Canis_familiaris Locus ENSCAFG00000019620
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000019620
Canis_familiaris
ENSCAFG00000019620
X
SNORA36, SNORA56
5864..6000, 10711..10837
13191
GGGGCTCGGCCGGAGGCGCTGCTTCCTGCTGTCGGATCCGCGCAGCCACTCAGCGGCCG
TGACTGTGGAGCCAGCGACGTGCAGCAGCGTCCTGGAGCCCGAACCGCTTCAGGTGGAAA
ACGCACACTGGGGAGACTAAGTGCGAAAAAGAGGTCTAAACATTTTTTAAAAAAGATTTT
CCTTATTCATTCATGAGAGACATAGAGAGGCAGAGACCCAGGCACAGGGAGAAGCAGGCT
CCATGCAGGGAGCCCGATGCGGGACTCGAACCTGGGACCCCGGGGTCACGATCTGGGCCG
AAGGCAGATGCTCAACTGCGGAGCCCCCCGGGCGCTCCTCAAATATTTCTTTCATAAAGT
GTGTCTCTGATATGTTGAAATGATATCATTTCGGATCACCAGGTTAAACAAAATTCGTTA
TTAAAGGAGTTTCACCTTTTTTCTTTTTTTGATCGTGCGGCCGCTGGAGGCTTTAAAAGC
GCCCGAGCGGCTCGCACTGTCCCCCCATTGGCCAGCAGCGCCCCAGCTGCGCGGGCTGCA
GGCAGCAAAGAGCTTTCCACGTCCCTGTGCCTCAGCGTCCGCGTGTCCACTCAGCCGACG
CGCCGCCAACGTAAAGGGGTCGGCGAGGGGACGCCGGCAGCCGCTGTCACCCGTCCGCCG
CGGCCCCGGCGGGGGTCAGGGACCCGCGGCCCGGGCCACGCCCACAGGCCGGGAGCCGCC
TGCGCATGCGCGTCCCGACCGGGCGGGTCCCGAGGCGCACGCGCGAACACCGCCCCCGCG
GGGGGCCGCAGCAGCCAATGAGGTTCCGCGGGCGGCCCGCGCGCCTGGGGCTCGGCTCCC
GGACCCCGGCCCCGCCCCCGGCCCCGCCCCCCGGGCCGCGGCGCACTACGCAGCGGGCGT
CGCACAGGTGGGCGGGCCCAGGCGGCGCGGCCTGACGGCGGCGGGAGTCCGCGCGCTCCC
TCGCTGCTGGCGCACGCGGCTCGCGCGCTGTGCGGGGCAACATGGCGGACGCGGAAGGTA
GGGGTCGCGCGGCGTGGGTGGCCGGGTGGGCTGCGAGGGCGACGGCGTCGGGGCCGAGGC
GGGCGCTGCCCTCCGCCCGGCCGCCCCCGTGGCAGCCGCGGCCTCCGGGCTGGCCTCGCC
TCTGGAGCCGGGCGACGGCGGAGGGGTCCTCCCAGTGGCGTGCCTGCGCGAGGCCCGAGC
CTCCCGCCGATGGCACCGTCTCCCCAGGGCCCGGACCCCGTCACCGGCGTGGGCCGAGCC
GGCGGCCCCCCGCGGCGGGAGACCTGGCAGGACATGTCCCGCCGCCTGTCCGGGCGCCGC
GGCCAGCGCCACGCGGAAAGGCCGAAGGAGCGGGCGGGGAAGCAGAGGGGCCGAGGGGCC
CCGACTTGCGCTCAGCTCCAGGTGGCAAAAAAGTTCTGTGGGCCGCAGACCGCGGAGGGC
ACCCTTGAGTGGCCACTTACGGAACTTTCTGGCCCGTGGGGCGAGCACTTGGGCGGCAGG
TTTAAGCACGGCCACGTGGTGAACCGTACTGGGAGCCGACATGTGCGACTGCTGCCGGTT
GGCTGCGGAGCCTTGCAGCCCACGCGCTCGGCCGTACACACCTCGTGGACCCCAGCCTCG
TGGGCCCCACGTCCATTTTCCGCTTGTTCCTGTTCCATCCTGTATTTTAGGCTTCATTGC
CCTTATTTTCGGGGAAAACTCCCAAACCTCTTGTCTCTTGTAGTATTAATTTTGCCGAAG
AAACATAAGAAGAAAAAGGAGCGGAAGTCCTTACCAGAAGAAGATGTAGCGGTGAGTGGG
AATATGTTTTACTTTGGACTAAACGGAAAGGTTAGGGAGGGAGCACATACGTAACAGCTG
TTTTTAAAAGTCTCTGATGAATGAGTCAGAATCGGGTAGTGGTTGTGTAGGGACTACACA
ACGCCAGCCTCCTAAATCTCTCTTGTCCAGGGCACTTTCCTAAATGGTGTTGACGAACAC
CAGCTGCTCTCCCTGAAATTCTTTCTTATGACACCCACAGACCCACTATCTCTCTTTCTA
AGTTACTGTTCCCATCTTTCTGTAAAATTTTATTTCTGAAAACAGAGAGTGCTCATGAGC
AGGAGGATGGGCAAAAGGAGAGAGGGAGAGAGTCTCAGACACCGTGGCGCCAGACACAGG
ACTCCATCTCAGGACCCTGAGATCATGACCTCAGCCCAAATCAAAGGTTACACGCTTAAC
TGAGCTGCCACCCAGAGGCCCCTACATGTCCCCATCTTGAGGGCACTTCACTTACCCTTC
TGAGATCCTGGTTCAGTTCTTTTTCACTTGGGAGGTCCCAGTGAGGAGGCATGGAGATTA
CCAGCTTTTTTATTTAAGAGGCTTAGACTAACAGGGTAGTAACGGAATTATTCAAAATCA
GGTGACAAGTCTGACATTGTGTTTCTGTCCTGTTTAAGGAGATACAACATGCTGAGGAAT
TTCTTATCAAACCTGAATCCAAAGTGGCTCAGTTGGACACATCTCAATGGCCCCTGTTGC
TCAAGGTATGTGGTTGACATTATGTGTCCAATCAGTGCCTGACTTTTAAGTTATTTAAGT
ATTCAGCAGTTCATTAAGAGTAATTAGCATCAGCATCTTTGAGGAAGTGCCAGATGATAC
AGTCTAAAGCAGCATTTTTCACGGTATCTCACATGAAGGACCAGGTTTTTTTTTTCATTT
CCAGTGCACACAGTACTGTAGTGGAATGCAGTTTCGAGTCTTACAGCAGTGTCCTACTGC
CGTCAAAGTTGATAAGTAACTAGTTCTTGGTTTCTGTATTTGACTCCACGTTACAGGCTT
GTACCAGTTTGTGTGTCACACTTGGTTCAGAACTGCTTTAGTGCTTCAGGCTATGGGCTT
TGAAGCCAGACCAACTGGAGTCAGGCAGTGTGTTACGTTCAAACAGTCATTTAAACTCGG
AGGCTGTCTGCTTATGGTTTTCTTCTCTTAGGAAGGCGGGTGAGGACTGTGGGTAGCAAT
CCATGAAACGAGTTACATAGAGTCTACCATGTAACTGGTCGATACTTACGAGGTGAATGA
ATGAGATTTGCTTATGTAATTCGACACAGTTGAGTTTCTGTTTGGCCAGATGGCTCTTCC
ATTCGTATCTGTTTTTCTATCGTAGGTCCTCAGGATATACTAGTAAATTGGGTATGCCAG
GGTCCCTACTGTCGTGGAACTTAAACATCTAGGGTTGGGAGATGACAGTTAAAAAATCAT
TGCTATTTGTGCTAAGCACCATGATGAAACTAAACTGGTCAACGTGAAAGATGAGCTTCA
ACTGAGGGGAGCTCTTTTAGACCTGGGCAAAGCAGAGGTGGGAGCGGCTGAAGCAGGAAC
GAACTGGTTGTGTTTGAGAAATGTCGTTGCCACTCTTAGTACCCCAAGAAGTCTTTCTAG
AGGAGTGATCAAATTTGAATTCGGTTCCTATAGGTAGTTTTTCCTGTGTATAAGGAGCCT
TAATGGTCTGTCACCCTAGATAATGAAAATGCAGGAGCAGAAACCAAGTTTATGAACTTG
CGGGTTAACCACATCATGGTTGATAGTGGTGCCGACTCTTGTTTTACATATGTTAACGGC
CTGTTAAGTTTTTTTTGTGTTGTATTTTTATTTTCCAGAATTTTGATAAGCTAAATGTAA
GGACAACGCACTATACACCTCTTCCTTGTGGTTCAAATCCTTTGAAGAGGGAGATTGGGG
ACTATATCAGGTAAGTGTGTTGGGACCATGTACTGTTCACACTCCTTTTCTTTTCAAAAA
GACCGTTTCAGGGTCGCCTGGCTGGCTCAGTTGGTAGAACGTGGGGCTCATGATCTTGGG
TTCATGAGTTGAACCCCACTTTGGTCATACAGTGTACTTGAAAAAATGACCTTTTTTTCA
CATCATTTCAAGGAGGTAGTAGCATCTTAGAATGACCTAGAATTGCCGTAAATACATAAC
CTGTACCCATGGTGAACTTTTTTGAATCGTCAGATTTAGTTTTTATGAGAGGGACAGAAA
TGATGGCACAGTGGTTTCTTTTCCATTTTAGGACAGGTTTTATTAATCTTGACAAGCCCT
CCAACCCCTCTTCCCATGAGGTGGTAGCCTGGATCCGCCGAATACTTCGGGTGGAGAAGA
CGGGGCACAGTGGTACTCTGGATCCCAAGGTGACTGGTTGTTTAATCGTGTGCATAGAAC
GAGCCACTCGATTGGTGAAATCTCAACAGAGTGCAGGTATGTGGAAGAGGGGATAAAGAG
GCAGCTTTTGATATCGAAAGGCTTTCTACATTTCCTTTTCTTCTGCCTTTTGGCCCTTGA
TAATGGTCTCTTCATCAGTTAAAAATCCTGAGCTGGGATACTCTGTACCGTCTGTCCCTT
GCCAGATCCTAGTGCATCTGCCTTTCTTGGAGTTCCCGGTACTGGACATGGTGCACATCA
AGTTGACTAGATCTGTTCCTGGCACGGAGGCGGGGCTGTGTGGGTCCAGCTCTAGGCTTA
CCGCTCCAAGCTCCTCTGGGTCTTTGCTGCTGCTTCTGCCTTAAGTGCCCCTCCCTCATT
TTCATCAGGGGAAGCTCTCCTACATGACCTTGCAAGGTTTTTTCCGAAGCAGTCTCTACA
TTGGGTATTCCAGCTGTCCCTATCAGCACATTGGAAGTTGAACTCCCAATGAGAGAAAGT
ATCTTTCCTTTCCATGTCCAAACCATGAAATTTGTGTCGAGGGAAATTTTACACAAAGAA
GTTGTCAAATTGCATGTTTTTCTTGCTGCACAAAATGGGAATATGAGCATATAAAAATAC
AGAAAACTCAGTGGCCACACCTGACTACTCTTCTGTCATTTTTTAGGCAAAGAGTATGTG
GGAATTGTCCGGCTACACAATGCTATTGAAGGGGGGACTCAACTTTCTAGGGTAAGTTTG
TGATTACAGGGAGGGTACCTCTTGGCAACTTGTGTATCTGAGCCCCTAGCTGTCCCTCCA
GAGGTCGGTTTTCCTGGCTGACCTGTCTTGTGCCCTTTTCAGTGGGCTGCTCACGCCAGC
CCGGGCAGGTACTGCAGATTTGCAAGGGCACTTCAGCCCTGTCCCCTCTGAGGAAAGGGC
TCTGATAAGCACTGAGTCATCCCTGTGTCATTGAAGAGAGAAGCAAAAATGGAAAGAGCA
TTTTAGGTCTTAAACAATTGGAAGAAACTTTTGATTTTCCATTTGTGTACTTAGACTGCC
GCAATAGCCCATTTGCTCCTATTGGAGAGTCCATGCATTGAGTCTTTGCTTTGTGCTTAC
TCCCAGGCCCTAGAAACTCTGACAGGTGCCTTATTCCAGCGACCCCCACTTATTGCTGCG
GTAAAGAGGCAACTCCGTGTGCGGACCATATATGAGAGCAAGATGATCGAGTATGATCCT
GAAAGAAGATTAGGTGAGTCATTAGGCCTCTGGGCAGCTGAATTGCCATTGACCACATGT
GGACAGAAGTGCGTTCTTGAGAGAACTACATTCTCTTGTCAAGAGTAGTTGCCCTTAGTA
TATGGTGTAGCCGGAGTCTGGTTCTGTTGTGCTTAGTCCTACTGACTTAGAAGAACTCTG
GGTTTCTCAGTCAGTGATGTGTTTACTTTGGACAATTGCTACTTTGTGTGTGTGTCTTAG
GAATCTTTTGGGTGAGTTGTGAGGCCGGTACCTACATTCGGACGCTGTGTGTGCACCTTG
GCTTGTTACTGGGAGTTGGCGGTCAGATGCAAGAACTTCGGAGGGTTCGTTCTGGAGTCA
TGAGTGAAAAGGTACACTATTATGGGACTAGAAGTTTTAGAGCTGGTACCTCGTATTTTC
CCGCCCTTGGTGGAATTTCTGCTTCCTATTCTGGAAAAGACAATTTCCAAAGTGTTGAGT
TCAGTTCAGGGCAGCTTCCCTGTTCTGTTAATTAGACTTTGGAACATTGAAGCCTGGGCC
GTGAGAGGTGGTTGGATAGAACGCATTACTCTATTCATTTCCTACCTCTCAGCCTACAGA
AATGCCTACTTAGACTTCAGTATATCAGCGATTACAGATGTGTAGAAGAGACTGAAGACT
AGAGTTTGGGACTAAAATTCAGGTTTGGGAAGTTTGGGGTCTGTTGAACTATTTCAGATA
CAGTGACACTGAATAATTGTCATATGGCTGCTTTTCAGGACCACATGGTGACAATGCACG
ACGTGCTTGATGCCCAGTGGCTGTATGACAACCACAAGGATGAGAGTTACCTGCGGCGAG
TTGTTTACCCTTTGGAAAAGCTGTTGACTTCTCATAAAAGGCTGGTGATGAAAGACAGTG
CAGTAAGTTCTGGGTTGTAAGTGGGCTTTGGACATAATGAGATTCCACAAAGATGAGATA
CAGTCCGTATTCTGAAAACCTCACTCTATGTAGAGATGAAAGATGACGTGAACCTATTTT
CTTTTAGGTTTATTTTTTTCTGGCTTTGTAGATTGGACTCTGGAATGTTTTGTCTTTTTA
TTTTATTTTTTTATTTTAATTTTTTTTGTTTTGTCTTTTTAATAAGCATTTATGATCAAC
TTGTTTTTACTAAATCAAAACCAAATATACTAGATTAAACTGAGAAATTTAATGGTAAAC
GTACTTCCATATCAAAATTAGGCAGATTGTTTAAACATTTACTTTTGAGTTTTCCTAAAG
TATCAGTGGTACATAAAATCTGCCTTTCTGTAAGCTGGTAGTTCTGTGTGTGCCTGAGAA
TCCTTGATGTATTTGCATTGTTGCCAGAAAAGATGTTCTTAGAAAGATAGTATTTATTGA
TTGGAGAGAGGGAGCATTAGCAGTGGAGAGGGGCAGAGGAGAGAGGGAGAAGCAGATTCC
CCACTAAGCAGGGGGCCTGATGTGGGGGACTCGATCCCAGGACCCTGAGATCATGACCTG
AGCCAAAGACAGATGCTAAACCAACTGAGCCATGCAGGTGTTCCTAAAAAAGAATTTTGC
TTGGGATTAAAAAAGTTAAGATGGGCATTTCAGAGATATGGTAAGCTATGTCCTTGGGAA
TTTTACTAGGAAGTTTTTTTCTCTTTAAAAATCTTAGTTTGAAAAAAAAAATCTTAGTTT
GAGGCTACAAAACTTAAACATCACTGAAATTACCAAGGTATTTTTTTAGTGTGTTTACTA
CATAACCTTGAGAGTACTTATCTTTTTTTTTTTAAGATTTTAAATAATCAAAAAAAAAAG
ATTTTAAATAACCTGTATGTATACCCAGCATGGGGCTTCAACTCACAACTCCAAAATCAA
GAATCACATACTGTACTGAGTCAGCTAGGTGCCCTGCAAGTAGTTCTTTTAATCACGTGA
TTAATTATGGCAGGGAGAAAATAGCTAAGTTGAGGGTGTTCGATGCACTTTTTGTATGTT
TTGCTTTGTAGTAAGAGACTAAAAGAAAAACTACAGAGGTGTACTAAACTATGCCATTAT
AATTGAACAAATGTAATCGCGTGAAACAGTGTAAATGCTGGGGCCTCCTTACGCTGGGGT
CAGACTGGTGCCCTCTGGGTGAATTAAAGTGGGGGGGTGGAATGTGGTCAGCAAAAGAGA
TCTAGGTGGATGAAGACAAGATGGCACAAGACCTTGAGCTCTCAGGGAGAGGTGGCCTTC
ACTTGCATGTAATTGGTTCAGCAGGCCTCGGTAATCTTACTTGCTAGGTACTTTGGGAGC
CTGTTACAGGCCAGGTCTCCCCAAAAAGCAAAAAGGTCTCTTAGTTCTGTTATGATTTTC
CTCCTTAATGATAAGAAAGAGAAGAATAATTAAGGAAAAGTCAGTCTGGGTTTTGGTAGA
AGATGAAAATACTGTTAAGTCCCATGGATGAATGAGGGGCAGGAATTTAAACTCCCCTTT
AATGACTTACTTTCTGAGTAAGTGTGTCTGAGGTGCCTAGCTCATAATGGATGGTTGCTT
CATAAATTTTTTAATTTTTATTTATTTATGATAGTCACAGAGAGAGAGAGGCAGAGACAC
AGGCAGAGGGAGAAGCAGGCTCCATGCACCGGGAGCCCGATGCGGGATTCGATCCCGGGT
CTCTGGGATCGCGCCCTGGGCCAAAGGCAGGCGCCAAACTGCTGCGCCACCCAGGGATCC
CTGGATGGTTGCTTCATACGCCAGATTGCAGCCAATGGCTATCAGTGCCATCAGCCCCAT
CCTGTAGGCCGAGGCTGCACTGTCAGGTCCACCCCAACATTCTCCTTTGCACCGGCGAGG
GTAGGGATGGAGGGTTAGTGCAGTGGCTAGGACTTTGACATGTGATGCTGTCCCTGCAGG
TGAACGCAATCTGCTATGGGGCAAAGATCATGCTCCCGGGCGTTCTCCGATACGAGGATG
GCATCGAGGTCAATGAGGAGATCGTCGTCATCACCACCAAAGGGGAAGCAATCTGCATGG
GTAAGAGGGGACGTTGCCCAGTGTCTTCTGCACATCACAGCCAGGCTCGCTAAGATCAGG
CCCCTGAGCCCTGGCTCCGCAGGCTGTCTGGGGCAGGTGAGGGCGGTCAAAGCAAAGGAC
CGCAGCAGAGACCCAGATGAGGAGGAGGTGGACGGCTCTTCCCTCGTCCCACTGGCTGCT
ATTAGAGGCCACGTCTTAGCAGCCTGGCTCCAGCGACGAGGGGGAAGATCCTCAATGAGG
GGAATAAGTATCTATGGTAATTGAGATGAAGGAGGGGAGGCCGTTTCTTGTCAGCCTGTA
CCAGTTACCTTGTGAATGTTTAGCTGCTGTTAGATTGTCCCTTAACACTTCCAGTGTTCT
GTTGCCCATGTGTGGCCTGAGCCCCCAGCCTGGTGAGGGTATCTTCAGGGTGCTCCGCTC
TGACTGCTCCATAGAGCCCTGCTTGCAGCTGAGAAGGGGATCCGATGACAAGCTTTCTTG
TGCAAATTAGGCACATTAGGTGAACAGCTCTGCTTTACTTTTTTTTTTTTTTTTTGCTTA
TTAAGAGGTCTCCTGAGGGCCTAGAAAGCATTGATTTTTATGCAATTAGTGTAAACATTT
TTTAGACTGATATTTTTAATATGGTCTCACAGTTTTTTTTCCATATGAACATCCTCAGCA
AAGGAAACCTCAAGGCAGTAGAGCTTCAAGTATTAAATGATTTTTTTTGGGCAGCCCTGG
TGACCCAGTGGTTTAGCGCCACCTTCAGCCCAGGGTGTGATCCTGGAGTCCCGGGATCGA
GTCCCACGTCGGGCTCCCTGTGTGGAGCCTGCCTCCCTCTGCCTGGGTTTCTATGTCTCT
CATGAATAAATAAATAAAATCTTTTATAAATAAATAAGTGACTTTTTTTAGAGTTTTTTT
TATATTATTTACTTATTTTAGAGGTTTCATTTATTTTGAGAGAGAGCATGCAAGCAGGGT
CGGGAGGGAGAGACTCTCAAGCAGACAGTATACTGCACGTAGAGCTCGACACAGGGCTTG
ATATCACAACCCTGGGATCATGACCGGAGCCGAAATGAAGAATTGGACACTTAACCAGCT
GAGCCACCCAGGTGCCCCTTAAATGGGGTTTTAAGATTTCTATAAAATAGTAGAATCAGG
GCTCATCACATTCCAAGTTTCTGCCCTCCAAGTCATTCTTCATCTCTTTCCAACACCTGC
AGCCATTGCATTAATGACCACAGCAGTGATCTCTACCTGTGACCATGGTATCGTAGCCAA
GATTAAGAGGGTAATCATGGAGAGAGACACTTATCCTCGAAAGTGGGGTTTAGGTCCAAA
GGTAAGTGGGACTGGGCGTGTGCCCTGCTCTGAGTTACCTTTTCATTTTTGTGTTGTTGA
ATACTCACTTGGGTAGTTCTCCGCTCTGTCTCTACCACCACAACCTTGCCTTGTACCGGG
CTCTGGGGAGTGATGGTGAGTAGAAAAGGGAACATCTCAGACCTTAGAGATTTTACTCTA
ATGGGGGAAAGCAGATGGGCATCACTAATTGCATGGCTAATGGTGAATTTCAGGCAAGTT
GAAGTCCTATCAAAGAGTGTAGAGCGGTTCCTGGCACCTTGGGAGTCCAAAATGAAGGGT
TTGACTTGATTGGGGGCGGGAGGGTGGGGAGTCGGGTCTGGGTAAGGGATTTTTGTTGGT
TCCATGCCAGCATAAAGGATGTAATAGTATGTGTTGATGAGGTGAAGAAGGGAGGGGAAA
GTCTGGGGAAACTGGGATAGTATGTGCAGAGGCCCGGTCGTGGAAGAATGGGGTGAGAGG
CGATGCCACCAAATGACATTTCAGAGGCTGTCACTGGTACAGTAGGCTTTGTGACGTTGG
GCAAGTCCCATGATTGCTCCTGTTGGAGAGAGTTCTGAGTGCCTTGCAGAGAGGGGTGAG
GCCCAGCTGGGAACCCACGAGGGAGAGGAGCCTTATTTGAGCGATCCTAGTACCTGCTTC
TCGCGTTACACTGTTCTGATGTCGAAACCCCAACTGTCTCCCAGGCAAGTCAGAAGAGGC
TGATGATCAAGCAGGGCCTTCTGGATAAGCACGGCAAGCCCACAGATAGCACACCTGCCA
CCTGGATGCAGGAGTATGTGGACTACAGGTGAGCACAGGGTGCTTCAGAGCCCCAGGCGG
GTGGAGACGGCCCCTCGCCGCCTGGATGCAGTAGTAGTTCCCCAGCTACAGGTGAGGACG
GGCGCCGGCGGGGTGGGGTTGGGCCGGCGCAGAGCTGCTGTCGCGGGACTCCGGGGACCT
GCGTGGTGCTCACGAGGCCTTGGGGCCTGCGCAGCAGACAGTTGCCCTTTTCTAGTCTGG
CTCGAGGGACTCTAGAGGGAGTCCGTCTGCGACAGTAAGTGGTGAGCTCGTGTCTGTCAT
CAGTATTTTGACGATGGCCGTAGACTTGCCAGATAGCGCTGTGGAGGATGTGGCAGGGCC
TCCCCGGAAAGCCGCCCTGCGTGTCTGACCTCCTACCTCTCTTGCAGCGACTCTGCAAAG
AAAGAGGTGGTAGCCAAGGCAGGAACAGCCGCACAGGAAGTCACCGAGGTAGTAAAGTCC
CCCAAAGTGGCTGCCGAAGTGGTGAAAGCCCCGAAGGTAGGTGGCATGCTGCAAGCGCTG
CGCCCTGTGCCCGGCGGAGGGGGGGTGTCCGCTGGTCCTGAGCGTGATTGCACACCAGGC
CCGTGTTGTGGCCCCACGCAGCCCGCTCCCCACCCCCGCACAGCGGAGACCATGCTGTGC
CAGGCGTCGGGGTGCCCGTCGGTGCTGAGCGGGTTCCAGGGGGCGTTCCCTGCTGTGGCT
GCCAGGAGCGCTACGGGCTCAGCTCACATTGGCCTCGGCTCCCACCTCAGCTGAGGCAGC
AGTGCTGGAGCGCAGAGGGGTCCATGGGCTCCTGGCCCCACCCTGGGTCAGATGGTGGCA
CAGCTGTGTGGAAATCCACTGTGCGAAGCTCGGGGGGCAGAATCACCTGAGGCTGACCAC
CTCTAGGCAGCACGGGATCGGTGTTGGGAAGTTGGAGGACAGTAGGCAGTAGTACCTCGA
CTTCTCAGGGTTGGGGACCCGCGGCTTGAGAGTACAGCGTGGGTGCAGGGAGCGAGCTGG
GAGGCGCTGCTGGCTGCCCCCTGGGGCCCCCGGCCCTGCTGCTCCGGTGCTCCTGCTGGG
CCCGTGGCTTCCCGGTCTTTGGGGCGGAGGTTGTTTGAATCCTCTGCAGATGAAGGCTCT
CTTGGGGGTCGTAATGAGGAAATGATCGTGTTGGGTTGAGTCGGGAAGTCCTCTGGCGCT
TCCCGTGTTCTTACTGGACGTTTCTTCCCCACTTTGCCCACGATCTCACATTTGATCACT
TGTCTGCACCTTAGCGGAAGCGAGACAGTGAGAGCGATGAGCTGTCTCCACAGCTGCTCA
AGAAGGAGAAGAAGAAGAAGAAGAAGGAGAAGGCCAAAGCTGCCGCGGAGGGCGCGAGTG
AGCCCGCAGATGGGGTATGTGGGGAACGTGGTTGGGAGGCCCGCGCTTGCTTAGCCGGAA
GGGGCAGGGGGCAGCGTTTGCTGGCAGCCGCTCGTGCTGCAGACTGTTGATGGCGGGGCG
CGTCTGAGTGGCGTCTCTTGCGGACTGTCTAAGAGGGGACATTGGGGCCTCCCTGAGAAG
GTCCGAATATCCTCACTGGTCCGGAGGCGGCTTTATGGGGCCTTTGGAAGTCGAGCCGAT
TGGGTTGTTAACGGACGCACTGAGGCTGCCCTCTCTCTCCCAGGACAGTGACAGCGCCAG
GAAGAAGAAGAAGAAGAAGAAAATAAAAGCGGAGGTGGTTTCGGAGTAGTGGACGCCAGC
GCAGGCACGGTGCCCGGTCGGGAGGAGACATTAAAGCCTTACTGAGAAAACGTAACTCTT
TTGTTCTTGAGGGAATGGAACGCAGGTCCCAGGAAGCTCGGAGAGTTCAGCGCTTCGCAG
CTGCTCCCTGAGAACTCGGGGACGAGACCCGGCGTGCTCCCCCCACCCTGTCCTGTTCTA
AGGATGTGGGTGCAGGAGGCAGGCTCGATGCCGCCCGCTGCGCTTCTCGGGAGAGCTGGG
AGTCCCCTCCCTCAGATCCAGGGTGGCCCAGGAACGTCTGCGGGCGGCGCCCGGTGGCTG
TCGCGACATCTAGCCCTCTCCTGCTTTGCACCCCCCCCAACTCATTTTAAAAGTCTCCAC
ACGTGGCCCAGTGACCCGATGTGGAGCAAGGAAAAGAACTGAATCCTGTTGGTCACTTGG
GGGATCAATCTTTTGTCCCGTGTCCTAGGAGGACAGTGGTCTTTTCTGGTGTCAGAGCCA
TCTCTGCCCCCCCGTGTGTGTCCCTGTCACAGGCAGGCCATCCCGTCAGCTCTGTCCAGC
CCCCCGCCCCTCCCCGGCTTTAGCGGCCCTTTGTGCCCCTTCAGAGCCTGCGTGGACAGC
CTCACGCACTTGAGTCCATCTGCCTACTTGTGTTTGTGACAGAAGCTAGGAAACTATTCC
AGACTCTCTCTTTTAACCCTCTTTTACTTTCAAAGGATGAAATTACTTCTTGCTGGGAGA
AGGTTGTACTTTTTACTTAATAAAGTCTACTTGTTTTTAAGTATTTCTGTTGGGTCTTTT
ATCGCAGATGTAAAACTAGCAAAACAAAAAATATAAACTAGTTTGATTAAAAATCTAGGG
GACTTTATGTCCAATTTGGAACACAGGGCTAGTTCATTGCTTCCTTTTCTTTCCCTGGTT
CTGAGTTGCCCCATTCATTCTGGGGCCCGTTCCCTGGCATGGAACTGAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1723..1790, 2438..2524, 3638..3729, 4051..4235, 4846..4910, 5286..5412, 5640..5770, 6158..6301, 8279..8399, 9602..9720, 10424..10527, 10907..11015, 11774..11893, 12163..12191
1001..1016, 1723..1790, 2438..2524, 3638..3729, 4051..4235, 4846..4910, 5286..5412, 5640..5770, 6158..6301, 8279..8399, 9602..9720, 10424..10527, 10907..11015, 11774..11797
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved