
AATCTATTTTTTGGAATAGTTTATTCGTGTATTAATTTCCATAGTTGGTGTGATTAAAAA
TTGGTTGATTGTTCAAACTGATGTATACTCAGCTATTTTGGAAAGGGACTATTTTCTTCT
GAAAATAAAGGCCCCAAAGATTTAAAGGAAAGAGTTGGAAAATCAAAGATTTGGTCTTAA
TCCTTTTTATTTGTACTAATGTGATTCCTAGTCTATCTAAATCAGATTTCTCAGTTTAAT
ATTATCTGCTCTTGCAAAGGCAGCATAGCATAGTGCTTTTGGAAGATGGATCTGAGAGTG
AGGTCTTTTGAAATATGGATGAGTTCAGGATGAAGCCTGAACTCCTCTTTATAAAAATGG
CCTCCTTTACTCCATTAACTCATGTTATCTGGAAATATTTTCAAATGCTAATTTTGGAAT
TACTGTATTCCTTCTTATATGATGACTGAGTATTTTCAGGGTAAAAAGGGAAATGTTGGG
AGCATAGAATGACAAGTTAAGCACTAATCAGTATTCTCAGTTTATATGAGAGTGAAAAGA
GATCTTAAATTCTTTTTGGTTTTAGTTACATAATTGATTAATATGTAAAAGAGTATAATG
TTAACCCTCCTTGGATTTTGAAATGGGACCGGCAGTAGTATGGTCATTATTTTCTTTGAT
AACAGTGTCTAACAGTGTTAAATGATGAAATCTTAGAGTGGGTAAACTTTAGCAAGGTTT
GATTCTTTGAATACAAAGGACATTTTTTTCCCTTAAAATTTTTTTTTGAAATTGACGTAT
TGTTGACACATAATATTACATTAGTTTCAGGTGTTGACAAGTCTGTACATTATGGTCTTA
CTAGGTGTGGCACAGACAGACATTATCTGCCTCACCATACAATGGTATTACATGATAGAG
TATATATTCCCTGTGCTGTACTTTTTATCCCTGTGATTTATTCCTTACATAACTGGAATA
AGTTATTCCTGGACCTCTCACTCCCCTTCACTTGTTTTGCCCATCCCCGTAACCCACTTA
CCTTGTGGCAACCACCAATTTGTATTTATGAATCTCTTTCTCCTTTTTTTCTTCATGGTT
TTTAGATGCCACATAAAAGTGAAATCAGATGGTGCTTATCTTTATCTTAAGGAAATAACA
CTTAGCACAATGTCCTCTGTGTCCATCCATGTTGCAGGTAGCAAGATCTCATTCTTTTTT
ACAGCTACATAATAGTTCGTTGTATATGTATACCACTTCTTTATCCATTTATCCATTGAT
GGACACATAGTGTTGCTTCCCTATCTTGGCTATTGTAAATAATGCTGCAATGATGTAGAG
GTGCATACATCTTTCCAAATTAGTATTTTCATTTTCTTTAGGTAAATAACCAGTTGTGGA
ATTACTGCACCATATGGTATTTCTATTTTTAATTTTTTGAGGAACCTTTATACTGTTTTC
CACCGTGGCTGTACCAGTTTACAGTCCAGGCAATGCATGAGTTCCTTTTTCTTCAGTCCT
TGTCAACACTTGTTATCTTTCTGGTTCTGGGCATTCTGAGAGGTGTGAAGTGATATCTCA
TTGTGGTTTTGATTTGCATTTCCCTGATGATTAATGGTGTTGAATATCTTTGCATATGTC
TGTTGGGGAAATGTGTATTCAGGTCTTCTGCCTGTTTTAAATTGAATTATTATGTTTTTT
CCTCCATGTTAGTTGTAGTTCTTTATATATTTTGGCTATTAACCCCTTATTAGATACATA
ATTTACAAATACCCTTCAGTAGGTTGCCTTTTCATTTTGTTGGTTTACTTTGCCATGTAA
AAGCTTTTTATTTTGTGTGGTCCCAGTGGTTTATTTTTGCTTTTGTTTTCTTTGCCTGAG
GGGACATACATAGAAAAAGGTTGTTAAGGCCTTTGTCCAAGAGATTATTGCCAGTGTTTT
CTTTTAGAAGTTTTATGGTGTCAGGTCTCACATTTAGATCTTTAATCCATTTTGAGTTTA
TTTTTGTGCATGCTGTAAGGAAGTGGTCCCATTTCATTCTTTTGCATGTAGCTGTATGGT
TTTCTCAACACCATTTATTGAAGACACTCTTTTCCTATTGGATATTCTTGTCTCTTACAA
AGGACTTTTAAAAATTAATTTTTGGAGGGGATGCCTGGGATGGTTCAGCAGTTGAGAATC
TGCCTTTAGCTGAGGGCATGATCCCGTGGTACGGTATTGGAGTCCCACATCGGGCTCCAT
GCGAGGGGCTTGTTTCTCTGTGTTTCTAATGAATAAATTTTAAAAAATGTTTTTTAAATA
AAATAAAAAATTTTTCTTTTCTCTTTCAGAGAATTGTAAGTGCTCAGAGCTTGGCTGAAG
ATGATGTGGAATGAGAAAATGTCAACATAATCTCAATTAAAAATATTTTTAAAATCTTAA
GTCAGAAGATGAGCAGCTCTGGGGGAGTAAGGGCAAATAGGCTTGTTATGGACTGTCCTA
TGCTGAAATCTACCAAAGTTAATTTTTACTTTGTGTAGATCCATTCATCTGTTTTATTTA
TTTTTCCCAGTGAAAAGTGTATTTTGATAGAAAGCGTTTTCATTTTATAAATACACTATG
AGTTACCAAAATATCATGGATTTATTTTATTCTTAAAACGTGCAATTAAAAAGTGTACAT
ATAACATCACTACTTATATTAAAAATACTCAGTGCTTAGTTTTGAAAGATAGGCAAAAAA
GTATAAGAGAAAGCTGAAGAATGCACGTTTTTTTAAGCTAATACACTTTGCTCTAATAAA
ACAATTGGATGGAAACTTCTTTTGTTTATCAAAACTGAGCATTAAAAATCTTGAGAGATT
ATTTCTTTCCATTTAATCTCTTAAATATGTGAGATTTGCTGCTGTGCTGTATTAATTCCT
CCCTCCCTGTGTATTTGTCTTGAAATGTTTTGTTTAAATTGGTGGGCTTAATGTGTTCTG
GATATTTATCTCTTTGTATTTAGATGTATGTAGTTGCAATTAGCACCGGGAATTAGATCT
ATGTACATCCTTAATCTAGCCATGTGAGCTTCACCAGTTACTGTCTGCCCTCTTTCCTCA
AACAGTAAGGGAATTTGTCTAATTCAGAGAAGTGTCCCTTTTAGCTTTTAATTCATTTGG
TTTTATTCAGCATCTTCAAATCCACCTTCTCCTGAGGTATATATTTGTTTGGACAACCAG
GCCTTGCATTATTTTTACTCTGAAGTTTGCATGCTTGCCTGACCTAGTATTTCTAAACCC
ACTTCCCCTTTTTAAAAAAGATCTAACTTATGTTGCTTTTCACTGAAATTATATGGTTCT
GTCGCTACTCTTGTAAATCTGAAACTTAACCTGTAGGGTAACTGGGATGCTAAGCTTGTA
AAATGTTCTCCTTTGCTTTTATCTTCAGTGTATCTCCTTAATCCTCTTTCAATCTGATTC
ATTTATCTTGTTATGATGAGAATAAGGTGTAACCTTGTGACTGAAGACTTGCAAAGAATG
GAGATGTTCTCAAAATAGTGACATGTCATCTGTAGTCACAGATTGCACATCAGGTCTGAG
AATAAAGATCTTGGTACTTACTGTCATCTGTTGAACTGAGTAACAATTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 6736..6782, 9238..9319, 13027..13169, 16049..16329
1001..1121, 6736..6782, 9238..9319, 13027..13169, 16049..16090
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved