Canis_familiaris Locus RPL13
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPL13
Canis_familiaris
RPL13
5
snoMBII-202
1626..1705
4180
CCTGTGTGTGTGAAAGCGGCAGACCAGAGAGGTTCACAGACAGGTACCACTTCCAAGTC
CAAGAGGGGCCTTCAGGCCCAGCCTGCACGTGCTGATGCTGTCCACAGAGGGGCTACCCT
GTCCTAGCTTCCTAACAGGCAGGCTCAGTGCGTCTGCCTGTGCAGACCGCTAGCCCCTTG
TATTACACGGTTCTGTGTCCCCAGCCAGACCCTAAAGTCCTCAGTGAATCTCAACCCGAT
TTTTCTAACATCCCAGGATGTCTCAAAAGAGCAGAAAACTCAGTCCGCAGCTATTCACTC
AAGGAAGCACACGGGCCTTCAAACTTCTCATCCTGGGTCACGACGGTCTTCCAACGTCGG
TTACATTGTATTAGCGAGAAGCCTCGTGTTTAGGGCGCCGGTGGGAAGGCGGCAGGGTTA
CTTGGGTGTAGACCTGCCCGCAGCAGAGAGGAGCACAGGGCCCAGGTCACAGAGGTCCAT
GTGGCTTCTCGGTACGTGTTAGGGCGCTCGTCTCCGCCCAGGTAGCAGGGCAGGGCTCCC
GACCCCGGGGGAAGGCACCCGACCTCGGGGAAGGCTCCCGACGCCTCCGCCCAGCGAAGG
CAGCTGCGCGGAGCTGCGCAAACACGCCCGTCAAGTCCTCACGCCCCGCGTACAGCTAAC
ACTCCGGAGGAGTCCACTCTGTGTGGACGCACGGGACGCGGAGGCGACGCCCTAGAGTTA
GGCGCACGTACCGAGTCCCGTGGCGTGCGGGAGCTAAAGCGCTGCTGCTCTCCTCCGGCC
CCGGCGTCCTGACTTAGGGCCACTGAGTCCTACAACAGCCCGCCGTCCGCCAGCAGGGCC
CGGCGACCAGAGCGCGGCTGCCGTAGAACGCCATATCTGCGCGGGGCCGCGGGGGTGGCT
GGGAGGGTGTGCGCGTCACTTCCGCGATCCCCGATTCTGATTGGCCAGAACGGTTGGCGC
TTTTGTGATTGGCCGGACCCAGTACCATCCCAGCATGCTTCGCGCCGCCAGTTCTTTTCC
GCTGGCCTGTCTCCCTAGGAGGAGGTGAGTGTGCTATCCCGCGGCCTCCGCTGCCATCCG
CTGCCATCGGTGTCGGGCTGCTCCAGGCCCGGCCGCAGAGGGGCTTCGGGCCCGCGCTGC
CGACAGGAGAGGGCCGTGGTCCGGGCTCTGGGGGCGAGCGGGCCGGCCGGAGCCCCGACC
CTGACTCGCTCCCCGCGCCCGCAGGCCCGTAGGTAGCCGCCATGGCGCCCAGCCGGAATG
GCATGATCCTCAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCCACGTGGTTCA
ACCAGCCGGCGCGGAAAATCCGCAGGTGAGCGGCCGTGCGGGGTGTGGGAGGGGCGCCCC
CTGACCCCGCACTCCGCACCCCTGACCCCCGCACCCCTGTCCCCGCGCAGACGCAAGGCC
CGCCAGGCCAAGGCCCGCCGCATCGCCCCGCGGCCTGCGTCAGGGCCCATCCGGCCGATC
GTCCGCTGCCCCACGGTGAGGTACCACACGAAGGTGCGGGCCGGCAGGGGCTTCAGCCTG
GAGGAGCTCCGGGTGAGTGCGGGGGCTCGGGGGCCTGTGGGGGGGGCCCGGGGGCCCGCG
GGCCAATGATGACAGTCTCCGGAATCGCTGTACTCACGTGATGAAAGTACACTCGAACCC
TTTTCCATCTGACGGCCAAGCGCGGCAGGGGCGGGCGGCTCGGGGCGGGGCGGGGCGGGG
TGGGGTGGGGGGGCTTCATGGGCCTCTCTATCGGTTAGGTGGCCGGCATTCACAAGAAGG
TGGCGCGGACCATTGGCATCTCGGTGGACCCGCGGCGGCGGAACAAGTCCACGGAGTCCC
TGCAGGCCAACGTGCAGCGGCTCAAGGAATACCGCTCCAAGCTCATCCTCTTCCCCAGGA
AGCCTTCAGCCCCCAAGAAGGGCGACAGCTCAGTGAGTGCCCCCAAACATCCAGAGGTCA
CAGGCAGGGCGGGAGGCGGAGAAAGACCCTGAGAATTCACTCCCTCAGTGTCTAGAGTGG
CAGGAAGTGCACTGCTGCTCCAGGAAACTCCTCTTTTGTGTCTTAACAGGAGCTATCATT
TCAGTTTAGTTAGAAGTTAAGCATTTGTTACCGAAAGCGTTTTCTAAAATGCTGTATATG
AAGTATGCATTCCTAGGGGAAGATTTCAGAGAGAGATAGATGGTTCGGAGCTAGGTCAGT
AGCCTGGGGGCCTGCCTGCACCTAGGGTTCACGTATGGGCGGCTGTGGCACAGGCCTGTG
CATCTGCTGTCAGCTGATGGAACAGGGCCCCAGCAGGAAGTGGGACTGGGGTCCTAGGTT
ACATGCTTGCAGCCCCAGGGCCTTTGAGCTGAACTCAGCCGACTCCCTTCCCCTTAACAA
ACAGGCTGAAGAACTCAAACTGGCAACACAGCTGACAGGACCAGTCATGCCCATACGGAA
TGTAAGTAGGGATCCACCATGAATGCTTGGGTTGGGGGGCTTGGTTGCAGGGTGGCAGCC
AGGCTGTGTGGAGATGTCTGGGTTTGTGGGAACCTTGCTGTAACTCTGGAGGGAGCATCT
TTCCTTCTTCATGGGCTCCTGGAGGGAGGGTCTTGCTTTTATCTCTGGGGACTTCATTGT
CTCATACACACTCCTGCTGCTATTCTGAAAGGCCAGGCCACGGGGCATTGTTTGGACGTG
TCCGGGGATCCAGCAATTGATTGGGCCCCTGAGGTTCCTGTGGCAAGGGAGGTGGGCTCC
CTCTGTCCAAGGTCTCTGTGGTGTGACCTGGTATCCAGCCTCCACTTTCTGCAAACACCT
GAGGTGGTTGTGGGGTTATGTCCTAGGGAGCCTCACTGTCATGTCTCCTTGGTGGATTCA
TAATGGTCTTGAAGCTGAGGGTGGGCATGTGTAGTCTTTACCTCCTCTTGTCAGAGGTTT
TGCTGACACAGTCATGGATCCTCCTGCAGACAAAGGTTTGACACACCCTGTGTTCCCCTC
CAGGTCTACAAGAAGGAGAAGGCCAGAGTCATCACAGAAGAGGAGAAGAACTTCAAGGCA
TTTGCCAGCCTCCGCATGGCCCGTGCCAATGCCCGGCTTTTTGGCATCAGGGCAAAAAGG
GCCAAGGAAGCTGCAGAACAGGATGTTGAAAAGAAAAAATAAAGTGCTATTGGCAACTCC
TGCTGCTTGCTGTCTCCATGTGATGGCGTTCTCCTCTGAGGGGACCTGAGACCTGGCAGG
GGTGATGGCACCTTTGCAGGGCAGCACAGTGACTGAATAACATCAGTACCTATCTCGTGC
AGGTGTTGCAAGGAGTCCTTGTTAACCAGAGTAGTTTCCAGTTACCTATCTCAGGACTTG
GGGCTACATCTTCCCAGACTGGTGTGCACGTCTGCTGTTCTGAATAGCAGTCCCTTCATC
CAGGTTTGCAAGGCATGCAGGCTGCCCCAAACCCATCCTCAAGCCACTGTGCCTGCGTGG
CGGCTAGGCAGAGCCAGGGTAGCTTCAGTGCCCATCCCAGGGGAAGGCTGGCACTGGAGC
AGGGCTTGAGCTGGATCCCTTGTGGCACATGGTGCCCAAGATCCTTTGAAACCAAAGCTG
GTTTCTCCACAAATGACACTAAGGTGGGAGCTCCCAGCAGGGCCTGCTGTGATGAGGAGT
TGGGAGGGTGTCTGGATGCTTCAGCTGTGCAAGTACAGGTCTTCACTGACCTGACCACTA
ATGAATGACGTGACTTTGTACCCAGCAGCCACATCACTGGTGTCCTGACCCAGGACCTGT
GCTGTCACTTGGGCTTGTTTGGAACCAAAGCCGGAGTAGGTTTTCATCTAATAGATGATT
TGAAAGGCTCTTCATTTCTTGTACATCCAAAGCGAACAGTTGAGCTGCTTACTTCCACGC
TCTTGTGTGAGGGTCAGCAGAGGTGGAGATTTGAGTTGAGGAGCCTAAGCTCTGTCCCTG
ACAGTCCTGTGCAGAGGGAATGAACTGGTGCTGCATCTGGATGGCTAGTGGTGGCCATCC
TGCCTGGTTTGTGTTGAGAAACCTGGTGAGCTCGACTAAGCTGGACATGGGCTGGGAAGC
CCACACCTCTGGGGCAGTGGCCCCTGTGCTCCAGCCTTGGAGTGAAGGGAAGAAACACGG
GGGGCCCTTAGATGTTGCTTCACCTTCGCTGTACGTCTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 1224..1344, 1430..1571, 1778..1951, 2404..2460, 3003..3180
1241..1344, 1430..1571, 1778..1951, 2404..2460, 3003..3158
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved