Canis_familiaris Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Canis_familiaris EIF4A1
Canis_familiaris
EIF4A1
5
SNORA48, SNORA67
1622..1742, 5160..5300
7200
gcgccaggcgggggtcgcgacccggcgcgggggacgacggcggcggcggcggcggccgg
cgggtccggacgcctctttggcgagggagggctcgcgcgcgctcggggttctgggggatt
ctgacgggaccactcgccggagcggggggcgcccgggtcctctgagccgggcgctcggtc
gcgcggagagccgggtcggggcgggagaagccggccgttcagtgtgctggttttcttgac
ggccaggaccgagcctgaccccgaggagcggccgcgtgaggcaccgggagcccacccggc
gccgggcgggcgggtccattttgccgcacaagccgggcaattggcaaactgcggatgggc
aggtccactttccttcaggggtgagcggcctgaggtatgggagggcgacgccatttcgcg
acggggcgggcgggctgtggattgttccgtggcggggggagacgccgccgggtggtcgag
ggagcgagcacatggcggcctgaggggctcccctcccccagcccccttcgctgctgagtg
ttgtgcaatctcccccttctctagctctgctggggctcattgtgcgcgaggccgccaccg
cccgcggcctcccacatccgggcaccgcaagggggggagacgggctggaggggtggggga
gggcgcgggcggagtgacgtggggggaaggggatgtcctcccctcgcagccgggaggcaa
ggggcgggacttccggcgcgccggggccgcggggggaggcgcacgcgctccggccggccc
gggacacgtgggcgggggcgcggaccccctcagggtcccggggggcgcggcggcgttccc
tgtggcctgcgggggccggggcccgagtcggtggaggaggaagggctgtgtcctcgggga
gtggaggctgatggcacgggcgggaccgcttgctggggagagcccggccgcgcggatttc
taactcgtctcagttggtgtgcatctgctttccaccaacaGATCCAGAGACAATGGCCCC
GATGGGATGGAGCCCGAAGGCGTCATCGAGgtgagccgggagctttgagccattgttccc
cctctctggaaaagacggtctgtagcagcctcccctgacctcgggaggggtggttcctgt
cccctaacaggaacctgttcctgtttcctctccccaattctcattccttttcgatgattg
gtataaagtatctacgtcctgggttgtacgaaccaggttgccggaggagtctggtctcct
ctcctgccctgtttagcctctggtttcacaagtggactggccctcactgattgcccaggc
cgggtagaaccagctggcttccccagagggaggagaggtgcagggatctgcagctctggg
gctggtaccaaggtgccctctgttctgcgagaacacagacccccgtttgactactgtgat
ttttctctgtcctacagAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACC
TCTCCGAGTCCCTTCTCCGTGGCATCTATGCTTATGGTTTCGAGAAGCCTTCTGCCATCC
AGCAGCGAGCCATTCTTCCTTGTATCAAGGgtaagcctcctgtcccaggacaggttctgg
gctgtccctaaactgggtacagtggtatctggttggtgcctgtctcctatcagtcgggga
ccgagcaactccttgtttatccaggcttggcttttggtctgtgttcatgccctggccaca
tgcatggctggtttgatttctgctggtacctgtttctgagctttgtgcagtactgaatga
gttaatgttctgtgtgggcactctgttgtcatggggtaaagtctgtggagcacgtcatgc
ttggcacatggctccattggcttcttgtgggtaaagtaaagccttgaacatctcatgact
ctgaaatgtatgtattctcatgtcttgtttttctcgatctatttagGTTATGATGTGATC
GCTCAAGCCCAATCTGGGACTGGGAAAACAGCCACTTTTGCCATATCGATTCTGCAACAA
ATTGAATTGGATCTAAAGGCTACACAGGCCTTGGTCCTGGCACCCACTAGGGAGTTGGCT
CAGCAGgtgagtatgtaggcttttttgttcctcccctgaaggactgctttagaaatgtgg
tcattaaaaaaagcatagatgtgtgttcctcaggaccactatctatttaagaactgaatg
gttgggggggtggggactgtgtaaagaaataagttgaggacttccggatgtttgagagct
tgttaggattaattacgaggtctttcctacccaaacacaataagcattattttctccacc
catttcctgagtcaaatgaaaaggttgcaaggtggagcctggctggctgggcaagtttgg
tggctgttttatgaacaaaccccctggcaatgggcaaagagacaccttggtggtggtggt
gctcttatatcagccaggggcaaagcagacgggcagtcctgtgttcatcctagcttgatg
cctggattggtggccagagctgtttcatgcctagggcacataaaattttaatgagacctt
tcttgggtcttggtggagaaagggtcagaaatgctagtctcataagtaggatattagttt
tatggtgannnnnnnnnncgagctgtttctgcctagggcacataaaattttattttattt
tattttttttttttttttaaatttttatttatttatgatagtcacagagagagagagaga
gagagagagagaggcagagacacaggcagagggagaagcaggctccatgcaccgggagcc
cgatgtgggactcgatcccgggtctccaggatcgtgccctgggccaaatgcaggcgccaa
accgctgcgccacccagggatcccgggcacataaaattttaatgagacctttcttgggtc
ttggtggagaaagggtcagaaatgctagtctcataagtaggatattagttttatggtgag
tttaggatgattctatgcttatcggtgaattgaggtaaggtactgtaagtgaagagttct
ggaagaattcagtagggccttaatgtatgtgcagaacatgctcttttaaaaaaagcgaac
ggggatccctgggtggcgcagcggtttggcgcctgcctttggcccagggcgcgatcctgg
agacccgggatcgaatcccacatcggactcccggtgcatggagcctgcttctcgctctgc
ttctctctctctctctctctctctgtgactatcatgaataaataaataaaaaaaaaaagt
cttaaaaaaataaaaaataaaaaaaaataaaaaaagcgaacgtgtcacctagcacaggtt
ctgtggcaggagttcagtaggacatgggtagatggccttccattcataaaactagttgga
gtgagatcaaatcaatgggtcgtcatggcttttagaaagggctgttagtgtgaatccttg
tattcttaggagccagaccaagctcaaatcctgagcctgccacttactggcagtgtgatc
ttaagtgaagtatctgcctgtttcttgtctgaaaagtgagtttaatggtgcacgtctgag
ttggagagaacactagaagcattttatttatttatttacttacttattttttattttact
agaagcatcttaaacgggacctgccttgatcatagctcataattgggtacattttttttt
ttctgagtccagATACAGAAGGTAGTCATGGCATTAGGAGATTACATGGGTGCTTCCTGC
CATGCCTGCATTGGGGGGACCAATGTACGTGCTGAGGTGCAGAAGCTTCAGATGGAGGCT
CCTCATATCATCGTGGGCACCCCGGGTCGTGTGTTTGACATGCTGAACCGGAGATACCTA
Tgtgagtctggctgtcctctttaaccctcccactcgtgccttccccccccccccttcgca
gtgtcctcctctgacgggctagcatgcacctgggaaagagttgctctgtgatgagcccat
gcgtgtcatctgagcctggcttccccgtcctcagccccggggagtgttctacttccctgg
cctgtcagctggcctcgtgtgggagtcttggcaaaggatcagccttcgtatcctgagagc
agatctcttgttccttagtgttctcgatcaggaacttgaagtttggtttcctggttccct
cactactgtccattggggttttctcctcttgtagCTCCCAAATATATCAAGATGTTTGTA
CTGGACGAAGCTGATGAGATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTC
CAAAAGCTCAACAGCAACACCCAGgtgagaaaggggttcacagactctagtgggcggtca
aggtttcctttgtaggtggctgtgtggtgggggtcacagcagcagcacatgctgcaggag
ccacaaagaatccgggggcctcaagccttttcatgccctagcttctgcattaggcgacaa
cttacttgcttgctaggggagggggggccagcctggaggatcccctaccccaaggctgct
ctttcccattagGTGGTTTTGCTGTCTGCCACGATGCCTTCTGACGTGCTTGAGGTGACC
AAGAAGTTCATGAGGGACCCCATTCGGATTCTGGTCAAGAAAGAAGAGTTGACCCTCGAG
GGCATCCGCCAGTTCTACATCAACGTGGAGCGAGAGgtggggcccggtgcaggggggggg
cttgcctggctgtacatccctgggtagagcccctcactgatctccttccccctcccagGA
GTGGAAGCTGGACACGCTGTGTGACTTGTACGAGACTCTGACCATCACACAGGCAGTCAT
TTTCATCAACACCCGAAGGAAGGTGGATTGGCTCACCGAGAAGATGCACGCCCGAGACTT
CACCGTGTCTGCCATGgtgcgttctctcccttgttccccgtagtgcccgtgtgcctgggc
ctccgagcctgtgcgcctgtgacacgcgccctcccctctggtccccactatagCACGGAG
ACATGGACCAGAAGGAGCGAGATGTTATCATGAGGGAGTTCCGCTCGGGCTCTAGCAGAG
TACTGATTACCACTGACTTGCTGgtgagtagggaatggagaaccctgggaaggagggagg
acccaagctgattccctctccagggggcttgcttgtgcccccctcaggaaagtagcaact
tggaataaaatgtgacatgcctcagggtgctgggaagaggggctgctgtttcctttgcct
tccctttggctgcctacacacacagcggtccctgctacgcgcactggtcccccacccttc
ctcctgctgacctgtcctctcccgacccagGCCAGAGGCATCGATGTGCAGCAGGTGTCT
CTAGTCATCAACTATGACCTTCCTACCAACAGGGAAAACTATATCCACAGgtaagtgcag
atctaaaatgttccctcccccagccctgagctcaggctctgtcctgcccccatcctgagc
cagactgaacctgtcctattctcaccagAATCGGCCGTGGTGGACGATTTGGCCGGAAGG
GTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAGGACTCTTCGAGACATCGAGACTT
TCTACAACACCTCCATTGAGGAAATGCCCCTCAATGTTGCTGACCTCATCTGAGGGGTGG
TCCTGCTACCTAGCCTGACCCTGGCCTCAGTCTGGGGGGGGCAGAAGAGCAGGAGGGGGG
AGGGAAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTCCTTTTTTTTTTCTTTGAAT
AAATGTCACTTTTTGAGGCAAAAGAAGGAACGTGAACATTTTAGACACCCTTTTCTTTGG
GGCAGGCTCTTGCTCCAGGCGCCGTCTCTTCTCCCAAAAACACTAATCCATCTCCGTAAC
CTAGTCAACCTCCAAACCCCAGAGGCTCTCCCCCACCCCAGCTACGTGCCTCTTCAGAGG
CTGCCAGGGGCCATAGTGTCACTCAACCTCATTTGCTGGACCAAATCTGGAGAATCCCAG
AGTTAAATGGCCCAGAGGATTGTCCCCAGGTGGGGGGGAGCAGGGGAGAAAAAGTGGTAG
CCATTTTTACATTGTTTTGTATAGTATTTATTGATTCAGAAAACAAACACAAAATTCTGA
ATAAAATGACTTGGAAACTGCctgtttgggcttctcatttcttgcctccccttccctccc
acctgtgtcccagggcctccctggctggggccaccactccacccccagttcatagtccct
caagtttcccttgggtttcctttttttgttatcctctccctgctgacccgctaatggggt
agcatttgttggctagtgacccactctaaaggccaagacgcaagcaccatcataagtgcc
tcacatgttctgtcaagaggaagtgacaaatggaaaagagggaatagaaacacttaaccc
ctagaactggaggacataagcaaggggtggggtgctgttccccgctggttctgtaacccc
tccggcccaccaaacaggctgaagtagacaagtaggtccgcaaggaccaactgtccccaa
actccgcatctacctgtgatattgaggctggtgacccatcccctcacttggtgacagggg
ttcaatgactaagtgattggtggctggggctgaggtgcctgagtcaggctgggggtggac
tgggctgccacaggaagtcagacacttaattcctcttccaaaagaaggcagaggctacag
gctggtgttgaacacaccgtcccgcaccgactggggtgaggccgatcggttatgaggcca
gccgtgtttttcttgggggccttggtggggctgctagcaggtaagggggggcccgagggg
aaggggctcagggggacactgccccattgctaaccaaccctcccctctgctccaagccca
ggggacccggagcgactgtccccataaaaagtcggccaccctgctgccctccttcacggt
gacccctacggctacagagagcacaggaagccctgggaccaccagccacagcaccaccac
cgcggagaccaccagccatgcgcccaacaccaccactcaccaggccccgacaaccccggg
gcacagaaacaccaccattcacccaaccacgagcaacagcacaagcaacaccacgggcac
c
  Untranslated Region
  Coding Sequence
  snoRNA
1000..1049, 1457..1589, 1966..2105, 3732..3900, 4234..4343, 4572..4715, 4798..4935, 5033..5122, 5370..5449, 5548..6200
1000..1049, 1457..1589, 1966..2105, 3732..3900, 4234..4343, 4572..4715, 4798..4935, 5033..5122, 5370..5449, 5548..5692
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved