Canis_familiaris Locus HSPA9B
snOPY snoRNA Orthological Gene Database
Canis_familiaris HSPA9B
Canis_familiaris
HSPA9B
11
SNORD63
12154..12228
19471
CAAACAGAAGTGGTCACAGTTCAGTGGGCCACTACCATCTCTTTGTAGAGCCCCCCCCC
CCCCCCCCCCCGCTCTGCCCCTGGGAACCAGCACACGGTTTGAGATGCAGGGGAGGAGCT
TGGATGCCTAAGAGCCTCAAGTATTTTCTTCTCTCGAGAGTCTGCACGATAATTAGCCTA
ACTCAACCTAACACTCCGCAGGAACGAAAGGCGTCTTTCATAGTTCGAAACCAGAGAGCC
CTGCGGTAAACAGGCGCAATTCAAACCCCCGCAACAGGCCACCAAAAGACGAGCACACAC
CAGGCAACCAACGTTCTGAGCCAGAGATTTTCATTGGACGAAGGCCCAGGACTCGACCGC
GCCCTCCTCCAAAAGCCCGGGCGAGGAGAACGCCAAGGCGAGCGGGTGACGCACGGGCTA
GGGCTCCCCGGGGCTACGCGCGGGCCAGCTCACGTGCGCTGGAACGGCCAATGAGCGATG
CGATTAGGCTCCATCCCGGTTTCCGCCGCTCCCTGCGCACATGCGCCTTAGGCACGCAGC
AGGATGCCAGCTGCGCAGGCGCAGCATGCTCCTCCTTTCACGCAACTGACGCAAGGACAC
TGTAATCGGGGCCGTAATTTAGTCGTGTGACCTTGAGTCTTTCCTGCCGCCGAGGCCCGG
GGCTGTCCAGCGTACTGCCTGTACACCTCTCTTAGCCCCCTCGCCACTCCCCGAGCCCAG
GCTTGTGGTAGCCGGAACGAAAAGATACGCTTTTTCCAGCCGTCATGCCGCGATGTGTAT
CAGCCATGTACCCTAACTCCGGGAGTGGCTGTCAGGTAGTCTCCGGTCAGGCAGCGCGGG
CGGCGTCTCAGCGGAAGAGCGGTCCTCCGGGCCTCAGCGACTAGCCCCCGCCCCCCACCC
CACGTGGTTGGAGGTTTCCAGAAGCGCTACCGCCGTCTCGCTGCGCAGCTCCTGTCCGTC
CGGTCGCGTGTTGCCCTCGATACTTCCACCGTCCAGCCGCCATGATAAGTGCTAGCCGAG
CCGCGGCAGCTCGTCTTGTCGGCGCGGCAGCCTCCCGGGGCCCCACAGCCGCCCGCCACA
AGGTAAGGAACTGTCGGGCCTTCTCCGAGGAGCTCCCGGCCTTGACCTCCCGCGGCAGGT
CTCGCCCTTCAGAGACAGAATTAGCCGGCAGTGGTGGGATGTGGAAGGAGATACGCAGCC
TCCAGTAACTAGTGCTACCGTTGCAGGGCCTACCTCAGGGTTCGGCTTCCGTGTCTCGGG
CTCTGCTGAGTCACACCCCTTACGAGCATGTAGTTTTACTTTGGGGAGTAGCGGATAGCG
GACGTTCAGCGGCTGATTGTACGGTTTGGGCCGTGCGGGCGAGGGACGCGATTTTAGTTG
GGAGGGAACCGATATTGTAGGTTTCGTTTACGTCTACAAGACGAAGGGTGACTGCTACTT
TTCTCTAAAATACTGTGCAAAGATCCCGTTATTGTGGAAAGAAAGAAGAAAAGCATCTTA
GTAAAGTGAAAGTCAAGCACAGATTTTCTTACTTAGGAACATTTGCCTGTAGTTCTAAAA
GAATCTTTGGTGTAAGATTTTTTTTTTTTTTAAAGAAAAAATAAGATCGGGAAATGGCCA
AGTAGTAGTTTTCGTCATTATCGTGTAAGACCGAACATATCTTTGGAGAACGGGAACTGT
CTCTTCGCACTCAACGTGGGGTTAAAAAAAGAAGGGATCTTTGGGTGGCTCAGCGGTTTA
GCGCCTGCCTTCGACCCAGGGCGTGATCCTGGAGACCCGGGATCGAGTCCCGCATCGGGC
TCCCTGCATGGAGCCTGCTTCTCTCTCTCTCTCTCTCGTGAATAAATAAGATATTAAAAA
AAAAAAAAAAGAAGGCTTGAAAGTTTTCTGAAATTAGGTTTGATCCTGCTTTGAAGCCAT
TCATAAAGTGTTTTTATAAAGTGACTCCCCTCTGTTGCCGATCCTAGTTCCCTTGCGGTG
TTAGCTTGACTAGATCGGGAAATACATTTGGATGATTGAGATCTGCAGCTGGAACACACC
TAGTCGGGTTTAGATAACTGTACCCTGCTGCTGATTATGAAATTGAGAAGTATCTGAATA
GTATTTTGTAAGCAGTGATTTTCGAGGGAGAACAGCTCTACCTTCCAAGGGGATATCTGG
AGATAACTTGTAAAAACTTGGGGGGCCTACTGGCTTCTAGCAGTAGAGGCCGGGGATGCT
GTTAAACATCCTACAATGCACAGAGCAGCCCCCCACAACGAAGATTTGGTTAAAAAAATC
TGTAGTGCTAAGGTTGAGAAGCTCTGTAGTTGAGAAGCTCTGTAATAATGTAATTCGACA
CAATTTTATATTTTTATCCCTCATTATTTGGGGAATTCTATTCAAATAAATTTGTCTCCA
CAATAACTCATATAAGATTTTCTTTTCAATATGTGGTTACCAGAATGAAAGTTAACACTT
TTTTGTTCTTCGGGAAAATAATGAGAAGCAGCTCAAATTTTCATGTCTTTGTTGATGTTT
TTTAGGATGGATGGAATGGCCTTAGTCATGAGGCTTTTAGAATTGTTTCAAGGCGGGACT
ATGCGTAAGTGTAACTTACTTTCTTTGAGAAATAATAAAATACTAAACTCTAGAGTAGTG
GTCTCTAAACTTGTGATTAACTCTTCCACCAAGGAAAAAGTGACATATTGGTTTTAATTT
GTACATTATTTAAGGCACAACTATTTCCATGGTATCAAGTAGTCTTTTTTTGTGTGTGTG
TATTCTTGCAACCATTCTGGAGACCACTTAAGATAACAATAACCATAGTATTTTTTTAAA
TGTCTTACAGATCAGAAGCAATCAAGGGAGCAGTTGTCGGTATTGATTTGGGTACTACCA
ACTCCTGTGTGGCAGTTATGGAAGGTAAACAAGCAAAGGTGAGCATGTTTGGAAGCTCTG
GATCTCAAATAGGAGTTAGTATCCAATCTGGGATTCTGTGCCTTTTGGCTTAGATAAGGG
ACATTCTAAAAGCTGATTCTAAGTTCCTAAGTTTCTTTTGAGGCTAACCTATGTACTTAA
TTGCAAGATGCTGTAAAGTGCATGGATTTGACACCAGGATTTAAGGGTGTCCTAGCATAG
AGATAGGACTGTTCCCATTTAGGACCAATTGGGATGACTTGCTCTGTGGATTATTTCTAT
CATCAGAATCATGCATTTTGTAAGTCAGATGAACCATGGCTGAAGGTGCAAGAAGAGTCT
AGAAGCAAGTGAATCTCCACATAACATGTAGGCTGCATCTTAGGAGCTTTTACTGTGATA
GAGGCTGTTCCTCCTGAAGGACCTCCTTGGTTTGTTCATAAAACCTTTATTCCCACTGGT
TTCTTTATAAGATGCAGAGCACCTGGTATTCCTGAATTGTTATTTGGCAATTTCTTTTTT
AAATGCCTGAAACTTGTAGCAGCATGAAAAAAAATTGAAGTAGATTTAATTTTCCCTACA
AAAGGAAAGAGTACCTTGTTCCATTATCTTAGTGTGAAAGATTTGATATTTATTCGTGTT
TTTGTTTTTAGTTATAAAAAGTAAAGAATTAAAAATACTTTTAGGGGCACCTGGGTAACT
CTGTTGGTTAGGTGTCCCAAATATTGATTTCAGCTCAGGTCATGGTGTCAGGGATGTGAA
ATGGAGCCCATCAGGCTCTGTACTCAGCTGTGTGTGCATGTGTATGTCTCTCTCTTAAAT
ACATTAAATGAATAAAGTCTGTTTTTAAAAAGTAAAGAAAAGTACTTAAAACATGTACCT
CAAAGAGGAGGTATTTAGGAGCTTTCACAGCATAAAAGCATGCCCATTAGTACTATTGTT
GAACATTTGTTTTGTGATTTGACAGATGTTTTGTGTCTTAAAACAATAGCAAGACTAGTG
GTGACTGGAACCTCATTTTCTGTCTGTCTCTGGGAGTTTTAGGTGCTAGAGAATGCTGAA
GGTGCAAGAACCACCCCTTCAGTTGTGGCCTTTACATCAGATGGTGAGCGACTTGTTGGC
ATGCCAGCCAAGAGACAGGCTGTCACCAACCCAAACAACACATTCTATGCCACCAAGCGT
CTCATTGGCCGGCGATATGATGACCCTGAAGTACAGAAAGACATGTGAGTAATAGGAAAA
GCATAGTTACTTCTAGAGGCTATGAGGAGAATCTTTTCACCAAGATTCTTGGAGCATCTA
AGAATTTTGGAGTTTTACATACTGTCCATGCGGGCATGTCCTGCCCCTACCAAAAGGGTG
TCTCCTTCAAAAACGTTTTTCCTGCCTTCAGATAATAGGTCTTCACTATGTATTGGCATG
ACGTGAAGATTTGGCTAGTCATTTAGGGACCACATAAATTGATGGCATATAAGGCCTAGG
CCCCATCATGTGCTGTTCAGCGATGTTTTCAGCATTTGTCTGTGCTGTAATATGTATCAG
TACTTCGTATCTTTTTTATGGCCAGATTACATTTACATCGTATGCATATACATTTGACCC
TTAAACACACAGGGCATTGTGGGGCTGACCATTCATGCATTTGAACACCTGTGTATAATT
TTTTGACTACCCAAAAAGTACTGATAGCCTACTGTTGAACAGAAACCTTGCTGATAACAT
AGGCAGTTGATACCACATTTCGAATGTTTATTGTGTATTGTTTATCATGTTTTAGTAAAC
TACCTTAGGATTTAAAAAAAAATGTTAAGCCATGAGGAGGAGGAAATCTTTTTACAGTAT
TGTATTTACCCAAAAATATTCACATATAAGTGGACCAGTGCATTTAGAACCCATGGTGTA
AGGGTTAGCTGTATACTACATTTTATTTATTGGTTTGTAAGTTAATGGGCATCTGGGAGC
TATTAAGAATACTGCTACAGAGGTGCCTGGCAGTCTCAGTCAAAAGAACTTGTGACTCTT
GATCTCTCAGGGTTGTGGGTGTTCAAACTCCATTTTGGGTGTAAAGATTACAAAGAATGT
TCTCGAGGGGCGCCTGGGTGGCTCAGCACTTAAAGCCTCTTCATGGCTGGGGTGTGATCC
TGGAGTCCCAGGATCGATTCCCGCATCAGGCTCCTCACATGGAGCCTGTTTCTCTGTGTT
TTTGCCCCCCCCCCCCCCCCATGAATAAGTAAAATCTTAAATAAATTCGAAAGCATACTG
CATAAACATTTATGTAGTTTTTGTAAGGATCTCTGTTTCTCTCTGCTAGATATCTAGTAA
TGGACTTGCTGGGTCCATTGGTAATTCTCTAATCACTTCCAGAGCAGGGGCACAAATCTT
GTGTTTGGCAGGAAGTAAAGAATGTTCAGGTTTCATCAGGGTGTTTCTACGTGTTAATGA
CTGCTTTCTAAAGGTTTTCATTAAATGGATTCTTGAAATTTTCATTTGTTGGCCATGAAT
CTCTTGGGATAGAGGATGGACGTTCATGGTGTATGGTCACCTTGTCATGGTAGGTTGTGC
GGGCACATTTTTTCAAATACAATTTTTATATCTTTCAGTAAAAATGTGCCCTTTAAAATT
GTCCGTGCCTCCAATGGAGATGCCTGGGTTGAAGCTCATGGAAAACTCTATTCTCCAAGT
CAGATTGGAGCATTTGTGTTGATGAAGATGAAAGAGACTGCAGGTGAGAAGGTTTAGATC
CCATCTGGGAAAGTTTAAAGAACTGGATGGTTCCTCAAATACCCTATGTCCCTTTGATGA
CTATGGTGGGTGTTGTACAGAAAACCTAGAAATGGGGAAACTATTATTGCTTACACATTA
CCGTACATATTGAGTTTATCTTCAGAGTTTCCTGATGGTGATTTGTCTATCTTTTCCACT
ATAGAGGGGTGGTATTCTGTATTGAAGGCTGAAAGACTACATAATAGTCTTTGGGCTCTG
TTAGATAAAACTTCTCATTTGGAGAAACCAGTGGCTGTTTTAAGTCTTAAGAGTAGGTCA
TTGTAGCTGGTGAACCTTCACTTAATGTTAAAGGTGAGATCTTGGGTCTTCAACTACTAT
CTAATTTGAGTGTTTTCCTAAAAGGTCTCTCTGTATTAGGTCACATACAAAGAAACTCAT
GAGTATTGTCTGTGGCTCCAAGAGGATGACAGATTGTTAGCTTGCATTAGTAATTGTATT
AGCTGTTTCATCTGACAGAGTCTCATGATTGTATTTCATTTTTTAATTCTTTTCCAGAAA
ATTACCTTGGGCATACAGCAAAAAATGCTGTGATCACTGTTCCAGCTTATTTCAATGACT
CTCAGAGACAGGTGAGTTCAGTTGGTGTTCTTATTCAGGAAGGTAATGGTACTTAGGACA
CAGGGTGGAAAATGCTTTTTTCTTTTCCTTTAGGCCACTAAGGATGCTGGCCAGATATCT
GGACTAAATGTGCTTCGAGTAATTAATGAACCCACAGCTGCTGCGCTGGCCTATGGTCTA
GATAAATCAGAAGACAAGATGTAAGTTTGTGTAGTAAACTCCACCTAGGTTTGTGAGACT
CCGTCAATGGAACTTGTCTGGCCCGTTCGGTACAGTATGTGACTTTTTTTTTTTTTTTTT
TTTTAGTTTATTTATTAGGCAGAGGGAGAAGCAGGCTCCATGTAGGGAGCCTGATTTAGG
TCTCGATTCCAGGTCTCCAGGATCACGCCCTGGGCGGAAGGCAGCGCTAAACCGCCAAGC
CACCAGGGCTGCCCTGAGTATGTGACTCTTAATTCAGGATGGTGAGATCAAACCTAAGTT
GGGCGTGGAGACTGCTTAAAAAAAAAAAAAAAAGTACTGTCAATTTTGCTTTTAAAAAAA
TATTTTAAAAGCTTTTTTTTTTTTTTTTTTTTTAATTTTATTTATTCATGGGGGCGGGGC
AGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCAGGGAGCCTGATGCGGGACTCGATC
CCAGGACTCCTGGACCACGCCCTGGGCCAAAGGCAGGCGCTAAACCGCTGAGCCACCCAG
GGATTCCCTTAAAAATGTATTTTAACTGTGTATTTACCAATAGCTATTAGGCCCACATTT
TAACATACTTGTTACTGCCTAAGAAAACTTGGATTTCATTATTATACTTCAGGGAAACCA
TCAAGTTTATGTTCATTTGGTTATTAAAATTTATACCCTTGCAGCAGGTGTTAATTCCTT
TCGGTCTTTTTTCTTTCTAGCATTGCTGTATATGATTTAGGTGGTGGGACTTTTGATATT
TCTATTCTGGAGATTCAGAAAGGAGTGTTTGAGGTGAAGTCCACCAATGGAGATACATTC
TTAGGTGGTGAGGACTTTGACCAGGCCTTGCTACGACACATTGTGAAGGAGTTCAAAAGA
GAGGTTAGTTACCAGTATAGTTAATATGTAGACATTGGGATGTTGAGAATTTCTTTATTC
AGATGGATCTTTGCTTTATGTTTTGCTCTTAATAGAACATTGACTAGAATGCTGAAATAA
TTGCTTTTCACTTTCATGGGTGTACTGAAACATGTGGTTGTTGTAGTTTCAGTTTGGGAA
TAAACAAATTAAAAAGGATATGGTACTCTGTATAATGTTCGCAAAGGAATTCTGGGAACT
CCTCTTTTGAGCCAGAACCCGGTGGTTGGGAAGAAATATGATTAGTTCAGCCTTCTGACT
CCAGGCACAGATAGGCTTTGCAAAATAAGATTTCTTTTCCTTACTGATTTTTAAGGGTAG
TAAATGATTCATGCTTGTTTATAAAGGTACAGTTCTGTTTTATGTTGTTATATGTTATCA
CTATACTTGAAATAGTATTTATCACCTTGCTAATATTAGTATTGTGTGTTTTTATTTTGT
AGACAGGGGTTGATTTAACCAAAGACAACATGGCACTTCAGAGGGTTCGAGAAGCTGCTG
AGAAGGCTAAGTGTGAACTCTCCTCATCTGTGCAGGTGGGATGTGGACAAATCCTAATAG
TCTTGATGTTTTTAGCCTTAGTTTATTTGAAAAGCATGTTCTGATTAGTGTAATGTCCAT
CTAATCTTTTTAGACTTTTCTGGTAAAAGTATAAAAACCTTCATAAAGTAGTAAAAGGCT
TTCCAGAAACAAAGTAGTATTTCTTTAAGGATGAGCTAGAATTTGTTAACCACCCAAGTA
AGATTCTATATACCAGAGCCAAAAAATAATTAGGATTTGAATGACACTGAATATGTTTTA
TTTGCCTTAAATTAACATACTGATTTTTAAGATCTATACTGGTGTTGTGCAAAATTAGAA
TCATTAGCCTAGAAATAATAGGAGCTTCTAGGAACTGCTACTGTCTTAAGATCCCTCTTT
GTGGGAGTCTCTAATTGTCTCATGATTATTTGGATCACCAATCCAGAAAGTGGGCTATGA
AACCTGGCTGAAGGCTGGGGTGTATACACTTACATACATTTCTCTCTGTTGGCATCTGTT
GAAGGTATCAGCCTGTGTTGTTCCAGTCTGAGAGGTGAAGCTTCACTTTGCTTTAACCAC
TAGGAATAGAACTGTATAAAGCTTGCTGGGTCTGGGTCAGAGATGCAACAAGATGGAAGG
TAGATTTGTTTCTTGGTTCTTAGGCCACAGCAGCAGGAAAGCAGAACCTGTGACTTCTTT
AGTTCTTACTTTGACCATGGATTATCCAGTGTGGGGAGACTTGGATTTAAAAAAGTTTTT
TAAAGTAGCTGTGAGGAGTAACAAAGTCATATAGTCCTCCAGGATGATGGTGTTACTTTA
TCCCTGCTGTCACACAGAGTGGCAGAACTGCAACATGTGATGGTTAGGGTTAGAGGTGAA
CTATGTGACGTAGTTCATAGTTCATAGTGCTGCAAGAGCGCTTAAAATTCTTCCCACGAG
TTTGACACTTTGGAAGGGAGAGGTTGGTGGAATTAGCGTGATTCTTATTAATGGGCATTT
GAATTGTTTCCGCATTTTGCTGTGAAGCAAAATATGTTGAGCATTCTTGAATATCAATGT
TTGTGCATGTGTGATTATAAATCTATAGAATAAATTCCTAGAAGTGTTCACCTGCGTGGG
GTTACAGAGTGGTTTGGAAAGATAGATTTTTTTTTTTTTTTTTTTTTTTTTAAGATTTAT
TTACTTTAGAGAGGATGTGGGGGAGGAGAGAGGGGAAGAGAGAATCTCAAACAGACTCCC
TGCTGAGTGCAGAGCCCAATGTGGAAGTCCACCACAATTGTGAGATTGTGAGCTGAAATC
AAGAGTTGAATGTTCAATCAACTGAGCCACTCAGGCACCCCAAAGAGGTAGATACTAATT
AGGACATTATATTAATAACTGTCAAGCCAAAGGTAATGCAGTAAGTTAAGATCCCCTGTA
GGGATCCCTGGGTGGCGCAGCGGTTTGGCGCCTGCCTTTGGCCCGGGGCGCGATCCTGGA
GACCCGGGATCGAGTCCCACGTCGGGCTCCCGGTGCATGGAGCCTGCTTCTCCCTCTGCC
TGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTCTGACTATCATAAATAAATAAAAAATTAA
AAAAAAAAAAGAGTGGCCCTGTAGACAGAGTGCTGGGATTAAAGTCATATTTTATCACTT
AATAGCTGTGTGGCCTGTGATAAATTATTTAGCATTTGTTTTTTCTTATTTTTAAAATGA
GGATAATGGTGCTGCTTTCTCTCTTAGAGTTGTAAGGATTCCTGAATTGATATGTGGTTA
AGACGTATCTTAACTAGTACTGTAAAGTGTCATTAATATGGTAAAAGAGCAAAGTTAGAT
TTGTAATTGACAGATGCTGAGAGATGAGTTGATCAGAAAAAGATAAAAAAAGGGTCAAGG
AAGTATGAGGCCCTGCAGTGACCCTGAGAAAGGGCTAGTGTGTGAAGAGCAGAAGGGCAG
GGAAAATGGAACATCATGAGACTAGATGCTTTATAGATGGGATTTAGGTCTATCCTGAGA
AGAATGAGTATAAACCAGCGGGGAAAAATTTTTTTTAGTAATCCCTACACCCCACATGGG
GCTCAAACTCCTGACCCCAAGTTCAAGACTCATAGCCACCTAGCCAGCCAGGCACCCTGG
TGAAAACTTAATTTAGGGGCAGTAATATGGTCAGATAAGAGATTATGAGCAGTGCTCTGT
TAGAAGTGGAATAGAGGTTTGTTCTGGGAGGGGTCCTGTGGCACAGGCAGCCTTGGTGGA
GGTGGTACAAGGTTGAGACGCTGTTGTGGTACACGATCAGCTGGTGGTGAGAGGAAGGAC
TGGGACTAGAGTGTGATAGAATGTGTTGAATTTGAGAGGGGGGGACAAAAGTTCGTGACA
AACTGGTTTTAAAGAGGTGAAAGTCCTGGAGTTCAGGTTGTCATTAATGTACAGCATTTG
AACTGTCATTAATAGTGTCCATGTGAGGGTTTTAAAATTAAGTTTTAGAATGCTGTTTGT
CATTTGTACAGCCTATATTTTAAGTGCTGAGCTATATGTGGCTAGTGGTTGCTGAATTGA
ACAGCACAAATTACCATTGTAGAAAGTTGTATTAGGTTGCATTGTGGGGTTTTTTGATTT
TTTAAGATTTTATTTATTCATAAGAGACACAGGCAGAGGGAAAAGTAGGCTCCATTCAGG
GATGTCGGACTTGATCCCGGGACTCTGGGGCAAGCCCTGAGCCAAAAGGCATACGCTCAA
CCACTGAGCCACCCAGGAATCCCAGATTGCATTGGTTTAGATCATTAAATTGTTTATTTG
GTTTATTAACATTTTGCAAGAGAAAGAAGGAAATTGTCCGTGGTGTTCTTTAAAGCAGTA
CTCAGTACCAGTGTTCTACAGAAGGTTGTGTTTTAAGTCTTGCTATTTATTAAGCATTTA
AATAGCTAGGGTAGTTCACCTGATGAGAGATGGTTAAGGATTTGTTCCTCTCTCTTTCTC
CCTGGCCATGCTTTGATGTGAAATTGGAGGGGAGGTAGAAAGTAATTTTGTTTGACGGTC
TACCTTGAGACAGGTTTTGGCATGTATAGTGATGAGTTTTATTTAGTCTAAATATTCTGA
ATCCAGGCCTTTTTAGGATTTGGGTTTTATTAAATAATGGCTGTTACCTGGTATGGTTGT
AGCAAGGTATACTGCTTACCATGAATGCGATGGTGGTAAAGTCAGTCCTTGGAGTTACCT
TTAGCATTTCAGTTACAGCTTTCTTCCCATATTCTTGAAACTAAAAAGCCTTGGCGTGGG
GAGAATATTTGGTTCAAAGTATGCCTTTGACTTTATTGTGTGCGTGTACAGAGTTTTTGA
AAACATGGTTACAGAAAACAGTGGTATGACTCTTAAAGTATGTTTAGTGGAACTGTTCTT
TGTGTCCTGAAGGGGGATTTTCCTTGCTATCAAAATCTTCATTGTTGGTAACAGATTCTA
GAATTTTTGCCTTTGGGAATAGAAGACCTCGAATCTTAATGACTCTTAAAGAGTCATTGT
CTTTGGTGGCCATTCATGCAAAATGGGTATCACTCTCCCAGTAACTTTGAAAGTCTTCCT
AATGTGGGACTGTGGTCTTGCTTTATTTGAAGTAATATAGAAACGTCACCACTACGCATG
CTCTCTCTGCTTCCTTTGCAGACCGACATTAATTTGCCATATCTAACTATGGATGCTTCT
GGACCCAAGCATTTGAATATGAAGCTGACACGGGCTCAGTTTGAAGGCATTGTCACTGAT
CTAATCAGGAGAACCATTGCTCCATGCCAAAAAGCCATGCAAGATGCAGAAGTCAGCAAG
AGTGACATTGGAGAAGTGATTCTTGTTGGTGGCATGACTAGGATGCCCAAGGTATGGACC
CATAAAATCCTTGGCATGGAAAAGCAGAGAGGGCAAGCACATGTTTTTTCTAGACAAATG
GTTTGTGTAGGGACATGAGTATGTGGTGTTCCTGCCACAGTGAGCTGAAAGGATGAATTT
GTGCCCTCACTACAGTTCTTTTTTAGCCTTTTTTTCTTTTTCTCTTTAATTAAAAGGTGT
CAGAAAAAGGATTGGGAAGGGCAAGGATGTCTTTGAGGTGGTAGCATGGAGGATCCTGGC
CTTCATTCTTGGAGTATTTTTAGGAATGAAACAAAGTTTGAGATCAGACATAGCTTAAAA
CTGGTAGTTATCTAGCCTGTAGAGGCGATTATGGGCATGAGTGTCTTTGCACTATGGTGT
TTGGGGTTTCTAACTATCTCTTCAACAGAAACTTGTGCAATGATGGATTTTATTTATCAA
CACATCATTCTGATAAGATAGGTGTGTGGAAAACTAATGACTGAGCACAGAACCTGTTGA
AGATGTAATTCTTGTATAGCTTGAATAGAATTATCTTGGGCCTTGGTAGTAGTTTTTCTC
TTGGGGTTTCTGGGCTTAGGAAAATATGCAAAGAATAAACACTAAGAATAAGAGGCTTTG
GACCAGTAAGATATCTTTGGGTTAACAAATTATCCCAGAAGCTATTTAAATAGCACTTTT
TTCTAGCATTAGTAAAATAAGCAGGAGGGAAGAACAAACCTCACATTAGCACCAGTGTTG
AATTATTAAATTAATCACTGGTGCTTTTTTTTTTTTTTTTAATTTTATTTATTTAGGGCA
GCCTGGATGGCTCAGCGGTTAAGCGCCCAGGGCGTGATCCTGGAGTCCCGGGATTGAGTC
TCCCGATGGGCTCCCTGCATGGAGCCTACTTCTCCCTCTGCCTGTCTCTGTGCGCGTGTG
TCTGTCTCTCTCAAATAAATAAATAAATAAATTTAAAAAATTATTTTATTTATTCATGTG
AGACAGAGAGAGGCAGAGACACACAGGCAGAGGGAGAAGCAGGCTCCACGCAGGGAGCCT
GAGGCAGGACTCCATCCTAGGACTCCAGGATCCCACCCCAAGCCGAAGGTGGCACTAAAC
CACTGAGCCACCCGGGCTGCCCCAACCACTGGTGTTTTTTGTTTTTTGTATTTTGTTTTT
TGTTTTTTATTTATGATAGGCACACAGTGAGAGAGAGAGAGGCAGAGACACAGGCAGAGG
GAGAAGCAGGCTCCATGCACCGGGAGCCCGATGTGGGATTCGATCCCGGGTCTCCAGGAT
CGCGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCCGCTGGTG
CTTTTAAGTTAGTTTTTTTTTTTTTTTTTTTTTTTTAATTTTTATTCATTTATGATAGGC
ACACAGTGAGAGAGAGAGAGGCAGAGACATAGGCAGAGGGAGAAGCAGGCTCCATGCAGG
GAGCCCGACGTGGGATTCGATCCCGGATCTCCAGGATCGCGCCCTGGGCCAAAGGCAGGC
GCCAAACCACTGCGCCACCCAGGGATCCCTAAGTTAGTTTTTAGTTGAACTGTACAAAGA
GGAGTTGGAGTATATCTGAATTCTAGTGTCTTGTATCCTGTTTCTTTTTTCTTGGTGTTT
GTTAAGTAGACTCCCTGTCCAGAGTGAAGCTCAAGACCTGAGTGAGCTGAGATCAGGAGT
TGGTTTTAAGATTTTATTTGAGAGAGTGAGCACATGAGCTGGGGGAAGAGCGAAGGGAGA
GGGACAGTCAGACTCCATGGCCTATCCCAGGACCCTGAGGTCATGACCTGACCTGAAATC
AACAGTCCAGCATTTGGTGTACTATGCCACCGAGGCATCCCTTCACCTCTGTTTCTAATT
TAATGTGTTCTGTGGGAAACCTAGTAACAAAAATTCTTTTCAAATCTTAAAAGGGCTATG
AATGATAGTCAAATATTTGAGTGTTACCCACTTGGCACATTTAGGTCATTTAAGAAAAAC
TAAAATATGAAATAGTAACTTGAGTGAATATTCTTGGATCTGTAGCAGCTTGTCCTGAGA
TTTTGCTGTGATTTTTGGGACACGTGTACTCTTCCTTTCTTGAGTAGTTGCCACTTAGTA
ATGAATGACAGGTTCTTTTTTCTTGATGGCTCAGGTTCAGCAGACTGTACAGGATCTCTT
TGGCCGAGCCCCAAGCAAAGCTGTCAATCCTGATGAGGCTGTGGCCATCGGAGCTGCCAT
TCAGGGAGGTGTGTTAGCTGGTGATGTCACAGATGTGCTGCTCCTGGATGTCACTCCTCT
GTCTCTGGGTATTGAGACTCTGGGAGGTGTTTTTACCAAACTTATCAACAGAAACACCAC
TATTCCAACCAAGAAAAGCCAGGTAAGAGTCACCTACTCCTACATTGTCATGGAGATACT
AGGGTCTCTGATAGATGTGATTGCACCCCCTCTTGTGGAGCTTTTCCTAGAATACTTTGC
TTTCTGTATTGAGAGCCCATAATAGTTGAGTGGGTGCTAAGAATCTTGTTTTTTGGGAGG
TTTTTTTTTTTGTTCCTGAAAAAGTTATTACCTGTCAATAGTGATGATTGTAGGGAGGGT
ATCAGTAGTCTCCTTCACCAGATTAAAATAACTTTACAGAAGGAACTTCATCATTTGGGA
CTAAATTCCCTGTGTTCTTCTGTACTGTTCTCTTTGGCCCGGGGCGCAATCCTGGAGACC
AGGGATCGAATCCCACGTCGGGCTCCCGGTGCATGGAGCCTGCTTCTCCCTCTGCCTGTG
TCTCTGCCTCTCTCTCTCTCTGTAACTATCATAAATAAATAAAAATTAAAAAAAAAAAAG
AAAGTTCTGTACTGTTCTGAAAGGCAGTAAAGAGAAGGAACTGGCCAAGATTAGGGGAGT
GTACTTGTTTTATGGGTGAGTGATGGCGGGGGTTCCTTAGATACCAAGCAGGGCTAGTTG
GACAGTGGCTCACTTTTTTTTTTTTCTGTCTTAGATTAAGAACTATTTCTTGCCTTTCCC
AATTTTGAAGTTTTTCTGAAAAGCTGTTAATATCTAACGGATATTGCTATTTGTTCAGTG
ATATATTGCCAACACATCATTCTGAAGAAAACTGTGGTGACTTCTGTGACTGAGTATAAA
ATAAATGACATGGTCTCTGATCTATCTCTTCAGATGAGCATGTTTCAACATTTCATCTTT
TTAGCTCCTCCTCTTGAAGCCTTTTTTGTGAATGCTCCTGCTTTGTATAGTGCATTTACT
TAGTTGAAACAGTAGCTATTGTATACCCTTTGACTATGCTAATTAATCCTACTCCTGTTC
CCTGCAAAGATTTAATAAGCCTTTGTTCGGAACATCCTGCGCCTTGGACTCTAAAGTGTT
GAGATGTGAATTTCTTTCTTTGGCTTGCACTTTATATAAGGGAATTAGCCTGATCAGACT
GCCAATCCAGAGAATTTCTTTCTCCCTAGGTGTTTTCTACAGCTGCTGATGGTCAAACTC
AAGTGGAGATTAAAGTGTGTCAGGGTGAAAGAGAGATGGCTGGAGACAACAAACTTCTTG
GACAATTTACTTTGGTGGGTATGAGGAATCATGGATAATATATTGCTCATTCCTTTTACT
ATACAATTAAACTATATTTTAACCCTTAATGATAACCAAAACACTAAAACACAAGGACCT
AGTCTGTTACCTTAGTTCAATGTACAGATGAATTCTGCAGCTGGATACCCATGGCTTCAA
TTTTTACCTGAAAGTCTTGTTTGTTCTCTGTGTCTTAGGAACTTCATCAAGAAGATGATA
AATACAAGAGCCAGGAAAATATTCATAAACAATATTAATCAGGAAAAATTCCTGATTGCT
AATTTAAGATATATGCTATTGGCTTTTGTCAGCATTGTTTATTAGTTCTTGGGAGATGAA
AAGTCTAGGAGACTTTTCCTTTCATTCACTAGGTCCTTGGGTACATAAAGCCATTATGGT
TACTTGCTGTGGTGAATCTTTTACTGAGCCCTGTTTATTTCAGGTAGCAATGAAACTTCT
ACCCTTATTAGAAACTTGTGGTTTTGTACATTTTATTTTAACTGTTGTTTGTTCCTCCCA
GGAACAAGTTACTTGTTTACCCAGAAAACTGTACAGATATGGAAAAGAACACGGGACCTC
TTAGGGGGGAAACTTAATACTGTGTATTTATTTTAGATTGGAATTCCCCCAGCCCCTCGT
GGAGTCCCTCAGATTGAAGTTACATTTGACATTGATGCCAATGGGATTGTACATGTTTCA
GCCAAAGATAAGGGTACAGGACGCGAGCAGCAGAGTAAGTACTCTTATTTATCAGAGTGT
TAGAGTGAGGCGAGGGACCTTGGAGTTCCTCTGGTTGAGAACTACACCTAATAGGTTGTA
CATATCTTTACCCCCAGCCTTAGGGGAGAGGAGTCAGTCCTTTTTGCCTCTTTTCTCTTG
GATTGGCAGGTTCAAATTAACAAGTGTGATGTTTATTACCCCAGATAAGCAAACACTGGG
CTTCTGGATTATTGAAGTTTTGGTAAGCAGGCAGGTCAGTTTGGTCTGTGTATTTCAGAC
CCTTCATTTTCTTTTTATTGTAGGAGTACAAAGTTTTCCTGTCTTTTATAATACACCTCA
AAATCGGCTACTCTGAACAGAAATACTCATTTTTCTTAATACGATAGAGTAAGAAGCAGA
AGATTTTACTTGGAAAATAACAGGATGCCTTTTTTTTCCCCTCACTGTAGTTGTGATTCA
GTCTTCCGGTGGGTTAAGCAAAGATGATATTGAAAATATGGTTAAAAATGCAGAAAAGTA
TGCTGAGGAAGACCGGCGAAAGAAGGTAACTACTTTCTGCCTCTGCAGCTGGGAGGTGAA
AGTGGGAGTTTGGAGATGTATCCTTGATCATCTTTGTAATCTTTCTTGGAATCTATCCTC
CTTCCCTCTTTGCTGGAAGCTTTTGTGTGGAATGCTTCTCTCAGTCTTTCCGTATCAGAA
TTCTTATGTTCTACTATCTCAGCTAAAATCCCTTATCGACATCCTAGACTACTTCAGACC
ACAGTAATTTGTTTTTATTCTGTAACTGTATGCATCATTTAGCATGTGGTCTTGCTCAAT
GGGGACATTCAGCCAACTGGTTGTTTGGGAAGTCTTTATACTAAATTTCTAATTTCTCTT
AGGAACGGGTTGAAGCAGTTAATATGGCTGAAGGAATCATTCATGACACAGAAACAAAAA
TGGAAGAATTCAAGGACCAATTGCCTGCTGAGGAAGTGAGTCTTCTTTTAAAATAGTAAA
TGAAGTTAAGAGGTAGTGTCACCAGTGTCAATGAAGTTTGTTTTTCTGTGTGGGTCTTGA
TAGGCATTTGGCAGTAGTTTTTGTTTCTGAGAGGCTTTATATTTCTTTTTCATATTTCAC
ATTTCATGAATGTTTATTCATTTGGGGCCATTTCACAAATAAATGGAGGGGCGCTGGGGT
GGCTTAGTTGGGTAAGTGTCTGTATTCAGCTCAGGTCATGATCCCAGGGTCCTGGGATTG
AGCTCCACATCAGGATCTCTGCTCAGCGGGGAGTCTGCTTCTCCCTATGCTCCTCCCCCC
TGTTCATGCATGGACGTGGGCGCATACGTGCATGCCTGCTCTCACTCCCAAATCTTTTTT
TAAAAATAAGAAAATGTAGATAGAATTCTAAGGACAAGTTCTGTCAGTGATAGGAATTTG
GGGGTTTTTTTGGTTTTTTTTGTTTTGTTTTTTAGATTTTATTTATTCATGAAAGACACA
GAGCATGAGAGAGAGAGGCAGAGGGAGAAGCAGCTCCATGCAGGGAGCCAGACATGGGAC
TCCATCCCGGGTTTCCAGGATCACAACCTGGGCTGAAGGCGGCGCTAAACCGCTGAGGCA
CCTGGGCTGCCCTAGGAATTTGTTTTTTAATGTTTCTGAGTATTACTGCTACATAAAATG
GGATAAGAAACCCAGGGAAAAAAAAATTTTTTTTTTTTTAAGTGCAACAAGCTGAAAGAA
GAGATTTCCAAAATGAGGGAACTTTTGGCTCGAAAAGACAGTGAAACAGGAGAAAACATA
AGGCAGGCAGCATCTTCCCTTCAGCAAGCATCACTGAAGCTCTTTGAAATGGCATACAAA
AAGGTATGTGGGCTGAAGGGCATTTTGCGCAATGAATTTGCCCCTAACTTGATTTCAACA
GAACTGCTGTTGATTATTATCATTGATGGCACTGTATATGGCCATTTATGAAACAGTATT
GGAGTTGGAAATACTTTTCCTGCCTTCTTGACTCTGCTTTGGAAGGGAGGGTAATAGCAG
CCAAAGGGAAGGACACACAGAAGCCAAAAGTAGTGTGTGTACAAGGAGGGAGGGAGTGGA
AGAGGCAGGATATGCCTCCATTTTTTAGTTTATCAAAGTGCAAACTGTCAGCCTTAACAT
TAAATGAGTTGCTCTCAAATATTTTAACAGATGGCATCTGAGCGAGAAGGCTCTGGAAGT
TCTGGCAGTGGGGAACAAAAGGAAGATCAAAAGGAGGAAAAACAGTAATGCCAAACTTTG
GAGTCGAAATATGATGCTTGGGAGTGAAGGGACTTCTGAGCAGAAATGGGCAAACTTCAA
TCTTTTACTGTGTTTTTGCAGTATTCTATATATAATTTCCTTAATATGTAAATTTAGTGA
CCATAAGCTAATGATCATTTAATGAGAATTTCAACCGTACAAAATTCAGAGTACTCTGTA
GTCATTTATCATCTGCATGTAAAGGGAGGGGAAGATTTGTTGATCATTATAAAAACAATG
TTTTGTGCTTTAGTAGCTGTATTTTCAAGAGGTGAAACCATACCATTTCTGAGAACGATG
AAGGTAGTCGGCCACACACCTGGAATGAGACCATATGGGGATGAGATCTTCTAGTGAATT
AAGAACTACTACACCAGCCTATGTGTACATGGGATTCTTCATGAAACTGAGGCCTTACAA
GGCAAGCCAGCAGTGCCATGTTGGAGGGTAGGGCAGGAGTAGCTAGATCAACAGAAAAAT
AGCTGTTACGTACAGCTTTGTATTTTTAAAGGTAATAGGGCTCCCTGACTTTCCTAAGGC
ATATTTTTCTAGCTGCCTTCTGGCCTGTGTCTGGCTTCCTTGTTGATGGCTTTTTTTGAT
CATTTTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATAAATCTGAAAAAGTATCTTGAT
CTCTTGTTTGTGAGAAGTGAGGCTCTGAGATTTAGCTTCAGGAATAGGACATGAATACTT
CCCCAAGTTCTCTGACCTAAAGCCATTCGAGTGGAATACAGGATTTTCTAACATCAGCTG
AAAATACAAATTCAGGATTTGGAAGGGCTGGTTGATGAAATAATATGCATTAATTACCAA
GAACAAGTCCATCAGGAACTGATGCTTCCAACATTTCTCCTGTTTAATCTTGAGTGAGTT
GCCTTGTCCCATATCCTGTCATGTAGTTGCAATTACATGCGGACACCTTCAGAAGAAGGG
TGAATATCTTTCCTATTTATTTAAATGTGAAGAATTCTTTCCAAAAGTTTTCCAGCAGAT
CCCCCCCCCCCCCTTTTCATGGATTACTGCCATATACTGTGCTCAAAGGAATCTACTGTT
CAAGAACATGGGCTTAGATCCTGTTAGATGTAATGCCTCCTTTTATTTTGTGATATCTAG
AAATTGCTGTACAATTAAGTCAGTATAGTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 2525..2583, 2830..2917, 3942..4123, 5498..5622, 6177..6250, 6333..6439, 7160..7322, 7802..7894, 11541..11750, 13894..14121, 15209..15313, 15936..16053, 16490..16584, 16922..17014, 17742..17882, 18210..18471
1001..1081, 2525..2583, 2830..2917, 3942..4123, 5498..5622, 6177..6250, 6333..6439, 7160..7322, 7802..7894, 11541..11750, 13894..14121, 15209..15313, 15936..16053, 16490..16584, 16922..17014, 17742..17882, 18210..18284
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved