Canis_familiaris Locus ENSCAFG00000018962
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000018962
Canis_familiaris
ENSCAFG00000018962
X
SNORD61
2463..2534
7629
CTTTCTGCTTAATGCTATCTCTCTCCTTGAAAAGCTTTCCCATGGCTAGTTTTTCTCCA
TTCAGATCTGATGTGACGTCTAAAATCAAATTGAGTCTCCCATACATTGTCCACCCAAGC
ACCTAGTTTACTTCCTCTGTAGCACTAATTACAACACATATTGTTTTGTTATTTGTATTA
AAATATTTTCGTAAGTTTTTAAATAAATTAGAAAAAAATTAAATTTTTGCAATCCCTCCA
ACACGAGTAGATTGGCACAGATAAAATACACAATGCCCAGTTAAATCTGAATTAAACGAG
TACTTTTTTTTGTATATCATTTTGGGACATGCACAAACTGAAACAATTTATCTGAAATTC
AAACTTAACCGGGCGTCCTATATTTTTATTTGCCAAATTTGGTAGTTTTACCTTCGAAGT
GCGTGCCTTGTCCTTGTCTCTCTCGCTTGTTCTGCGTTGTATCCTTACAGCCAAGCCCAG
ATCCTGCCTTTTATTTGTAGGTGTTCAGTAATTGTTCTATATGAAGTAACTATCTGTACT
ACCCCCCAAGTCATATTCATTCACCAGAATTTTCCCCATTCAGTAAAAATTCTTGTTGAG
GATATTTGGGAAGATGTATTTTATTATTGAAACTTCTTTGTTTCCCCTTTATGCAAAATT
AGCATAGTTAGGACTCTGTACCTTCATCACATTGTTTTGAGCATTAAATGAGTTCATGAG
TGTAAAGTTCAGCACCGTGTCTGGCCCCCTAGACTATGCAATAAATTTCAGTTCGGTATT
AAATGCAGCCCGTGAAACATTCTAGCGGAAAGCAAAACCGCGGGTTTGTGGAGCACGGGT
GGGGGCTGGGGAAACGGTTAGAAACGGGCGCCGGCCAGAACGCGGAGGGCCTGGGGAAAG
GGGAGGAGCAAGGAGTGAGTGACAGAGAGGATGGCCAATGGGAGGCTGGGAACCGCTCCC
CCTCCCTTTGCGTTTCAAATTCTAAGCTCGGTTTCCATCCGGGTCCTTCAGCCTCGTTCC
CGGGCAGTATAAAGTTTGCTGTCTCCTTTGTTCGCCCTCGTTGCGCAGTAGTGCTAGCGG
CTTCCCTCTTCCGCTCTCAGAGCCGGTGGCTCTCACTCGTGCTGAGCTGCTACGAAGCCC
CTGCCGGCGAGCTCGTAGGAGCTTGGAACGGTCGTCACCCCTCCGGTACGTGTTACTCTT
TCCTTCACCCGCTTCTCGTACCTTCTTGCCACGTTACAACTTGGGATTATCTCCCTGGAG
ATGGGGGTGGCGGGCGCCATTTTAAGAGCCTAAAGGTGCCGACCTATTTCGTTAAAGCCG
AGCATGTCCGGGGAAAACAGACGTGGGAGCGCCATTCCGTTCGGTGCCTCTCGAGAAAGT
TTGGCTGTCCGCCTGCGGGGTTGGTGCCGGAGGTCGGGGCTGGAACAGGACGAGGGCAGA
CCGCGCCACCGCGGTACCTGCATTGGGATGGCGCTGGCGCTACGGATGGGCACGTGCGCT
TTTACGCGGGTCCTTGTTCATTGGCGGCCTTGGAGAGGAAGCCCTTTGAATTTTCCCAAC
CACTGCTGATGGCAAAAGTTACTCCCCTGACCGGTGTGGGTTTTTCTGGGTTGAATCCAA
GTGTCGCCATTTTGTGTTTTCCACGCGGTTTTTAATGACGGGTTTTAATTGGATTCTGCT
GCAGTCATGGAGTGTTGAGTGATACGATGCGCGCTTCCACCTTCCGTTATTATGAAACGA
GACTGAGACCATTTTTTTTTCTTTTAAACCTTTTCGGCGGGGCAGGGGCTGGTAAAGAAG
AGGTATAACTTGGCGCAAGGTTTAAATTTCTTTTAGATTTACTAGGGAATCCTAATGAGA
AAAGGCAAAGAAAGGTCTTGGAAGAGGACTTGCGTCTGGCCCGTGACCTTGAATGGGGCG
ATACACTTTTAAAAAACCATTAGGGTAATTGGGATGTGATAATTGAATCTTTAAAAGGAA
ACACATCTAGGATTAAACTAAAATGGCTTTTTCAAATGCTGAGTGGCTGTTACTTTATTA
AAATTGCCGAGGTGGATTAAGGAGGAAGGTATTAGCTAAGTTGGACCTTTTTAACTAGTT
TAGTGTAAACTGCTGTATCCGTAAACTACTTAAATTGGTTTCCTGCTGAGGCTTAGCAAA
GGAATGATGATTTTAGTAAAACAAGAAAGATGTACCAGTAAATAGGTGTGTCCTGTGAAC
CTGAACTTTTTTTTTTTTTTGAACTTGAACTTTTTATAGGGAGGTAATACTATTCTTTTT
TAACAGACTCTCACCAGGGGGAAAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTTTTCA
TTGGTGGCCTCAATACGGAAACAAATGAAAAAGCCCTTGAAGCAGTATTTGGCAAATATG
GACGAATAGTGGAAGGTGAGTTATCTGAAACTATATAGGGAGCTGTTAGAATTAAAAATG
TAAGCTGTGATGTATTTAATTGCGTTGATTGTCTGAAATGATACATTATTTTGTCCTCTA
AGAAGTTCTGAGCTTACGTTTTGTAGATGCACTTGTCTTACCTAATTCGAACTAGAGTAA
CACTCCCCCCCCCAAAAAAAAACCTGTTTTTTTTGTTTTTTTTTTTTTTTTAGTTCTATT
GATGAAAGATCGTGAAACCAACAAATCAAGAGGATTTGCTTTTGTCACCTTTGAGAGCCC
AGCAGACGCTAAGGATGCAGCCAGAGACATGAATGGAAAGGTGAGATTGCACAATGATAG
TTTCCTAATGCATTAACTTAATGTTGTTATTGAATTTTGGTCTAGGCATAGGTCTTGAGT
TGTGTTTGGATGTATGCGTTTCCAGAACCCTCTAATTTTTTTCGCCTTTTGTAGTTTCAA
ATTTTGCGGAGTTGTGGATTATACTCTTTTAAGTGTTTTCAAATCAGAAAATTATCTGAT
TGTTATCTGGAATCCATAAAATGAGTTGACAACTTGGCTTTTCATCGGTTATCACATTTG
ATAACAAGTTGACTGGCTCTTTAAACTTTATTGACCAGCAGTGTGATAGTCCCCTTGTGT
TGGGGTTCAACTGATCAGTATTGTTCTAAGATACTTTCTCCCCCCCCCAAAAAAAAACTT
TCAATGGAAAAGTGACCATATATTTTTATCACTTTTCTCAGATGAGTTGATGAGCTAAAT
TTACCTAAAAACTTGAATTTGGAGGGCACATTGGTGGCACAATGCATAGTGAATACATCT
ACAAGATCTATTTAAATACTAATGCAATTAACCACTTTGATGTTTAGTCCTTAGATGGAA
AAGCCATCAAGGTAGAACAAGCCACAAAACCATCATTTGAAAGTGGTAGACGTGGACCAC
CTCCACCTCCAAGAAGCAGAGGCCCTCCAAGAGGTCTTAGAGGCGGAAGAGGAGGAAGTG
GAGGAACCAGGGGACCTCCTTCACGTGGAGGGCACATGGGTAATGACTTGAGTCTACTTC
AGGCTTGTAGAATTTATGGACTGCAAACCCCACACCGATCTGCATTGGTTATGTCCTGGT
ACAAATTCTACAGCTTTTTTTTTTTTTAAATTAACCAGCTTTTGATATTGAGTGCACCTA
CTCCTTTATCATTTACCTAAGTTAAATTAGTGTTTAAAAAAATGGACCAGAGCCTGGCTG
ACAACTTAATCACGGGTCATGAGTTTGAGTCCCACACTGGGATTACTTAAACCTCAAAAA
ATAAAATCATGGGAAACCAGCTTATATGGGTAGTTTGTGAAAGAAGTTTACAGAAAACTT
CTCAGAATGCATATATTTTAAGTGTATAAGAATTAAACCATTTTTTTGAAGGAGCTTAGA
CTACTTAGTTTTGTTAGTCTATATAGACTCCCTTGGACAAGTGCAAATTAAAGCAAGATG
TCCCAACTAAACAAAATGGTCATTGATACAGCAAAGGAAACTTTTATGACTTTCATTGAT
GTGAGAATTAACATGTTTTTCTTTTCTTTTTCAATGCAGATGATGGTGGCTATTCCATGA
ATTTTAACATGAGTTCTTCCAGGGGACCACTTCCAGTAAAAAGAGGACCACCACCACGAA
GTGGTGGTCCTCCTCCTAAAAGATCTGCCCCTTCAGGACCAGTTCGCAGCAGCAGTGGAA
TGGGAGGAAGAGGTAGATGCTAGATTTATTGAATAATCTGTTCTACCACCATAACAGAAG
AGATTGATTAATGGATTTTAAAAAATGATGCTTTAAAATTAAAAACCTAAGTAAATGTTA
AGTATAAAAAATGTTAATGAAACGGACTCATGGACTTGAGATGTGATCTAGGTACATAAA
GTTACAAGCACTGAAAAGAATTAAGTTGTGAATAGGAAATTTTAAAGAAACTTCATGATT
TAGTTGTACTGTCCTATTTGAATCTCTACCCTCAATGCCTGAATATAAATTCATATTTTA
GCTTTCCATTTTTGGATATATTTTTTAAATGGTTAATTTTTTCCCTTAAGCTCCTGTGTC
ACGCGGAAGAGATAGTTATGGAGGCCCACCTCGAAGGGAACCCCTGCCCTCTCGTAGAGA
TGTGTATTTGTCCCCAAGAGATGATGGATATTCTACTAAAGACAGGTAACAGACCAGTGT
AGTAGTAGATAATTGAGGTTGAAAGGAGAACTTGTCAAAAGCGTGAACCAAGTTAATTTT
TGTTTTTGTAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACAAGAGATTATGCA
CCACCACCAAGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTAC
CCATCAAGAGGCTATAGGTAAAGTAATATTGTTGCCTGCCACAGCTGGCTGTAAAAGATA
AAATTGCTCTGAAAATTGCCCTGTGACTTAACAAGTTTTTCTCTTTAGTGATAGAGATGG
CTATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATA
TGAGAGTTATGGTAAGATACTGGTTGAGGGTCTTTGAATATCACCAGCTTGAGTTTTTAG
GTTCATGAGCCACTTTATTAGGCTGTGTGGTGCTTGCTTTTTAAGGGATATTTGCTTGCT
TTTAAGGGGTAACGTTATCAGCTGGGCTTTTCCTAGTTTCGTGAGGGGCTTTTGTTTTTT
TCTAAGTTTTTTTTTTGAGGCTGTTTGCTTGCTTTGGAGGGGATTTTGCTTGCTTAAATT
GGCAGCCTTATGTGTTTTCCCCCAACAGTGAAAATACAATTTAAAAATTTTATTAACAAG
ATCAAATGTTTACCATTGCAATATGAAGGAAAGTCTACAGTTCAAAATTGCAACTTATCA
CTGGAAAGTGTCTGAGTGTCTACTATAAAATAACAAGCTGTCTGGAATATCCTCTTGAAA
TACACACCGTCTTCAATCTTTTCAAACAAACATTAAAACCCATCCAATTTCCGTATCTCA
GCAGATGAGCAAATCCCTGTTAATGGCCAGCAATGGCAGAGTTTAAAACCTCCCAGTTAA
AGTAAACGTTTAATACAAGAATTCTGTAAATTCAGATTTAAATGTTGTATATATACAATT
TATAGTGTTGCCATATTACCTGACCATTGACCCTGCAGGTAACTCACGTAGTGCTCCACC
TACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATGATTACAGCAGCTC
ACGTGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAGCCGAAGTGATCTCTACTC
AAGTGGTCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCTTCTATGGAAAGGGG
GTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAGGTGGTGG
CCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATATTAAAAACAAAACAA
AACTTTGGACCAAAATCCCCGTTCAAAGAAAACAAACAAAAAAGTGGAACCTTTTCTGTC
ATAACTACCCAAGGACTACTAAAAGGAAAAATTGTGTTACCTTTTTTAAATTTCCTGTTA
AGTTCCCCTTCCATAATTTTTATGTTCTTGTGAGGGAAAAAAGTAAAACCTGTTTAATCT
TATTTGACTTTATGACATTGCTTTCAATAAGCAAATGTTAAATGTGTTAAGACTTGACTT
GTGTACTAGTGTTGTAATTTTTCAAGTTAAAAGTGTCCCTAAAGGCCACTTCCTATATCT
GATTTTTCCCAGTAAATGAGGCAAAGCAATTCTAAGACCTTCCACAAACATCTAGCCTTC
TAAAATGGAGAGGTGAATCCTTCTGCCTATACAAACAAGCTAGCTATTAGAGGGTGGTCG
GGGTATGCTACTCTTAGGATTTCAGAGTGTCTTCAAACTGAAATCTCAATGTTCTCAGTA
ATGAAAAACCTGAGATCAGATGCTTATGTAAGGAAAGTGCTATTCACCCAGTAAATCCAA
AAAAGCAAATGGATAATGCTGGCCATATTTTGCCTTTCTGACATTTCCTTGGGAATCTAC
AAGAACCTCCCCTCTCCCCTCCCCCAATAAGACCATTTAAGTGTGTGTTAAGCAACTACA
GAATACTAAATAAAAAGTTTGGCCAAAACCAACCATGAAGCTGCAAACGGTGCTTGCTCT
TACTGTTTCAAATTTTTGCAACTCTGTAGTGTCTCACTTTTAAGGAACAGCTTGATTGCA
AAGGAGAAAATAGATAAGCAATGAAGTTATCTCCAACTTCTCAAAGGCTTATGACTTCTA
AAAAGTGAATCTATCAGCATTCCACATCAGATTTAAAGCATCAAATGCCTGTGAAACCGC
AAAGATGGTAAGCAAAGCAAACTAGTTTTTCCGTCTAAGTCGAGATTGAACACTTACCTT
CCTCATAGTACAGTGAGACATACTGTACCTCATGGCAATGGAAATGCTTTCTAGATTAAA
AAAAAAACTTTGGAAAAGCAAAGTGTTCGATAGCATATTAGAAGTCCTCCAAATTCAACA
CATGGATTTTTTTTTTTAAAGCATGTATGACACTTAAAGGCCTTAATAATAACAGCTGTT
GTTTACCAATAGCGATCTGGGGCTTGGGAGGGGGTGTCTTTTTTTTTTTTTTAAGTATTT
TTGATGAAGACCTTTAAACATGCTTCATATGTTTTAACATTTTTCAAAATAGACTTTTAG
TCAATTTAGGAAATGGCTTAAGTTTGGGGTCCCACTCTGCCCCTGTAAGCCATTGCAAAC
TTGACATTTAGTTGGATGCCTGACTTGTTTTTAGTTCTATGAAACTACACTGTATGGAGA
AAATCTATTGCAAGTGGTCTTTAAAAAGCAAAACCTGAGGCAGCATGACCCAGGTCCAGC
CATGAAGTTGAAAAAGATGCTCTTGAATATAGTAAACTTGAAGACCTCCAACTAAAATCC
TTACACTGCACTTATTCCTTCAAATAAGTTTTGTCCGTTCAACTTATGGATTTAACATGG
CAGTGCACCATTGGAACAGAATGAGAATCCATAAGCCATGCGACTTAAACCATTTTAAGC
CATTCCAGTCCATCCCAAGCCAGTGAATCTTCCACCACTTTGAGAATTAGTAGAACATGA
AATAACTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1191, 2292..2414, 2630..2739, 3287..3458, 3999..4151, 4490..4604, 4691..4816, 4908..4990, 5618..6629
2306..2414, 2630..2739, 3287..3458, 3999..4151, 4490..4604, 4691..4816, 4908..4990, 5618..5925
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved