Canis_familiaris Locus ENSCAFG00000020136
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000020136
Canis_familiaris
ENSCAFG00000020136
9
SNORA65
3891..4020
5907
TGCAGAGCTGGCTCAGGACCATCTTGTCATCTCACCTGCCAGCAGTGATGGGGAAAAGT
CTAAACACAGCCGTCTCCCATTCCTCCCTGATGACAAGCTCTTACCCATCTGCTCTCCAA
GGACTAACACCCTCTTATCCCCTTCCCCAAAGTCAAGCCCACCCACTACCTCCCCGACAG
TGACCATCCTTTCTCCATCCCTTGCATAAGATCGGCTCTTCCCAACCTGCTCCCCGGTGT
TCACTCCCCTCATCCATTCCTTCCTCCAACGTCCAGCCCAATGGGGAGAACCACACCCAT
TCTCCCCGGGCTGGAGTGGGGAGAGCCCCACCTGCTTTGTGGGTGGACAGGTCACCACTC
CTTCCCTCGGGTGGATCTGAAGGCAGGCAGATCACTCGTAGGGCTTGGCTCGGTCATGGA
CACCGGGTCGCAGACCACCGGGCACGGCCCGGGACCCCGCGCGAGCCAGAGTCTGGTCTC
CTCCAAATGCAAGAGCTGGGGACGGAAACTCGGAATCTCAGAAAGTCATGCAGACCAGGA
TGACGAAGTCGGAGACCGAGAACCGCAGGACCTTGGAATTGAGAGTTGGATCAAATTTAG
ACGCGAACAAACTGTTTCGATAAACAAAATGCACACATCACGAGGAAGCTAAAAGGGGGC
CAAGGGTCTCGGAATTGGGGTGCGGACTCCTCAGGGGAGGGGCGGGTCTTTGCTATTGGG
CTACAGTGACCATAGGGTGACTCTCATGACAAGGGAGAATAGAGAACAACGAGGCCTGAA
AGCAGCCTTCTGTGGTCTGCACCCCCCCCCCCCAGGCAAACCTCTCTGAACCCCCCCCCA
CTTCCGAACCCCTACTCACAACTCACCGCAGAGCAGGGCTCTCCAGCCGTCAGCATCAGG
CGCCTGCCCACAAGCAACATGGCGGCAAGGGCGTCGCCGGGAGGCTGGGCGGAGCCCACG
GTTCTCGCGAGAGTCGCGCTTTTCTGCCTATATCCGGCGCAGTCAGAAGCGTTTCCGGTC
TTTTGGCTTTAGGCTCGGAGGAGGCAAAGGTGCAACTGTCTTCGGTCGTCCCGAATCCGG
GTTCATCCGACACCAGCTGCCTCCGCCATGCCGCCTAAGTTCGACCCCAACGAGATCAAA
GTCGGTGCGTGCTTTAGATGTGGCTGGGGCTGCAAGATGGAGCATTCCTCCTCCCCGCAG
CCCGGTGGGCCCCCGGCTCAGCCGCCGTTGCCTTGCCCACGTCGGGCTTTTAAGGCGCTG
CCTGCTCGAGGCCGTAACCGTGCCGCGATGAGGGTTGTGAGGCCCTGGCCAAGTGTCTAA
CTCTCTGGGCCTCAGCTTCCCCACGTGTAAATGGGGAGGGAGGACCAGACGACCTGTGGT
GGCTTTGCGGCCCGCACGCCTAAGGGTAAGGTTTGTGCCCGGGCGCTCCCCGCTGCGCTG
GGCTGGCCGGAGGCCGGGCTGCCCAGGGACTCCGGGGCCGTGGCCGAACCCGAGGCCGCT
GGCCCACGTGGCGCATGGGGCGGTCCACGCCGGGAGGCGGCTCGCCAGCTGCGGGTTGGG
TGGCCTTCCTTGTCTCCGGTGAGGCTCTTGGTGCGGCTCCGAGCATTGACCAGTGATGTG
GGCGGCCCCAGAAGAGGCGGAGGGAAGGAAGGCTTTGGCGCGGGGGCTCCCTCTGCAGCG
ACACTCCTCTTTTCTTTCCACCAGTGTACCTGAGGTGCACCGGTGGCGAGGTCGGTGCCA
CGTCTGCCCTGGCCCCGAAGATCGGCCCGCTGGGTCTGGTAGGTCATCCTGGTGGAGGGC
GGTTTCGCTCTGGCTTGTGCGAACAGGCGGGATCTGGGGTGCCTTGGACGTTGACGGGGT
GGTAACGCCTGCTACGCCGCTGAGCCTCCAAACCGGACGTGCTCCCGTAGCAAGGTCGTG
CTACATTGAAGTGGTGACCTCACTCTCCAGGGTTGGGGTCTTACCTGCGGCCTTCCCCGT
TCTTGAGGCACGGGCCAGGGGTCTTGCTGAAGGTTTAGAAGAGTAGCTTAGAGACACTGG
ACAGTCTAGTTAGCTTGTGTTTTCTAGTCAGGGAAATGGGCATAACTGTGAGGTTAAATA
TCGGAAGGGAGGATTAGATGGGGTGTCAGTTAAATCCTGGTGAGCTTAACATAGTAAGCT
TGTGTAACCTACTTGTTAATAGGACCAGCTTTACTGATGACCACGCGATTTACCCATTAA
TCCATTTTATGCTTTAACTGTGCTTGCATTTCGCCAGATATCGTTAGGCCTTTATTCCTT
TTTTTTTTTTTTTTTAGGCCTTTATTCCTTGAACTTTGATCTCCTGAACCAAACATTGTT
CCCATGTTGTCTTGCCTAACCAGTGCCTTCTTTACTGCTGGTCCTTGGCTCTCAGCTTAG
CTGGCACCAGCTGAACAGCTTTCCTCTTTAGGCTGATGGTCATTAGGAAGTCTAGTACTT
GCCCAGATCCCATCCTTGCAGAAACCTGGTGTTTCTAAGATTCTCCTGATTTGAATGTAA
CCAGTGTTGGACATTCCCACGTTATCACATGGTTTCTTATGGGAGGGTAGGTAAGTAAGG
GACTTTGCCATCTTATGACCCTGGGCCTACAGCCCCAAACAAACTTAACCCCTAGCTTCA
TCTCCCCAGTGTATACTGCTGCAGTAGCTATGCCTTGATTTGGTATGTGCACTTGGCTTT
AAACAGCGCCCTGTGTGCTCGATTGGATAAGGAAGGTTTGGGGTGTTGCCAGGTGAGAGG
GATGGGTTTTCAGACTGTACTTCAACTTAGTGCACAGTGTGATAAATAATTTTCTTTCTA
TAGTCTCCAAAAAAGGTTGGTGATGACATCGCCAAGGCAACCGGTGATTGGAAGGGTCTA
AGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGGTACTTGGTTTGAGGGGG
AGGGTAGAGGTAGCAACCCTTTGGGATTCCTGGGTGGAAGGTTTTTGCCACCTGACCCCA
GTGGTGAGCTGAGGGCAATTTTAAATGTGGGGAAGGCTCTTGAGAGCATGGATCAAGAAA
GAGCAAGGATGTGGACTCAAATATTAATTAGCTCTTGTCACTTGTGTGACATTGGGTAAA
TCACTTTGTGTCTCTTAGGCTTAGACATGTTTTAGATTGTGAAAATAACTGAGAATGCAC
AGCAAACCCAGTGTGGCTTGTGTTTTTTGAGAGCCACGTTGCATGGCAGTATTGACAGTC
CTCACTGTAAGGTGGAGTAGAGCTCATTCAATGGAGAATCTCTTCTGCAGATTGAAGTGG
TACCTTCTGCCTCTGCCCTGATTATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGA
AGCAGAAAAACAGTGAGTGGCCTTTTCCCTGGTAATTTGTGAGTGGTGTCTACCCAGTGA
TAACTTCGCTGCATGTGTTCCCTTTAACAAAACCTAGGGGTGGCAGAGGGATCTGATAAG
CTGTTGGAGAGCCAGGCACTACCAAGAAGTGTCATGTGGCTCTCCCCAATCCCTAGTAGG
GGGCTGGCCGTACTCTGTATGCAGGAGGGAAATAGTAATTTAGTAGAATATGGGATAATG
ATAACCAGAATCCGATCACTTCTGAGCTGGGTAATGCTCTGAACAGCTTGGGCCCAGTAA
AATAAACAGGTCTTTTTTTCATGTTTAGTCTGGGCAGCCCCAATGGCCTAGCAGTTTGGC
GCTGCCTTCAGTCTGGGGTATGATCCTGGAGACCCAGGATCCAGTCCCACGTCAGGCTCC
GTGAGTGGAACCTGCTTCTCTCTGTCATGAATAAATAAAATCTTAAAAAACAAAAATGAT
AGTCTTATGTGTCTGTGTAAGATGACCAAAGACTTGATTTTGCCCCAGCCACCCGCCACT
GCACCTGATCAGTTTTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAACCCCA
GCTTAGGAAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGC
CTGGAAATTAAGATGAGGCAGCATATTACGTGGTCTGCTCTGGCCTTGGGTTGTGATAGA
ACTTAGGCTGTTTTTCTTTTCTGCAGTTAAGCACAGTGGAAATATCACTTTTGATGAGAT
TGTCAATATTGCCCGACAGATGCGACACCGATCTTTAGCCAGAGAACTTTCTGGTAAGTG
GACAACATGGAACCACCTTAATTGTTATACGGGGTGTATTCACCAAGGGTAGAATTTCCC
AGTTTGAAGGGATGTAAGCTGTAGTTGGGTTGCAGGGTCTTGTGGGTTTGAAGAAATGGA
TTGACATCGGTGAATATTTGGGGCTGGATGTGTTTAAATCTGGGTATCAAGGGACCCATG
GAGTCTTTGCATTAAGAACTTACATACCTAAATCGAGTTCTGAATTGTGGATTAGAGCAG
CAGAGATGTCACTCCATAAAATAGGGTTAATTCCTCCCTACCTGCGATGAAACTCCCCAT
GGTATTTCCCCATGGTATCCAAGGACTGAGGGATTGCAGTCCCTCTGATGGCAACTTTTC
TTAATTATAGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCTGTGGGCTGCAATGTT
GATGGCCGTCACCCTCATGACATCATAGATGACATCAATAGTGGTGCAGTGGAATGCCCA
GCGGTGAGTGACTTCTGTTTCATTTGCCACCTAAAGCAGGGTGAGAGCCGGAGGAAGGCT
AAAGTATGCATAGAGAGGCTGGACTAGTTCTAAATAGAAATGGTCAGTAGTGGGTTTGGG
CTATAAGATTTTTTTTGTCCTACTGACACATTTTTTTTTTCTTTCCCACAGAGTTAACTA
CAAAGGAAAATATTTCAATAAATGATCATTTGACAACCAGTGGACCTTTTGATGTGGCCT
CTTGCTTGGGGAGGCTAGCTCCTCTGTGGTGCCAGGGTGGCAGAACTATAGAAGGAGCCG
TTTGGGTAACAAGCTCCTCCTGGGTGACAGATTGCTGCCCTGTATGGAACTAGAGAGAAG
ACACCTAGAAAGTAAGTTTCAGTGCTTTTTGTAGGACACAGATACACACTTTACAAAATA
CTTTGCCAAAAAGAAAACTTGTACCTCAGTATGAATACATAGCAAGGAGTTTATCCCAGA
CCAGTTTAATTCTTGAGTGGGCTAGTGTCCCGTGGCCCTCAGTGCGAGCCGTCAGTCTGT
TCTAATGTATAGCCAGGCTTCAGAAGCACTGGTGGGAAATAAAGGAACCTGACCTTGGTC
TCAGCCCTTAAGGGTTATTTTCTAAAGGCATGTTTTTGCCTTTCCTGAGTCTGTCCTCTT
TCCTTAGTTCTAGTCCTTTTGACTCTAGTTCATGACTCCTTTTAGTGTGAGTGAAGGATT
GAACCAAGATACCTGGGTACTGGGGCAAGCTATACCTGAGCAGCTTAGAGGGGCTACAGG
GTAGAGGGGAGAGGGAGGAATTTAGGAACAATTAACCCAAGAACTTAGTTTCCTTGACAT
TAGTCCTATTCCTGCTGTATATAATTTTGTTAATAGGCCTCTAAAGTTAGGTGAGTTTTA
ACCCCCCACCCCATACAAGTAGGGTTGGAGAACTGTAGTGGGAAGGATAAACCTTCTAGG
ACCTGTGCTAAGTCACCAAGAAACCAAAGTCAAAGGCCTTGGTCAATGAAGTTGAGTCTG
ACTCCCAAGTCCAATGTTTACCTAATCCCAAGTCACAAGGGTTTACTGTTGAGACGAAGT
CATGCCAGTTATGCATGAAGAGGAGATGTCAAAGGCAAAACCCAGGACTGGGAAAGGGAG
AAAGGCCAATGAAAATCTTACTCTAGGGCAGCCCCGGTGGCTCAGCAGTTTAGTACTGCC
TTCAGCCCAGGGCCTGATCCTGGAGACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 1704..1777, 2823..2921, 3290..3371, 4106..4192, 4570..4682, 4851..4907
1107..1143, 1704..1777, 2823..2921, 3290..3371, 4106..4192, 4570..4682, 4851..4853
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved