Canis_familiaris Locus ENSCAFG00000011666
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000011666
Canis_familiaris
ENSCAFG00000011666
5
SNORD14, SNORD14, SNORD14
3582..3669, 4012..4097, 4895..4982
6298
cgcctgggaagccccaggtgaagggcacggggccgccggcgcccaggccgctcatgcct
ggttctcctcggcggaagcaagccgcgggcctttctttccttccacagacacctgaggag
taggggtgggggccgggcggcgggcggcgggcggggggaggggcagggcgcgggcccggg
ccccgcagcctgaggattccgggcgccggcctggctcacccgccccgcccccgcccccgc
tcccgctcccgccccccagccccagcgcgcacacccggcccgaagcaccaggcaggcgac
gcgggaacgtgggccccgcgagggcctcggggaccccgggcgatgccgagggggggaggg
gcgcacaaccttcgcggccattttgccctcgctccacttccgccttccctcccgggccgc
cgggtccgccctgcccccgggtccgcgtccgagcccgctggcggccagggccgttgccat
tggctggctctcacgctgcccgcccctctccctcctcctccttccggcccctcccgcgcg
cgcttgcgacggcgcctgcgcagaagcggacgcggcctccggcccccccccgcccccccc
tccgcctccccctccgcctgaggtgactgaggactcccgcgcgcgggctctctcggctcc
accctccctttccccggggccgttcggagcgcgggggcgagaatgaaagttccagaacgc
tgcggtgagtgcgtcatcgcgagggggggtgggatgggggcgggagggggcgaggcccgg
agcgggagccggcgtcgtcattggggctcgccgaggtggccgcgcgcccattggccgacg
ccgccgtgannnnnnnnnnngattcggggctcgccgaggtggccgcgcgcccattggccg
acgccgttgtgatgggcagccggcaggggtggaccccttctggaaggttctgaggcaggg
tataagagacagggtggcgggcggaaaccggtctcattgaacgcggcgccagatctgcag
acggctgttgtctccgcgagccgagcccggcccacacagaaggtaaggcccgggcgtgcc
ggggtcccgtggcggcccctcaggggcgtgcgggcggcggcggccgggccgggtgggcgg
cgcccggggggccccgagccttcgtgtgcaggtcctggggcggcggggggggggggggtc
cggagccgtcgctcgcctccctgccgggctggggcgcgcccttccccgcggggcgtgggc
tgcagcctcgggggccggcggcggccgggtggcgtccgggccgcttccgccctcggggcg
cggaagtttccaggtcctgtgaggagcgagccgccattggcgtgcggccagccccgggag
cggggcggggggggggcggccggagcacgtaccccgggccgcattgtgtggtctccggga
gcgcgggtcacggcgacggggggaagcggcgctccagggcccgacaccacgtgctcggaa
ctgtcgcagactctcggggcaggtgcaccttccggtgtgggccggccccgccgccgttgg
cacggcaaccccggctgcagcgctgccggccccggcgtcccgcggggttctcccacatgg
gcggcgattcggggcgggggaagcgggctcgtgcccggtggtggcttagttgtcgcagga
agCGTTCCGAGGCGTTCAATCCCGTTCTCAAACCAGGGGCTCGCTTTCTTTTTTTATCCT
AGCAATTATGTCTAAGGGACCTGCAGTCGGGATCGATCTTGGCACCACCTACTCCTGCGT
GGGTGTCTTCCAGCACGGGAAAGTGGAAATAATTGCCAATGATCAGGGAAACCGAACCAC
CCCAAGTTATGTCGCCTTCACGGACACCGAACGATTGATCGGTGATGCTGCGAAGAATCA
AGTTGCGATGAACCCCACCAACACGGTTTTCGGTAAGCCGTTGGCTTAGATCTTCTGGCG
TGGAGTGTAGGTTGCGGGTGGTGGAAGTCAGAAGTTTATGGAGTGTGAGGCAGCCGTGAA
AGCCTGGAAAAGAATCGTAAAATCTGTTGCAGTGGTGATTACGTAACGTTCTGCAAAAGT
TTGAGGTATTTTAAGAAATAGTTTGGATAACTGTCAGAGGAGGAGTCCGTTTACTAGAAA
GTAATTTGGTTACTAGTCCTCGTGGCGTTTGAGTGATGGCGGACTAGGTTCTTCCTCGGT
AGATAGTAGTGTAACAAAACTTTTCCATTCGGTGACCTTTTACAGATGCCAAGCGGCTGA
TTGGACGTAGATTTGATGATGCTGTCGTCCAATCTGATATGAAGCATTGGCCTTTCATGG
TGGTGAATGATGCTGGCAGGCCTAAAGTCCAAGTAGAGTACAAGGGGGAGACCAAAAGTT
TCTATCCAGAGGAGGTGTCCTCTATGGTCCTGACGAAGATGAAGGAAATTGCAGAGGCCT
ACCTTGGGAAGGTAAGTAGTGTGCATCCCTACAGGGAGGTAGTTGGAGGTTGAAACATGC
ACCAGATTCCCTGATGAATGCATGGGATTTTTAGTGCTGTGGAACATCTAGTGGCCACAA
CTAATAAGTTAAACGTTTAAAACACGCTTTTTGATATTTTGAGAGCACACAAAAGTAGAC
GATGGCCATGTGACTGCGGACAATTTTACAGATGATTTACAGCCATTTTTTGGTCTTCTT
AGACTGTTACCAATGCAGTTGTCACGGTACCTGCATACTTCAATGACTCTCAGCGTCAGG
CTACCAAAGATGCTGGAACTATTGCCGGTCTTAATGTACTTCGAATTATCAATGAGCCAA
CTGCTGCTGCTATTGCTTATGGCTTAGACAAGAAGGTATGTACCACGTGTGAAGAATAGG
ACTCACCTTACTATATTATATATAGATCAGAGACCTAGGAGGAGGTGTGCGTAATGAGTA
ACTGTCTCATATTCTAATTGTAGGTTGGAGCTGAAAGGAACGTGTTGATCTTTGATTTAG
GAGGTGGCACTTTTGATGTGTCCATCCTTACTATTGAAGATGGGATCTTTGAGGTCAAGT
CCACAGCTGGAGACACTCACTTAGGTGGAGAAGACTTTGACAACAGAATGGTCAACCATT
TTATTGCAGAATTCAAGCGCAAACACAAGAAGGACATCAGCGAAAACAAGAGGGCTGTCC
GCCGTCTCCGTACTGCATGTGAACGGGCTAAGCGTACACTTTCTTCCAGCACCCAGGCCA
GTATTGAGATTGATTCTCTGTATGAAGGAATCGACTTCTATACCTCTATTACTCGTGCCC
GGTTTGAAGAATTAAATGCTGACCTCTTCCGTGGCACCCTGGACCCTGTAGAGAAAGCTC
TTCGAGATGCCAAGCTGGACAAGTCTCAGATCCATGACATTGTCCTGGTGGGTGGTTCTA
CCCGTATCCCCAAGATTCAGAAACTTCTGCAAGATTTCTTCAATGGAAAGGAACTGAATA
AGAGCATCAACCCTGATGAGGCTGTTGCTTATGGTGCAGGTAAATTATTTCCTCAACCTT
TAAACAGTTGTAACCAGTGGACTTGTTAAGCCCTAGGCTGCTTCGCTATGATGATTGATT
CTTTAAACATTCGTAGTTTCCACCAAAAGCTTAGCTAATGATGGTCCAACTTCCTTGGAT
GTCTGAGCGATTGACCTTTGTTAGGGAGTTAACAGGGTGGTTGGGATTGTTTTTTTTAAC
ACTGTTTCTATTCCACCAGCTGTCCAGGCAGCCATTCTTTCTGGTGACAAATCTGAAAAT
GTTCAAGATTTGCTGCTATTGGATGTCACCCCACTTTCTCTTGGTATTGAAACTGCTGGA
GGAGTCATGACTGTGCTCATCAAGCGCAATACTACCATTCCTACAAAACAGACACAAACC
TTTACTACCTACTCTGACAACCAGCCTGGTGTGCTTATTCAGGTATGGATTATACTGTTG
GTACTGATTTGGCTATACTTAGGGGTTCTATGTAGCTTTGGAAAGACTTGTCCCGCTGTG
ATGATATGACCTAAACCATTCGTAGTTTCCACCAGAAGATTTTGTGTTGGCCAACTCCTT
CCTTGGATGTCTGAGCGATCAGTCTTTCCTCCTAATAATGGACTTTATGCAGAAATCTAC
AAACTGCTAAACTTTTGCGGCTTCTTAATGATTTGTTTTCCTACCAAGGTCTATGAAGGT
GAGCGTGCTATGACCAAGGATAACAACCTACTTGGCAAGTTTGAACTCACAGGCATACCT
CCTGCTCCTCGTGGCGTTCCTCAGATTGAAGTCACTTTTGATATTGATGCAAATGGTATC
CTCAATGTGTCTGCTGTGGATAAGAGCACAGGAAAAGAGAATAAGATTACCATCACTAAT
GACAAGGGTAAGTGTTAAACACAGGTTTGAGTGTTATTTTATGTTCTACAAGATGGTGTG
GGTCATTAAGGATAGTATTTCCAAAACCTTTGACTTCCCAAAGCCCTCCCGAAGGCATTT
ATCCTAGAAGCTTTCTTTCATGGGTTATAAATGTTATAGGGTAACTAGAAGGTTCACATT
TTAAGGTCGTGTCTAAACTTCACAGGCCGCTTGAGCAAGGAGGACATTGAGCGCATGGTC
CAGGAAGCTGAGAAGTACAAAGCCGAAGATGAGAAGCAGAGAGACAAGGTGTCTTCCAAG
AATTCACTTGAGTCTTATGCTTTCAACATGAAAGCAACTGTTGAAGATGAAAAACTTCAG
GGCAAAATCAATGATGAAGACAAACAGAAGATTCTTGACAAGTGCAATGAAATCATCAAC
TGGCTCGATAAGAACCAGGTTTGTGATTCCTACTGAATAGTGGTGGGTATAGGGCTTCAG
CAGGAAAAGATTAGATGGGTTTCTAAAAATACAGGTCACGATGATGAATGGTCCAAACAT
TCGCGGTTTCCACCAGAATTCCACGTGTTGGCAACTAGCTTCCTTCCTTGGATGTCTGAG
TGACCCAACATTTCATGGGTGACCAAGACTTGAATATAGGGATAGGTTTTTGTTTAGTGT
TACTGTCAGATTATACCAGGCATGAAGTTTCTTGAGGAATTTATAGTATGTCTTTTTTTT
TTTTTTTTTTTAGACTGCAGAGAAGGAAGAATTTGAACATCAGCAGAAAGAGCTGGAGAA
AGTCTGCAATCCCATCATTACGAAGCTATACCAGAGTGCAGGAGGCATGCCAGGAGGAAT
GCCTGGAGGCTTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCCTCCTCTGGGCCTAC
CATTGAAGAGGTTGATTAAGCCAACCTGATGACAGGTCTAGCATTGTTCCACACATTTGA
AGGACCCAAATTTGTAGCAAATTCCATGGCAGTTTTAAAGTCGAAGCTGCTATAGTAAAT
ATACTGGGCATTCTTGATACTTGAATATGGAATATGTGCACAGGGAAAGGAAATAAACAT
TGCACTTTATAAGCACTGTATTGTTAAGTGGAAAATGCAATGTCTTAAATAAAACTGTAT
TTAAAATTGGCACCATAAAGTTGTCTGACTCCATGTATACAAGGGCAACCGGTAGCATTT
GGTTTTTGGGAGGGCTGGATATTTGGCCTAGTGGTGAAACTGGGTTGTCAAGTGGCTCAG
GTTTAGTTCCAAATCGATAAAATTGTAGTTTGGGTTTGCCATTAGCTAGGCTTATGGTTG
CTATGATAAATTGAAGCTAGCTGCAGATCTAGGCACTCTCGGTGCTCTTGAAGTTGATGG
GGAAGAAAAAAGGGAAGAATCCAACTTCTGCTTCATCTGGCATGAAGAAAGTAGTTTGGG
AATGGAAAATTTGAATAATAGATACCTAAAAGGGAAGTAGTTGGTCATGTAGGAATAAAT
CAAGTTAAACCCCTGTAGCATATCCTTTATTTCCTTTCGACTTGTTTGAGCTGGGTGCTA
ACCCATAGAACTCTGGAGTTTACCATAGAATCAACTGGAAAGGAAAGGCCTAGAGCAGCT
AATTGTGCATTCATGTCTTAAAACCGCCAGGCTAACCCTGAACCATGGGCTGAGCTGATG
TTAGTACAGTTGTATTTGACAGGTTACCGGTTTGCCTTTAGGTAAAGGGTTTATAAAGGA
AAACTACATCGTTGGCTCGTTTAAAGATTACGTGGCTTGGTTCTTTGCGATGTTTAGGAA
AGGGGTTGAATTTAGGTTTCTTAGTAAATAATGGTTGGTTAGCTACAGGCTGAAAGTACT
CCGCCTTGGAGTCCTGGAAGTCCTTTGTGCCTATGTCACTTTGTTCTGATAGGCCTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1061, 1742..1951, 2265..2470, 2702..2854, 2963..3518, 3739..3941, 4188..4386, 4585..4817, 5113..5298
1746..1951, 1742..1951, 2265..2470, 2702..2854, 2963..3518, 3739..3941, 4188..4386, 4585..4817, 5113..5295
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved