Canis_familiaris Locus ENSCAFG00000019553
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000019553
Canis_familiaris
ENSCAFG00000019553
X
SNORA70
3085..3218
5136
tggtaaccgcagcgccgcttcggcggccctactggagtccactcctgtgggcggggggg
ggggggctttattgtagggcgatccatttcagaggcacactctaggcgctggcacgcaga
ggcgggacaagggggcgtgtgcggcagggccaccatctggggccgggggcggtggaagcg
cccacgagcgcccagtaaggcggctctcagaggctaggagtggggcgcggccagagaagg
aatgacagtgctcctttgccgtcttgggtgggggttgccgccctcgttctccaagtcacc
cggggcgccccaagtttcttttctctgccgggtcagggtgggcggggaggggatgggcgg
ggcgggagcaaatgggcacacggggtctctcgggcacccgatcacgggtgaggcgcccgc
ccccccgcgcgggcctttttctcgcgagagcgcgcagccccaccctgcgcctccggcgaa
cgagggatctgcgcgtggttcccagccgagccaggtccggagcgtccggttagggcgggg
gaggcgtgggcggggggagcccgcggctccgccgacaaaggaacgctgagcgagactcca
gcctggcgtgtgtcgtggggccctggagcccagagggagggtgtcagccccgtgaccccc
aggaagccgcacgcagccgcgtaagccccactcgagggtgttttccttctttttcaggac
cacaggtctctcacagggcaaagcctcggccaagagccctacacccaagatggccagccg
gaaactggcctctccgcgccgatgtggcgacgcccgattggccggccggccgcccgcgca
ccagctcccggcggggacccagcccgcgcaggtccggacgccacgcccgtgcgcaggcgc
accgggcggctgcatctgtggtccggaagtgtggcagagcacccgcccgccccggccgcg
actctatggtaactgcgcgggaagatagtccgcctatataaGGCCTGCGCAGGCGTGGGA
GCGCCTCTTTTTCCTTCGGCGCGgtgagtagccggggttccgggcttgtcccgtgcgctc
tctgactctctggcctgcttggaggcctctctccgtcttctcttccgactttgtctgttt
cgttgcagCCACTGAAGATCTGGTGTCGCCATGGGTCGCCGCCCCGCCCGGTGgtgagtg
ctcaacccgtacaatttggcagctgagaaaggagggaggactgcgcttggctgctaaaag
cagccgtggggtggggcctcgagtggagcgctcctgtgctggggacacactccacgtctc
tcccagtgcctcccgggtcgcttgggatcttcgattatactgtttaaggtccatgcggct
tttcagagcatcttctgttttgttgggtgttggggtggccgattttccttggactggctg
cgctccgtcactttcggcctggaagccacgtccgccttgcatccttcctgtcttggaaat
tcgccgccttaggaagctcgataccctttcagggcctttgtgtgctatcccggtcttatt
tccgggcgacatgcccgtgccttctcgggcgccaagggccgccctgaaaagcgggctcag
tcgccttgtatgtcctgcagggggcgttagaatctctccacacgtggtccggagccccga
tttaatgccacgtgcccaaaagtcggtggatagcatgaaactgactcactaatactcagc
aaatcttccgtgtcttgaagtgagagggtctttttttttgtacctagaaaagtcccctag
gatctgttagaagtatgaggccataaaggatcaagcgaggtttttgggcttttatattct
tagaatgggtgttttctaagttctgaccaccttgttttggttgtcttgcttagatccagt
ttccaggactggaaaccgattgatacgttgttgccctccccattcgcagccctcctttgg
ttttaacttaagggagcctcaaagtgtttattgttacattcacttgtgaactttaaactt
cggtttcctcccctctccgcagTTACCGGTACTGTAAGAACAAGCCGTATCCAAAGTCAC
GCTTCTGCAGAGGTGTCCCTGgtaagtagtgggcgtgctcccaaactggtttggccgcac
tgactcaattgccaatggtacccccctcccccacacacctaacgaaggtcttttcagATG
CCAAGATTCGCATCTTTGATCTGGGGCGGAAGAAGGCAAAAGTGGATGAGTTCCCATTAT
GTGGCCACATGGTGTCAGATGAGTATGAGCAGCTCTCCTCTGAAGgtgaggcaggattcc
ttaatggctgtcccttctagctgccccccaccagacccagaacacactgcactggatttc
tattttaatgagtgcctaacggtgagcctttctgaaaaactcacccatcagtacagatat
actgtgagtcggggagggttacaatagaaacgtgtgtgtttatctcctctcactctgttg
ccacatgtcatcaccctagCCCTGGAGGCTGCCCGTATTTGTGCCAACAAGTACATGGTG
AAAAGCTGTGGCAAAGATGGTTTTCACATCCGAGTGCGGCTCCATCCCTTCCATGTTATC
CGTATCAACAAGATGTTGTCCTGTGCTGGAGCTGACAGgtgagctgggtcttgggtctct
gctttttcaggtgtttactcataacttgaggcctttgtttggcttgatttttttcattag
ggcaaagagatggcctcacacagaattcaaccatttaataatacagccaggttaaattta
ggctatgaaacggatcttaatgggccatttttgccccataacaccacagagaactgattt
gcagaaacaagcacaaaagacattgtgactgtcttagcctcttggtgacaggtggagggg
gctccttctgagggagtaactttaatcctgatgccagccatctgccagcaagcaggtagc
tgaagcagtcacaggttggagggctttcagatgagccaatgaccccttagaggaactggc
tagtctgttttgagttttctgttttctgcagccaattaagccgactgtgctctttctcca
tgggggcccagtgtgccatggctgcaaacagtagcctccttggtagtgtatgcagcctgt
tgattgtatgggttgccctaagggaccttggagacagccctttgtggtcgacttagaggt
ctgacataatgttatctccaatctagGCTGCAGACAGGTATGCGAGGTGCCTTTGGGAAG
CCCCAGGGCACAGTAGCCAGGGTCCACATTGGCCAAGTCATCATGTCCATCCGTACCAAG
CTGCAGAACAAGGAGCATGTGATTGAGGCCCTACGCAGGGCCAAGTTCAAGTTCCCTGGC
CGCCAGAAGgtgagttgtgctgaaaccaccgtcctgcctttgcttgccccagtgtctagg
tttcctgatgccatcctcttcatctctccctagATCCACATCTCCAAGAAGTGGGGCTTT
ACTAAGTTTAATGCGGACGAATTTGAAGATATGGTGGCCGAAAAGCGGCTCATCCCAGAT
GGCTGTGGGGTCAAATACATCCCTAATCGTGGCCCCTTGGACAAATGGAGGGCTCTCCAC
TCATGAGAACCTTGCACCACCCGAACCCTATTCATGCCCACCAATAAATCCTGCTTCCTG
TCTGTCTGTCTTTGCATCTGGATTCATGGAGGGTGGGGGGCTCTTTGGAAATCATGAAAA
GACTACAAACTGGCCCTGGGCCAACAAGGAAACATTAGGAATATGGCCTAGAACATACCA
TCCTCCAAGTTGCCTAAATGGCACTATGATTTGGACCTGCTTAGGTCAGAAATTCAGTTC
AGAATCTCTTTTCACAAATCCAGGCTGTGATGACTCCATAGGCATTGAATGCTTCTTTAG
GCCAGTGCCCTGCCCCAGTGTGATGAAAAAGGGCTTGTGGCCTACAGTTAACTTGGAGCT
GCTGCAAAAGTTCTCGCTGAGGACCCTACCAGAAACATAACTGGAAATGGGGAGAAGTGA
GACTAGGCCTGGTTCCAGACACCTTTTAAGCCAGTCCTCTAGAAGACAGGTCTTGAAgtt
ggctcatgaagagttgtgctcaagttttcaggcagcagtcctgactccactccttctgag
gactcctttcacatccttggccactgtggccagtgtccattctgatacccagctcccaac
cttaagtggcccatagggcttagcaagaagacctcatggcaagtagtgtgcagctcccct
gggcctggggattccggagtgctgtctggcacctcaactgtgtgccaggtttacaagagt
agcgttggattccacatcctggaggaggaaagatacccccaggaactctgttaggcctga
tggcacgtggctctgcacccagaagagaatcctaaaggaatctggctccagagcagggca
cagtggttgcagaggccccctctgcttgcccaggctgggctgtgtgctgcatgtaagctc
tgtggcccatcctctgaccttttgcaatccttactaaacagccatttctaaggtttaaaa
tcccttttatttttggccttcaaatggttctaatctgtaagcatttgtgctaaaatggcc
ctgatacctgctaggtggttttactgagctgttccccgaaaattgaaactgggggaaggg
agagttctgtgatcccgacatcctaataaagagtccttaacctacaagcccgcgtatcca
cacagttgctattacgtgagaagtgttccatctattttctgtatgcacctgtcgcctggg
taaccagcctgagccatgcctcctacacctgccagtcagtgtggactggcggtaccctgg
gcggagggaggctgagctgcacaatggtcgtgaatggtcgtgaacgtgggcttgacagaa
ggcagcagcagggctgtttgcagctactttgatttattagattacgagtttaaacatact
ctgttcactagttactgcgtgtgtaaactgcttatcggtcattgtatctgctggaatctt
aatacagattcctgtgaatcctgtatgcaataaaaat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1148..1192, 2062..2120, 2217..2324, 2539..2677, 3266..3428, 3513..4136
1170..1192, 2062..2120, 2217..2324, 2539..2677, 3266..3428, 3513..3665
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved