Canis_familiaris Locus RL23_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris RL23_CANFA
Canis_familiaris
RL23_CANFA
9
SNORA21
1809..1943
7912
TCCTCTTACCTTGTTCTTTTACTTTTCCATAGTACACATTATCGTCTTACATACTATAC
ACTGCAGTTAGTGTATCTATTGTTTAGCGTCTAATACCGGGTATCACTGCCACCCTAGCA
GAACGTAAGCTCCTCAAAGGCAATAATGTCGATCTGGCTTTTTTCCCTGAGGTAGTCCGA
AGTATGACAGTACCTGGCATAAACCAGGTGCTCAATAAATATTTGCATGAATGTATTGAC
AAAAGGAAAGCCAGAAAAGGGGGAAGTTGAAGCTGTGAAAGGGATAATAAGCCAAAGTTA
TCTAAAATACAAATGGCGGTGCGCCTGGGTGGCTCAGCGGCTGAGTGTCTGTCTTTGGCT
CAGGACATGATCCCAGGATCCCGGGATCCAGTCCCACATCAGGCTCCCTGCGGGGAGCCT
GCTTCTCCCTCTGCCTGTTTCTCTGCCTCTCTCTTCGTGTCTCTCATGAATAAATAAAAT
CTTTAAAATAAATATAATTAATTAATTAATTAAAATACAAATGGGTATGGGACCAAACAC
ACATATGTGGGATTATACATAGTGCTAGTGGCCCTTCTCAGTACCACATCCTTTTTGGGG
GACGAGGGTTGTTGATTTTTATTCGCAATCTCTCTTTCAACACAATTTTTTTTTCTTTTT
TTTCAATACCACATCCTAACGACACCATTTGGAGCTCTTTCTAGCTCGGTCCCCCATTCC
CTGTGTCCCCGGGGGCCCCTACACAGCAGACCCTTTTAATCATTCCCGAACCTCGAGTGT
CCACCAGCGAAGTTCCGGACACATAGTACGTGCTCCGAAGAGGTTTCTGGGTAAATTAAC
CAATGTTTCTGCATCCCCAACTACCTCGGAGCTCGTCGAGAGGACGCTCCGAGAGGCATT
GCCTCCGGCGGCCCTCTACACGCACGCCCTTCTCTTCGCAACCCGAACGCACGCCGAGGC
GCAGGGTTTATTACGTAATAGGCCAGCGCCCGGGGCGGGAGAGAAGAGGCGGATTGAGCA
AACTCCGGGCCACGTGACGATACTGGGCGGGGCATCAAAGTTCATATCCCAGAGTCCTTT
GGTCTTCCTTCCTTTCTGTCCTTTTCCGGTGTTCAAGATGTCGAAGCGAGGTGAGGTTTT
GAGTCTTGGGTATCCTTCGCCATCTGTCGCGAGGTGGCTGCTGGCCTCGCCCGGGCGGCG
GCCATGGGCAGCTGAGGCACTTTGCTCTCCTCCGGGGCGGAGAGGGAGAGGAGGGCACCG
TGAGAGCCCTGGAACGGCCCCCGAAAGCGGCGGGGGGTGGGTGGGTGGCTGGAGAGTTGA
GGTGGCAGGATCCGGACAGGACTTTAGGCCAAACCCCGCGGGGTCCTCCCCCTGCGCCTG
GCGCTCCTCCAGTAATGCTATTGAAGTGGGATGGTTTAGGCCCCAGAGTGGACGACTGCT
GCCTTCGGGGAGAGCTACGTGGTGCAAAAGTTGGAGCGAGGATTGAGAGGCTCAGGCCCC
TTCATCATAACGTAGGGGCGGTAATAGGAATTGGCTGTTTGCTATGGGGAGGGGTAGGCG
TAGTCCCGGAGAGAGGCAATTGAGTATACCGTTGCCCAAAGCATGTGCAAATGAATTTAT
TTCTTGAGAGTGGGAGGGGAACTCCGAACCATGAGTAGACAGTGACCCCTATGCTGTTTT
TCTTCTACCCGCAGGACGTGGTGGGTCCTCCGGTGCAAAATTCCGGATTTCCCTGGGCCT
TCCGGTAGGAGCCGTCATCAATTGTGCTGACAACACAGGTGAGACCTTCAGCTGCACTGT
GCCAAACTCCCCCTTTTAAAAGCACTCGGTGGGCCTTGACTGATGACCCACTGAGCCGTC
AAGAAAGGGTAGAGTAAAAACACTGCTTTTGGGTGAAGCAGCAGCATATTGTGTTGTTTT
GCTTCAATCGGTGGTGTGACAAGGTGTACCACCTTGGTTGGGCGTGGGAACTCACTTGGG
AGTGTGAGCAGAGGGATAGGCTTTGGAAGTGCAGGAGAAGCATTATACTGGCCAAAGAAC
AATCACTTTTGTTTACACTCTCTAGGAGCCAAAAATCTGTATATTATCTCTGTGAAGGGG
ATTAAGGGACGATTGAACAGACTTCCTGCTGCTGGTGTGGGGGACATGGTGATGGCCACA
GTGAAGAAAGGCAAACCAGAGCTCAGGAAGAAGGGTGAGTAGACACTGAATCCTCGTTGC
TTGGTGGACAGGTGAAGGACTTTTCCCTTTATTGGAAAATGGAATAATTTTACCATTCTA
AAGGTTTCTTAAACCTTGATTTTCTTTGAGAGGCAGTGCGAGATAAATACCTGGAATTGA
CGTTCTGCCCCTGCTGTCTTAGAGACTACTCTCCGCTACCTGGTCTTGCTGTATTTGGTT
TTTTTTGTTGTTGTTGTTTTTAAGTAATCTCTGCCCAGTGAGGGGCTTGAACTTCCTACC
CTGAAATCGAGTCACACACTATACTGGCTGAGACAGCCAGGCACCCCATTGTTCTATTTG
TTCTTGCCCTCTTAACTCCTTAAATATTTTTGCCACATTGAAGTCTGGGCCCATCTTTTA
AAAATGTAAATTATGGGGCACCTGGATGGCTCATTCGGTGGAGCATGGTTCATTGCTCAT
TGGTTGGCTATAAATGAATATGGTGGTATTTAGTAAAAAATTTTTAAAAATATTTTATTT
ATTTATTCGTGATAGACATAGAGCGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCAT
GCTAGGAGCCTGATGCGGGACTCGATCCCGGGACTCCAGGATCGCGCCCAGGGCCAAAGG
CAGGTGCCAAACCGCTGAGCCACCCAGGGATTCCCCTAGTAAATGTTTTTTAAGTAATCT
GTATAGTCAACATGGGGCTCGAACTCACAATCCGAAGATTAAGAGTCCCACACACTACTG
ACTGAGCCAGCCAGGCCCCCTAGTTAATGTATTTTTTATTGATTATTTGGTAGACGTTTA
GAGTTGGATGAGGTGTCAGGCAAGTTTCCTTTTTCTGGAACAACTGATTTGAAGGAGAAT
AATATTTGCATAGTTTCTCAAGTGGTTGTGAGATTCGGGTAATAAGCTGAGAATGTAGAG
CATTTGGCCTATGACCTGACAATTTGTAAGTAGAGAATAACATGCGTCCTGCTTTAGGAC
AGGTTCTTTATATAGATGAGATTTTTTTTTAGTATTTTATTTACTTATTTACTCTACTCA
TTCATTCATTCATTCATTCATTCATGAGAGACCCACAGAGAGAGAGAGAGGCAGGCAGAG
ACACAGGCAGAGAGAGAGGCAGGCTCCATGCCGGGAGCCCAACGTGGGACTCCAGGATCA
CGCCCTGGGCTGAAGGCGGTGCTAAACCGCTGAGCCACCCGGGCTGCCCTATATAGATGA
GATTTACTCAAAATTGTGACTTGTCAAAGGTTTAGCATAGTTGCTTCTAAATTTCTTCTG
GTAGAAACTATAATAGGGAACTGCTCATTGCTTAATTCCCCTAGGAGTAGGAGTTGGGTG
GGAGAGGGTCTCAGAGCACTTCTGACTTGTAATGTAATAATGTTCTGTCTGGCTTTAGAG
CTCATGATACTCCATGCACTTAACTTCAGCTCCTGCGCTTTGCTCTTGTACCTGCTTAGT
CTATCTCTGCCCTGGGACATCTTGCTTTTTTGAGAAGTCCTGGTCATCTCTTGATGTACA
GTACGAATACGATGGGTTGTGACCACATACTGCAGTTATTCCTTTTAGGCCTATACAAGC
AGCCCTCCCACCCCCTGCTTTCTTAGCCTTTGGGTCTGAAGTCTTTGCTCACCTTGAATA
CCCACTTGAGGGCTTGGAGTTGTGATTATTGATTAATCAGTGTGTAGATTGGGATCTGCA
TACAACTGGACAGGCTTTCCTTTTAGAACACTTGCTGGGTCTGCCCTGTGGCCTGGGAAG
CTGTCAGAGAAGGGCAGAGCAGTCCATTGTCACTGATGAGATGGCAGCGGGATGTGTTGT
TGGTCTCAATCAGATTGTTGTGGGACAGACCAGAGGACACTTAAATGGCTTTAAAAATCG
TGAATTGCCAACACTGTTAATCTTACTGGTCCTTGTTTCTTTTTTTTTTTTTTTTTTTAA
GATTTTATTTATTTATTTGAGAGAGTGACAGAACAAGCATGAACAAGGTGGTGGGGGGTG
GGCAGAGGGAGAGGGAGAAGCAGACTCCCCTCTGAGCAGGGAGCTGATGCGGGGCTTGAT
CCCAGGATCCTGGGATCATGACCTGAGCCGAAGGCAGATGCTTAACCACCTGAGCCACCC
AGGCGCCCCTGGTCCTTGTTTCTGCTAAATGAATAGATCCCTTCACCTTGGCCTTCCATG
TAACAGAAGTGTGGAAAGGGGCAGTTCTGGAGGTCCAGAGTCCTGGATTTGTGTGTGGCT
ATGAGTAGATGAATGAGAGTCCAATAGAGGAGGGTCTCAGTAAATACTAGTTATCTTTCA
ATGTGTATTTCATTGTTAAAAACCTAATCCAGAGGTAGGGGATTCTGGCTGGCTCAGTCA
ATGGAGAATACAACTTAATCTTGAGTTTAGGGGTTCGAGCCCCACATTGAGTATAGAGAT
TTTAGAAAGAAAAAACCTTATCAGGGGCTAATTTTATGTATAGTGAAAGTATTAGCCTCA
AGGATAGACAGGATCCGTGTCCTGTATTTGCAGTGTCTGATCTTGAATGTGGAAATGTAA
CTATTATCCCTATTTTACAAGAGGAAAACTTGAACCTCAGAAGATAAGTAACTTCTTCAA
AAGTCTCTAAGCTAGTGACAGTCAAGGTTTGCATGCAGGTGATGTCCTGTCTTCAGTGCT
TTCTTTTTTTTTCTCACTATTTTATTTATTCATGGGAGACACAGAGGCAGAAACATAGGC
AGTGGGAGAAGCAGGCTCCCTGTGAGGAGCCTGATGTGGGACTTGATCCCAGGACGTCCC
TGTCTTCAGTACTTCCGTGCAGTAGGTGAAGGTTTGGGCGAGTGTTTACTTTAGTGCAGG
TAGGTTTTTTTAAGTTACTTAAGACCTTGGAAAACAGTTCCTCAAAAAGTTAAACACAGT
TAAGTACATAGGAAGTGGAAGTTAAATTTCAGTTATCCAACTTTCAGACTTCCAAGAGAT
GATCACATAATATTTTGTTGTATGTCCTTTCTCTTTATTTTAAAGATTGTATTTATTTGG
GGCACCTGGGTGGCTCAGTGGTTGGTTATCTGCCTTTGGCTCTGGTCATGATCCTGGGGT
CCTGGAATCAAGTCCCGCATCAAGCTCCCTGTGAGAGGAGCCTGCTTCTCCCTTTGCCTA
TGTCTCTACCTCTCTGTCTCTCTCATGAATAAATAAATACAGTCTTTAAAAAAAAAAAAG
ATTGTATTTATTTATTTGAGAGACAGCATGAGCAGAAGGAAGGGCAGAGGGAGAAAGTCT
CTCCACTGAGCAGGGAGCTTGATGGAGGGCTCAATCCCAGGACCCTGAGATCAGGACCTG
ATTGCAAAGTAGATGCTTAATCAACTGAACCACCCAGGTGCCCCATCCTTTCTTTCTGAC
TTATTTGCAGAAAATTAGCTTGTAAACTTCTTAAATGGGACCATGGCGTTCCTGTAACCT
GTTTTTTTCTTGCTTCACAGATGATAGGTCCTATATGTGAAAAATTACAGATAGGTGTAA
ATTTTTGTTGTTATTAGAGGGCATGAGTGAGGGCAGGGGGGATGGAGCCTGACACGGGAC
TTGATCCCAGGACCCCAGCATGATGACCTGAGCCCAAGGCAGATGACTAATTGACTGAGC
CACCCAGGCAACCCCTAAGTTTTTGCTCTATTAAAAAAAAAACAAAAAACAAAAAACAAA
AAAAAAAACCAAACACACATTTGCCGGGCAATTAGGCATTTGAAATAAAGTAGAGTGTGG
TCAAGATCCTGGATGTATTGCTAGGATTCAAGGAGTATCTGTATATATATGCACACTAGA
AATTACAGGGCTTCTTTGGTTAAATTTGTGTGAATGAACTTCTATTTGTAAAATCTAACA
CTGTACGTACTCAGTCCTAACCCTTGAAAGCAGTAGTTTTTAGATCAAGGTATGTACTTT
CCTGGAGGTTTTAATACATACTGGGATGGAATGTTGCCTAATGAGTTAATAGCTTGACCT
CTGCTTACTCCGTCCAAAAGGGGGTCCCATTTTGTGATACGAAGATTGTAACAGTATCCA
CCTGTTCCTGAAGTGGGAACAAGTATTGAGGTGCTCAGCAAGTTTCCTGCTAATCTGTTG
CTAATCTTTCTAAAAGAGTACAGATTTATACTTGCAAGAAATGCAGGCAGTTTTGACTTG
GAATAAGGTCTTTCCTTAAGTCCTTAAGAGTTGATTGGTATTTGCAGTATCCCACACTTG
CTTTGAGAAATGAAAAGCGAATCATGAGTATATATTCTGTCCAAGTGGGAAATGTTGGAG
AACTAAGTGAGATGTGAACTACTTTCTTGTGGTGGCTCTGGGACTTGACAAGTTAATGAC
TGCTCTCCTGTTTTCCCTCTTAGTACATCCAGCAGTGGTGATTCGACAACGAAAATCATA
CCGGAGAAAAGATGGTGTGTTTCTCTATTTTGAGGATAATGCGGGGGTCATAGTAAATAA
TAAAGGTGAAATGAAAGGTAAGAAAGAAATCAAAGTGTTGCCTAGGTCTTCGAGAGCAGT
TGACTTATTAACCTTAGGGTCTATCTGAGCTTATCTGTCACTTCGTTCTTTTTTTATGTA
GGTTCTGCTATTACAGGACCAGTCGCAAAGGAGTGTGCAGACTTGTGGCCCAGGATTGCT
TCCAATGCTGGCAGCATTGCATGATTCTTTGGTGTATTTGTTTTAAAAAAAAATAAAAAT
TATTTGTTCTCAGTGTTTGCCTTCCTGTTTTCTACATGTCATTCTTCTTCTTCTTTTTTT
TTTTTTACATGTCCTTCTTGAACACCCCCTAACCCTTGCTTCTTTTTGTAAAATGAAGCT
ACTCAGTGCAGTACTTGCACTTTGTGACTTTACAGACACTTTTGGACTATTGAGTTTCTG
CTATAAAATTTAGTGGTTTTTTTTGTTTGTTTGGAGTCCTTAAAGTAAATTGCAGATAGT
AAATACTGTTTAATGAGAGGTCACCCCAGGTAATTGCACTGCTCTTTTTTTTTTTTAAGA
TTTTATTTATTCATAGAGACAGGCAGAGGGAGAAGCAGGCTCCACGCAGGAAGCCCGATG
TGGGACTTGATCCCGGGTCTCCAGGATCACACCCCAGTCTGCAGGCGGTATTAAACCACC
ACGCCACCGGGGCTGCCCAACTCCACTGCTCTTAATTTGAGATAAAGTGAATGATTGGAT
TGTGGACACAGATGGGAGTTCAGGGAGTGATGTGAGGAAGGATCAGGTGCATGTCTATAT
ATGCATACTTGGGAGTTAGAGTTTTCTTTGGGTAAGCCAGCACATAAAGGACTATAGTTG
TAAAGTCTAACATGATTGCCATATAAATTTGCTCTTGTGGAAGGTAATTAAGTTACTAAA
AATATCTGCATGTTTTTTGCTGTCAAAACGTTTTGACAAGATAGCTGTATAATGTACCTG
CCAAACCCTAGTTCATGAATAAAAAGTGATCTAATTAACCAGCATAATGGGTGTAAACCT
TGGCAAATTAAGCATGAAAGCATCGGACATTGCAACTTTTTCTAAACCATGATTTATGTG
ACATTCAGAGCCTGAGAGAAAAAATAAGCACTTAGCAGGTTTGGGTCAATTGGCCTAAAG
ATGTAGGAATAGGCTTTTTAGACTAAGATGTTCATATATCTAGTATCTGAGTATACTCCG
CCTTAGGTGTTCTCTGTACGGCTGAAGCTTAGAGTATGTGTAGGTCCTAGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1694..1777, 2065..2193, 6563..6676, 6781..6912
1117..1129, 1694..1777, 2065..2193, 6563..6676, 6781..6860
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved