Canis_familiaris Locus RPL23A
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPL23A
Canis_familiaris
RPL23A
9
SNORD42, SNORD42
1513..1579, 4107..4171
5623
agaccatcggagaagcaaaccgaagcattcctaaaacttgttctgtgtggggaactgaa
tttgaggatgccaacatgactggagcagggggagggaagactacttaaagagaggggact
atgaatgaaattactcacgagaactagcaagtcctagtgaaatcagtgcaacgggtgttt
ttaatattggtagtttaaagaatattatcgggaaaacgcacgacatctaggactatcaca
ggtaaagaggggcagatacggccaccttctacctcctatgacactttcctcttctcctct
gcctgactcgtctttttctgcgaccaaatcactgtgttattgataaaccacgtcgccgct
ctggacctaaatttccacagaagttgtttgagggtcttggaccagataattaaagtttgt
tttgttttgttgagagagtgcacacaagccggagtagggggccgcagaggggagaagtca
gatctttgctgagcagggagccctatgggggtctgcaccccaggaccctgggatcatgac
ctgagcagaagtcagaggcctaacctactgaaccacccaggagctcctgtaccagacaac
ttctgctctaacgttctagaactttgcttcactctccctgagtcaacctaattatattta
gctcagttttcagtgttactgtctcctgaaactgcaatactttcctcaaaatgggaagcg
ctcaggatcagacgccagctgcagctggctacacgaaacacatccacgaccttagcaaat
aaacataataaaacgtgcctccaaaaaactacaacccccaagacactttagactcttttg
cgggaaggggtggagcatgcttaatcactctcgcgagggcattaaacttaactactattc
ccagagggcgctgcgctacagtttatccaatcagctttaaataaaaagcatcgcgagtct
tcggtgagactgcgctctataagcccgtggaaacgagcctgGGAAATCCCTTTCACGAAG
ATGGCGCCGAAGGCGAAGAAGGAAGgtgtgtgttcgggctggggaaagagggttatcacg
gttagctggcgtggggtctcttcggaatgaacgaactgggaggacagcggctaggctaag
ctttggggtgtcctctcccgagctgcgtgtcgcattccgccatgccacggtgcgtgtgta
cccagcctcgtgggctaggctcttctgaggtggtttgtggaggcaagcctggccggcccc
acctgtcgggggttgccagactgttggctttggggaactacttatatccaccggccggag
ctccgtgtctccagacctgtaaaaaactagcctccaatttaatttcctttttttttcccc
cgtgttttaggcggtgctatataggtaaataaaactgctaacacatcttgtcagatatca
agcgttcgattatcgttagttcctcttttctgcgtcgtattcctggacttcttcccaagt
tcgaaccagtatcgtgcatatgatggaaaaatcttaatctcctgagacttgtgatgtctt
caaaggaaccactgatgcacgtgtggtctggggcgcccgctaggacggaagtgattgttt
tctgaatcccgagccctaattttctttctttctctcagCCCCTGCCCCTCCCAAAGCCGA
AGCCAAAGCAAAGGCTTTGAAAGCTAAGAAAGCGGTGCTGAAAGGCGTGCACAGTCACAA
AAAAAAGAAGATCCGCACGTCACCTACATTCCGACGACCCAAGACCCTGCGTCTCCGAAG
GCAGCCGAAATATCCTCGAAAGAGCGCCCCCAGGAGAAACAAgttagtaatgccctttcc
tgtgaaaagatgttgggtaaccattcgtaatttggaaacttaccaaacctacagcatggg
ttctcaaatacatgttggtacctagtgtgtgtcttcctaaggggagtgtgaagggattgt
tagtgccccatttaagaacaagaagagacggggatccctgggtggcgcagtggtttagcg
cctgcctttggcccagggcgtgatcctggagacccaggatcgaatcccacatcgggctcc
tggtgcatggagcctgcttctccctctgcctatgtctctgcctctctctctgtgtgacta
tcataaataaataaaaattaaaaaaaaaaaaaaaaaagaacaagaagagacgtttaacta
attgtcaggttaattattgttcttatatgaccaggatttttatatttttttaatttttaa
aaaacgcctattcactagagatacagagagcagcaggcaccctgagggagcccgatgcag
gcctggatcccagaatcctgcaatcatgacctgagccaaaggcactcaaccactgagcca
cccaggtgcccaatgattagggttttatttttaagattttaattacttattcatgagaga
taccagagagagccacagaagcaggctccatgcagggagcccaacgtgggtccccattct
gggtctccaggatcacaccctgggctgaaagcggtgctaaagcgcagagctatccgggct
gccctgattagggttttaaactccgttttcttggagtgtaaaaagtaggactttgataaa
tgtattttgttttggagttccagatttagttattcattgtgcctattgctggaaggaata
gtcctaacaggtgctgattctagattgataaggacacttataataaccaaatggacatag
aaggcctgcaacagtgtatgtaaaaattctcatttacactcaagaaataggagggaatag
gcaaaagattagggtctttgaagtgttttgtagtaataagactgactttaggggccacgt
attagaacaatagtagtaactgccaccttctatttcttaaaaaaaaaaaaagaaaagaaa
agagtgatagagtgggttgtgtccgtggaggaaagcactttttacccccatttagactta
ggatttaatgtgatgagaggttgagacctgatatctagctttaagacaggaacgtaatgt
ccagatgaacagagacttgcttttctgaatttcagggggaaaggtgtgtggtaggtatgg
tcaagccattgtaagtttaacttggactataaataaaagttgctttcattcattggtcct
caaaccagtttcagcaactagagggggcagaaatgtctatctcatctcctagtgaagcac
taatgttctttggaactctactctgggtttcaagattccatagtccagctttatgctctt
gaagtaagttgtttactctctgaagcctcaaattcttttagaggtttgcccttcaaaacg
ctaaagtcaaagaatgaagggggtttactcagatgattcttcaatcacttgaaagtcctt
caagtggaagagagtgcacaggtctcccaagtttcagggtgcagatgatgacactgttta
gcgaccaaagtctgacaaaaatgattgctacttcattgtctgatgcacctgggctcttct
ggcttcaggctctgaaagagggcctatcttctcttttatcagacccaggccagctgacac
cattttgcctcttctccagGCTTGATCACTATGCCATCATCAAGTTCCCCTTAACTACTG
AGTCAGCCATGAAGAAAATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTCAAGG
CCAATAAGCACCAGATCAAACAGGCTGTGAAGAAGCTCTATGACATTGATGTGGCCAAGG
TCAACACCTTGATCAGgtgagtagggccttcatcaggagccaggaaacctacatggagtc
aggtaggtttcacagcttttgagccttgagaaatgagcagcttttgctgtatttctatgt
ggtatgggcttttgaggatacattagctctcctgcctctaggacttgatgtatggtgttg
gctttcttgattcttacacctttagatagacaggccctagacccaatttatgtcagatta
tctgcacttaagtcttaaaatgtactgtggtggtccccacaaggggacttggcttcatat
gtggtttggtggcatccctagcctcttatgcaaatgatggaaaagtcactatttaggaaa
gaatgacatgaacaaaggaactgctgatgtgccagaaagactagggggaaagggaagggg
ttaggggcagtaagggcaagaggaattaagacatccttcatcctagGCCTGATGGAGAGA
AGAAAGCATATGTTCGACTGGCTCCTGACTATGATGCTTTGGATGTTGCCAACAAAgtaa
gcttccttttctgtgaactcacccactgcctgggtccaagtgatggctcttttggtcatt
aataagtgaccaaaaaaaaaaaaattgtgtccaaaacatgacttctcactggtcttaact
gactgcaccccatatccttaataggccctgcttcacctcattttgctttttaactgtgac
ttttcagctaatcttcacatttcagctcctggtaatgaaagctccccttttgtttttcag
ATTGGGATCATCTAAACTGAGTCCAGCCGGCTATAAATCTAAATATAAATTTTTTCACCA
TATAtgtttgtttgttgatttctggttgggcttctgggaggccatactatggtatatata
cacacttaggtaacagggctcgggtaagactcttggtctacttaccctgttggaacactg
ccttattaccacaccacacttcttaaaatcccagcaaaataaaataaaatcccagcaaaa
taaaataaaatcccagcagtggaagctcagatatttcgggcccggattggggttcattgt
cctgggacaactacaacttgccactgttggaggggtaagaaaaacaagaatccttccctt
tatctggaagaggctttgtaggaaaccaacacagagttctcattagcatccacttcaggg
cagtgtggactggttggctttcatagcacctgtccccacacccaactactacgtccaacc
ggtctgtctgcttccctcaccccttgcccaagaaaggacaaggacttcagaggagtgctt
tcaatcaacattttcaatagtaggtgcagcagtcggcctcagaggatgccccaggcgtgg
agctaattctcttacacatggaggctgtttttggcgcctttgctcttgccacaagttgca
ggctttgtgcctttcattcagtcaaaaacttgcctttgtgttgctgactggggacacgct
cagggcagaagtctgagcggaggaggcgggaaaagtaggtgaggatcatgacgtccagca
tgagcagtatactcagcagaaaggtgcccagtgtcctctggccccaataatgcaggaaga
aataggtgaggtaggcctgaggggccaggcggaagagaaagtacatgaccaagttgacat
acttattgaccctgtacaggaggaggtgctgggcgttgtttatcttcatcatcatgcgga
tagtgaggaatatgttgctgacctccaccagcagtgttaggactcccccaccaacaaaac
tgttccaaaagatgcctgaaaagaaggcactcatggcctagaag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1044, 1658..1841, 3619..3795, 4246..4315, 4560..4623
1020..1044, 1658..1841, 3619..3795, 4246..4315, 4560..4574
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved