Canis_familiaris Locus Q9XST8_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris Q9XST8_CANFA
Canis_familiaris
Q9XST8_CANFA
9
SNORD24, SNORD36, SNORD36
1582..1656, 2339..2414, 3143..3209
4593
GGTGGTGCGGCCCATGGAAGCCTGGCCACCTCACCGCAGCGGGTAACCGACCGGCTGGT
TCGGTCACCGGGTGACCCGTTGCCTTGGGGTGGGGGGAACAAGGCCTGGCCGCGTCGCTC
ACTGCTGCTCCGCACCACCGGCTCGCAGCCTCACCCCATCCCATCCCCGCCCCTGTCTCC
TGTCTCGGAAGGGCAGGAGCCGGCCCACCCGCCCTACCTTGGCGGTCTTGATGATCTCGG
TGAAGTTGTCCATGATGGACTTGACATCGTCCTTGAGCCGCTTGTTGTAGGACTGCAGCA
GCGTCTCCTTGCTCTGCGGCAGGGCTCTCTGCTGGGCCATGGCCGGGCCTCGGGCGGCAC
CTGCGGGCCGGGGTCCGGCGTGAGCGGAGCCACCCCCGGCCGCCGCCCTCCGTGCCCCCG
CCTCAGCAGAGCCTCGGCCTCGGGGAGCCCCGTCCCGGCCAGCACACGTGCGGCCCTGGG
CACACGGACGGGCCGGCGCGCTGGGCCAGCGAGCGTCGGCCGGAGGCCCGCAGACGCCCC
CCGCGCCGCCCCGGGGCCCGCTCGCTCCGCACAGGTGACCCCGCGCCCGCGCCCCCGACC
CACCCAGCTCGCGGCCTGGGAGCCACCTGGCAGCGGGGCAGGGAGGGTCACACCGGGGAA
GAGACGGCGACCCCGCCCCGACGCGCCGACGGCCCACCTACTCCGCGGAGCCCGGGGCGA
CCCGGCGGGACGCAGGCGGGAGGCTGGAGGCGGGAGGCGGGAGGCGGCAGGCGGCAGGCG
GACGAGCGCGCGCCCCTCCCCGGAAGTCCCGTCCCTGCTTCCCGCCCGCTCAGACCTGCC
GCGGCTACCGCGCTAGGCGCCGCCTCCTGCGGGGGCGGGGTGAGTGGGTGGGCGAGAGCG
GTCCTGTCGCTTTAAATCCGAAATCCCGCGCGGGCTCCAGTTCTCGCGATCTCCAAGGTC
GCCTACATATTGCCCACAATTCCCTTTTCTTTCTCTCTTCTCCGCAAGCCAAGATGGTGA
GTGATGTCGGCTTTCGTCGTGCCGGCGTCGAGTCCGGCTTCTATCCGCCGCCATCCTCCT
CGGGGCGTGGCCGTGCGGGGGTCCCTCCACCGCCGGGCGCTAGGGGAGCCCCCCGGGGCC
TGGCAGGGAGGCGCTGGGCCGTGTGTAACCCCAGTGCTGCCCCCGGGAGTGCGGGGCGAG
GGCCCGGGCGGGGAGCGCAGCGCCGCAATGCGGGGCTCCTCGGGCGCGCGCGGTTCCGAG
TCCGGGGCGGCCGCGGCTGCCGGGCTCACGTCGAGGTGTTGAGCGCCTGACGGCTGGCAG
CCTGCGCGGGGCCCCGCACGGCGAGGCGCGGGCCGGGGCTGACTGGGTCCCTCCCTTCTC
GCCCAGCCGAAAGGGAAGAAGGCGAAGGGGAAGAAGGTGGCCCCGGCCCCTGCCGTGGTG
AAGAAGCAGGAGGCCAAGAAGGTGGTCAACCCCCTGTTCGAGAAGAGGCCCAAGAACTTC
GGCATCGGTGAGTGCGGCCGGGGCGGGAGGCGGCCGCCTGGGGGGCGGGGGCGGGGCGGG
GCGGGGGCGCTCCCGGTGTGCGTGCAGGTGATGTGAAGGAATATTTGCTATCCGAGAGTT
GGTGATGACGCTTGAAACCACCAAGATCGCTGATGCACCCGCACCCTCGGGGGCCCTACC
GGCAGCGCCGCCGGAGCTTGAGCCGCGCCGACCGTGTTGCCCTCCCCTCAGGACAGGACA
TCCAGCCCAAGAGGGACCTCACCCGCTTTGTCAAGTGGCCGCGCTACATCCGGCTGCAGC
GCCAGAGGGCCATCCTGTATAAACGTCTCAAGGTGCCTCCTGCCATTAACCAGTTCACCC
AGGCCTTGGACCGCCAAACGGGTGAGCTGCTGTGGACAAAACCTCCTGGACAGGGGGGCT
TCCTGGGCAACGGGGTGGTGACCCGGCTGGACCCGCAGATGTTTGGGGGGCGGTGGGTGT
TTTCGAGTACGTCAGGTTATCATAACTTAGGAAATCTCTAGTTCCTGGGACCCGAGGGTA
GGGGGTGGTGCCGCTGAAGGGATCACTACACAGTGTGAGGGGACAGTGGCCTAGCGTGAG
GTCAGGTGGCACAGACCAGAGCCTAAAACACAAGCCTAAACCGTGACTTTTCCAGCTACA
CAACTGCTTAAGCTGGCCCACAAGTACAGACCAGAGACCAAGCAAGAGAAGAAGCAGAGG
CTGTTGGCCCGGGCCGAGAAGAAAGCTGCCGGCAAAGGGGATGTCCCCACTAAGAGGCCG
CCTGTCCTTCGAGCTGGTGAGTGGGCCCCTTCTCCAGGGGTGAGTGGTGGGGCCGGCTGT
TGACAATGATGCAGGAATTTCTTCACCTGGAATCTCTGTGAAGAGTAAAATCGAGCTTTT
TAACCCTGAGTCACAGCCGGGCCCAGAGTAGTAGGATGGCTTTTGTGAACCTAGCAGCCC
CCACGGACTGCTCAGGCTAATGGGTTCTGTGTCCTAGGGGTTAACACTGTCACCACCTTG
GTGGAAAACAAGAAGGCTCAGCTGGTAGTGATAGCCCACGACGTGGATCCCATTGAGGTA
CGTCGAAGTATCCACTATCGAGCCTAGATTGGGTCTTTATGTTGGTATCGGGAAGGCTAA
AGCTGAATGTTGTCCGGCACGTTGGGCCAAGGTGGGGTGACCGCTTTCTATTGAGGACGG
TACTGACGAGGGATCCGCGTGATAGCCATTACGATGATGTGGATTTCTTACTGAATTAAA
CCTTGAAGTGCAAATCCAGGAGTTTAATCCTCAGCAGTTGGTACAGAGTTAGGTTTTAAG
TTACCGTTTCGGTCAAAATACACTCTAGAGCTAACTCTGTCTTCCAGCTGGTTGTCTTCC
TGCCTGCCCTGTGTCGTAAGATGGGGGTTCCTTACTGCATTATCAAGGGGAAGGCCAGGC
TGGGGCGTCTGGTCCACAGGAAGACCTGCACCACAGTCGCCTTCACACAGGTTAACTCGT
AAGTATACAAGATGGCTCCAAACTCCCAACAGCCAGTGGAGGTCAGGGACCCCCCCACAC
ACCCAGTTCCCTTAATTTCTTTAGGATTTTACCTTAAAGATCAAACGTCATACTTTTCTA
AAGGAGCGTGTCTGTCTAAATCTTTGCCAATGATGGTTACGAATTTCTTCACCTGAACCA
GCCATGTGGTCATACTGTATCTGAGGCAAAGGGCTTGTTGGGTCAGCAAGTCCTCCCTGG
TTTTTGGAAGGTAACTGAGAAGAGAAGCTAATGACCCAGATTTTCCCCTGCCTTTTTAGG
GAAGACAAGGGAGCTCTGGCTAAGCTGGTAGAAGCCATCCGGACCAATTACAATGACAGA
TACGATGAGGTAAGTCATTGGTGAGAGGACTGGCTGACTCTGCCCTCCTAAGCACTCCAG
TAGGAGACCGCATGAGCTAGCGTAGTGGGAGCCTCGACGGCAGATGCTGACCCCTCTGTG
TCTTTGCAGATCCGCCGCCACTGGGGAGGCAATGTCCTGGGTCCGAAGTCAGTGGCTCGC
ATCGCCAAGCTGGAAAAAGCAAAGGCTAAAGAACTGGCCACCAAGCTGGGCTAAGTGGAC
GCTGTTGAATTTTCTGTACATAAAAGTAATAAAAGGTTCTCTTTCAGTGAGTGTCAGTGG
GTATTTGGGGTTGAATATACTTGATCTTGTTACTTAAGTTAGAGTTGTTAAAATCCAGGA
TTTGGATTTGGTGCAGGGCGGGAGTTGGGGGAAGAAGACGTGCTATGTGGGGGGGTGCAA
GGTGATGGTTCTGAACAAGCAGCTCACCCACACATTGGTACGTGGTACTTGAACCCACTG
ATTATGATCAGATTGTTGCATAGGTAGAAAAGGCAGGCACGGCATGTGTACTGTATGGAT
TTATTCATACCACTCATACCTAACCCACGTAATCTTTAAAAAGAAAGCTTAGAAATCTGT
GACTTAGTGATTATTCAGGAGAGGAGCGGAGCTACTTCAGTAGATCATACACCAGGAGTC
CGACGTAGGAATTTCTTAAACCATAGGTAGGATGTAGCTGCACAGAGGCCATACCTTGGG
TTGAAGAAATGAGCAGTCAGGGTTTAGAAGGGGAAGAGGAGGGAACAGCCAGAGGCAGGG
ACTTACCAGGTGAGGATGTACTGCATGTGTTCATTCCTCAGAGTGACTCGCGTTTGCCCT
CCAATGGGTCCCCCAGGGACTGTGCTCTCTGCAGAGACAGTGGGTTTAGTGTCCACAATC
CCTAGGGCAGTTTGGCCAGCTGTCTCCATGGGGCCTTCCAGAGCTCTTTAGAGCTGTCAA
ATTCAGTGAGGCCTTGGACCTGTAACTAGACCCTGTGGCCTCCTTTCCTTAGTGCCCACC
AGACACTCCTCCCACACGCTAAAATGCAGACAGCAGGAAGTAACGGCCATGTCCAGGGCT
GAAAGAAAGGCAGGCCGCCCACAACGTACGGAAGTCTGCATCGATGAAGATGGGGTCTGC
GCCTGTGAGCCTGGCCATTGCCTCCAGGTCCCGGTAATGCCAGTGGTTCCTTTCTGGGTT
GTTCTCTGGGACAAAGGGCTTCCTGGTTTCTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1386..1506, 1731..1880, 2155..2295, 2497..2576, 2867..2997, 3299..3368, 3489..3593
1013..1015, 1386..1506, 1731..1880, 2155..2295, 2497..2576, 2867..2997, 3299..3368, 3489..3590
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved