Canis_familiaris Locus poly:SNORD49
snOPY snoRNA Orthological Gene Database
Canis_familiaris poly:SNORD49
Canis_familiaris
poly:SNORD49
5
SNORD49, SNORD65
1001..1071, 1867..1940
2940
gtctgccccgtcaaatgggcaggaagttcccgtgagcctttgctagtgttaccctccct
tccgcgcggaatgggacgttccgactccttaaaggccgggaacgcggctcaagcgacctt
tccgttattgtgatgatggaggtgggtggtttctgtaggtgagcgtggtatttggcggca
aaggtggaggagcctagaggcgtcctaattcttgggaggaaattttcggggggcggagag
cggctcgttaaggggcgtcgccgagctcccgggctgctgcggcggcggcggtgtatgggg
ggagagttgcgcagggccgccgggggccgaggcccaaagcccgcgcgcgtgtttgtccgg
cagcgccgccgccgtgtgaggagcccgaggttcccgaaggccggccccccgctccccgga
cccggcgtggggagtgcgccgaccccggaggcgtgggtaagtgcgagtcgggctgcacgc
gggggccgcggctgatactgggaacacgaggagggctggcccgactgtcctgatgatact
gggcttgggaatagccgtcagaagcggtgactgatgagttttatgcctctgaagcctcct
cggtctagatgaacgtgtccctgcagaacctgcccttaacgcgtgtcgccggccatgttc
caggcagccgacggcctgcagcgccttcaagcggggagcggcatcccaccctgaggtagg
acccggtggcagggttttgtttttttcgtcctttcagcttcaatgcactggatttggcgc
cttgggcagtaaattgtgcgcgctaccccccacccccatcgcaaggaatctcaaggagaa
ctttgcaggtggctgctcctaacccccgaactatttcagctgcagttgtatctcgaaata
aactgggttaagatgattctcgtttaaaaccaccactttgggcttaattgcagggactat
ccaggtttctggagcagtcctggggagtgggaggtgttgactgctctgatgaaatcactt
ataggaagtgccgtcagaagcgataactgacgataacctttcctggctgactgcagtcga
caagtcctccccggctgcgggtactctggaataggagggtttgaacagtgaccctttcgc
cccctctattcgcccagattgcagatgcgtgtgcggttgccagtgtgatcaggtcaccag
cagtggagtgttggagtgatgagcgctgatctgtctccaggtaaacctcggtctgtggga
cagattgcatagctgtcagatggcgtgaagttcgggtagggtcagatacacttttatgtg
gtgaaccctgatagcttgtatctgtgtcgcccttcttgatggtaccctaatactgattga
tgattatggttcacggtgactggagcagagtgcagagggaacccagcaattctttttacc
tctctgctctataatttggagcaaactgcctaacagccgagtcttcctcatccatgaaga
tcatcgctttagatttgtgatgttgaaaatgatgggacaaaatgaggttgcaacactcag
agaagccagttaggacttgggggcttagatgacttttcagtgcccctgttggattgaact
ggaatttgtagttgaggctatcgtgatcaaaacggtcctattctgcctttgccatctgct
acctcttaggggtgccttcattcattcctccaggttttgtgtgttgaggttctcaagaat
ggtggtcagcagtggagttttaaagctgcagcccaagaagaggtaagcttccatctggac
aaggaccctctccccatgatagaacaaaaataggtggctggttttaattctcagaaaaaa
ggatatcaaatgatgagatcacccaaaatagctggaattaccggcagattgtatagtggt
gaatgtaatggttttctgaagataaccttgttaatgctgtgaataactattggttggagt
agaaaatgaagttgatacttagtttcttttgcaggctatgttcctagagcatgctcagcc
ttgctgcagcaggggaagaacttcaaaggttcaaggaccagtggtcacccatcagtttgg
actgaaaacccagcttcaacagtttgtggaaacactgcttaccttgtgctgggattcata
gaggccattttcttatcaacggcagagccaacaaatgtgtttggcaacatttttttagga
taggcaatgttggttgtcattaaattgagttttctagtaatgtattacaaatattgtagc
cttcttatctcccttgtgcaaacagcttttgtgtttacttgtaagaatttgttctgttgg
gtaaggttctctttaagctggaaacttactactgagactaatatttccatgtaatcacca
taagccaatactgcaataaagaatggtctttagtactggttgttaaaaacgtgtatttaa
agaaaaaaaattttggttactgctgtcagatgagcagtccaggtgttattagcacttgtc
aacttctccatggtcagtcagttttccccttttacaactttagacttgagggtaaaagtt
ccaaagcatttaaggcatccgcacctttgattccagtctgcctctgggccgtgtcctttt
gtgcatagcctacctcctgaagctctatgcggtttggccaaacacttgtgcagtggcagg
caaggtcgcatagtctggctctttacctcagcccctgtcctgttggccttcctgagttgc
gatcttgcctatacctgtcctgatcctagaggccctttaggccatgttgccagctttgcc
tgagtggctaccaccctttgggaactcgtttttccccatctcctagctcttgctaggagg
cacgaagtccaccaagagtcctaagtttgacctattcttgggttttaggagccttccaga
g
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved