Canis_familiaris Locus MAGED2
snOPY snoRNA Orthological Gene Database
Canis_familiaris MAGED2
Canis_familiaris
MAGED2
X
SNORA11
6117..6246
8840
AGGGGCGGGACCACTTCCGGCCTGGAGCAGGGAGGGCAGTCTAGGAGTTTTAGAGGGGC
TTGGAGCGTGGACGCACTCTGGAACTTAAGGAGAAGGAGGTGAGCTGTGGGGCCCAGCCC
GGCTCTGGATCACAGCCCAATAAGGATCGGCCCCACCCTCTCATATCTGGAGAAAACCTG
CTGTAGGGACCGGATCGTACCGGATCCATCCGGATGGGAAGGGAGGGGACTGGACCCGGT
TTGGCTGGGCCTAAAATGGAATCACTGGCTCCATTCTAGATTTGAGGAGGGGGTGTACTA
AGGAAGGGGCGGAACCAAGATGCGCTTTGCCCCTGGTTGGAGGGGGCGTGTTGTGAAAAA
GGGCGGGACAGGGCCATAGTGTGGACTTGGGGTGGGTGTGAGTAGGGGAGGGGCCGGGAC
CACCAAACTGCGACAATTTTAGAAGAAAGCTTGTTGGGGAGGGGGCGGGACCAAATGGTA
CTGCGGACCTGGAGAAGGGCTTGTGTTGAGAAAGGGCGGTGGACGGAGTCCGGACCATTG
CGCATGCACACTCTGGATTGCTAGGAAGGGGCGTGTAGAGGAAAGCCAGCCTGGAGACGG
GCTGCTGCCGAATGCGCATGTGCATGGTGGACTTCAAAGAAAGAGCTTGTGCTGGGAAAG
CGGGCGGGGCTGAGGTGGGCCTCCGCAGCGAACGCGCATGCGCATTGTTGGTCTGCGGCT
GGAGGGGGGGTGCACTGGGAAAAGGGGCGGGGTCCTCAGAGCTGCCGCGCTGGCACATCT
TCCTGGAGAAGGGGAGGGTGCGGCTGCAGAGAATTGAGATCTAGAAGCTTTGGATTACTG
AATCCGAGAACGGAGTCATTGGGGGCGGGGGCGGGGTTTGGGTTTGGGGCCCTAGGGAAA
GTGAGGATCAGCTTCCAGGCAGAACAGGAGAGAGGACGTTCAGGCCCTTTGACACAGGCC
TTCTCTCCTCAGGCTCAGCTCTTGCCAGGCCAACTTGAGACATGTCTGACACAAGCGAGA
AAGGTACGGGTCCAACCCGCTTCCAGGTAAGGCCTCATTTTGTCCTCTCCCTTACTACTT
TTCTTCTCCAGCGCGTTGCTGCCTCAGTTCCCTTGGTACCACCCCTCCCATCCTTGTCCT
TTACCCACTTTCCTTCCTGGGTGCCCCCCCTCACCAGTAGAGGGAGTGAGGGAGGGAGGA
AAGAAGGAAGAATGAAGGATGGAGGAAGGAAGTAGGGAGGGAGGGCAGGCCTGCCTTCTT
CTGCCATCACTTCCTGCTCAGAGGAAGGAGAGGCCTTGTTGGGTCTAGGTGGGCAGAGCT
CACTGTAAGTAGGAGTTAGTATAGGTCAGAGAAGTGAGGTCCTGGAATTTTGGAGCCATT
TTCCTAGTTGGGAATGGGGAGAAGGTCTGTGAGCTTTCCTGCTTCCTCTTGCAGGCTGAA
GCTTCAGAGGACAGTGGCTTGAAGATACAGACCCTATTGACAGTGACCCATAATTTGGAG
GTCTCAGAGATACCGAAGACCTCAAAGGCACTAGAGACCTCAGAAGCCATGAAGGTCTCA
AATGCTGCAGGAGTCTCAAAGGCCACAGAGGTCTCAAAGGCCCCAGAGGCTCAGGAGGTG
GCTGCCACTCAGGCCTCCCCTACCACTAAGCTGACTGATACCCAGGTTCTGACAGTTGAA
AAGAAGAGTCCAGCAGCTGACACCAAGATGCAGAGTGCTGACCCTCAGCCTGTGACAATG
CCTGCCACTGAAACCAAAAAGGTCAGCTGTGTGGCTGATATAAAGGCTGGTACAAAGGCC
CTGGAGACTGAGGCTCCTGCCTCTCAGGCTTTGGCAGATGAACCTAAGCCTGATGGTGCG
GCTGCCCAGGCTCAGGAGAATCAGGATACTCGGCCCAAGGTCAAGGCCAAGAAAGCCAGA
AAGGTAAGACGTCTATAAACACCAGTCTTCCCTTTCCACTTCTCTTCATTAGTCCATTTG
TTCTGCAAACATTTAGAAAGTTCCCTGTGCTCATCAAGATTAAGGGGGACAATAAGAGGA
ATGTGATATCATTTCTCTCTGCAGAGAGTTCACAGAGTCATGGAGAACTGAGATAGTACA
CATACTTAGCTGCAATGTTAATGTAGTTTGTATTTACATAGGACCTACCATGTGTTAGAC
CTTGAGCTAGGCACATGCATACAGGTTATTTCATTAAATCCTGAAAGTAATCCAGTTTTA
TAGAGAAGGAAGCTGAGTCCTAGAAAGGTGGGGTGACTTGTGCAGGGTGGTACAAGAAGG
GCCAGTGGTGGACATAGGAAGAGGAGAATTCTCAGGCCCCATCTCAGGTTGTTCCTAGCC
TGGTAGAGAGATGAAACTTCTGCATTGAAGTCAGTGAAAAACAGTCCCAAGACTCAACAT
GGCCAATGTCTAATCAGGCTGTTACTCCAGGGGTGGGATTAGAGGGGCCTTCCAGAAGAG
AGAGGATGAGGGAAAAGGAACATCTACTTTGTTTGACAATATTGTGCTTCCTCTCTGTTG
CTGCAGGTGAAGCATCTGAATAGCGAAGAGGATGGCAATAGTGATCAGAGTCAGGCTTCT
GGAACCACAGCTGGCCGAAGGGTCTCCAAGGCCCTAATGGCCTCAATGGCGCGCAGGGCT
TCAAGGGGCCCCATAGCCTTTTGGGCCCGCAGGGCATCAAGGACTCGTTTGGCTGCTTGG
GCCCGGAGAGCTTTGCTCTCCCTGAGGTCACCTAAGGCCCGTAGGGGCAAGGCTCGCCGT
CGAGCTGCGAAGCTCCAGTCATCCCAAGAGCCTGAAACACCAATACCTCGAGATGTGGCC
CTTTTGCAGGGGAGGGTAAGAACCCTGTCCTCTCCACTCTGCCTTATCTACTGCCTTGCC
TACCTTTTCTGCCTTCCTCTCAAATCTTGTGCAAACGTATTTTGATCTTTCTACCTTTTT
TTCCCTTTCCCAGGCAAACGATTTGGTGAAGTACCTCTTGGTTAAAGACCAGACGAAGAT
TCCCATCAAACGCTCAGGTAGAGTTCTGCTAGCCCTCCATCCCCTAAGCTGTGCCCTCCA
TGGCCCTTTTTCCCATGTGCTGAGGACATTTCTTGTCCTTACACTCCTACCTTTGTACTC
CCAAAGTTCTAACTGGGCAGTGCTAGCATCTCTTTTCATTACTTCAGAACCTGTTTGTGC
CACCCACAACAGAGTTGGCAAACAGTCTTTAGCTTGGATTGGGGGCCACCTGACTTCATT
TCAGCTCAGGTGCTCGCAACACTCTCCCCTTGCAGACATGCTGAAGGACATCATCAAAGA
ATACACTGATGTGTACCCTGAAATCATTGAACGAGCAGGCTATTCCTTGGAGAAGGTGAA
GGGGCAGCCATGGGGGATGGATGCAATGGGGAAGGATTGAATTGAACAAATATACATGTC
TGTTCTGGGGGAGGGACCACAGACTCACTAATTCAACCCTATCACTGTGTGGATGGATAG
ATAGGAAGGGGCCTTCCCATATCTGGGGTGGTCTAAGGAGGGGCATAAACTAGCCCAGGG
TCACATAGCAAGTCTCATAAAAGCACAGCTAGGACCCAAGCCACCCAACTTAGTCCTGGC
TTCTGTCTGCTGCTGGAGATGTCCTGTAATATATTTTACATGCTTACATCTTCCTTCCAT
TCCCCGTTCTCTATCTCCCTAGATTCCTGAGAATCAGAGATGATGCTGAGAACAATAGTA
CATTTCTTTGCTGTTTGCTGTGTGCCATCCACCTAGGCTTATGTACATTATCTCACTGGC
CCCTCCCCCCACACCACACGAATGCGCATTCACACCTACACCCACATACCCCCACATACC
CCCACATACCCCCACATACCTAGGTACATGGGAACTTTGGGATGCCCAGGAATCTGAACT
TGTGATCTTACAAGCTGTTCTCCCCATCCATAGGTATTTGGGATTCAGTTGAAGGAAATT
GATAAGAATGACCACTTGTACATTCTTCTCAGCACCTTAGAGCCCACTGATGCGGGCATA
CTGGGAACGTAAGCTGGGAAAGGGCTGGGGTGGGAGGGAGGCTCTGCTTCTGTCTATGGC
ACTACTCCATCCCTGTCGTCTCTCCCCACAACCCCTTGGAGAGGCAGAAAGACAGAACCT
AAAAAGCCCCCGTTCCAATTCCCACACATAGTTGGAGCCCTGCACATGGTAATGGTGACT
GAAGAGTATAGAAGCCTAGAATGGTATATTCCTCCTGTCAGGTTTTCTGTTTTTCCAGAA
GCTTCCCAGAAAAGCAGACCAGTTGTTGCCTGTCTCTTCCTACTGGCTTTGGTAGAGTGG
TTCTTCCTGGTATGGGTGAATCATGATCCTTGAAGGACAGGAGCATCACTGGGGCTGTGC
TAGAATTCTCTTGGAGCAGGGGGATCGGTTTGGGAGAGAAAGGACTCACATTGGCTGGGT
GCCTGGGTTGTTCCAGGTTGACAGGCATTCTTCTATCCTTTTGACAACCTGGGACAGAGG
AGCATTGGATTTTGCCATTCTACTTAACAGGAGACTGAGACTCAAGAGTCTAAGTGCCTT
GCTCAGCGTCACATAGAGCTTGAAGCATAAACTGGGAAGAATTCTGTCATGTGTGAGGAA
TCTGGGAGAGGGTAGCCTAGTGAGCTGGCTGATATGTTTTTTGCAGATGGCTGCTGGACA
TAAATCTTCTCTCTACCCTGTTATTTCCCTAGGACTAAGGATTCGCCAAAGCTAGGTCTC
CTCATGGTGCTTCTTAGCATCATCTTTATGAATGGAAATCGGTCCAGTGAGGGTGAGTGG
GCATGTAGCTGAATGGGTGGCCACAGTTGGAATTCCACATGTTCATTTTCTGTCCCTGTC
TCCTCTTGCCTCCCTTTGCAGCTGTCATCTGGGAGGTGCTGCGCAAGCTGGGGCTGCGCC
CTGGGTATGATTGGGCTCTCTCAGTGCTTGCTGTCCGTATTGTCATTTGGCAAGAGAGGA
TGGTCCCAGGATTGCATCAGTCTGGTGGTCTGGTGGAATGGGTGGGGGTACCGGTAGAGG
GTCCAGGGTTTGACCTGAGTGGGTGGGAAATGGTCCCAAACTCTCTGTCCTCTGTTTCAC
TATCTCTTGGGCTACTATGGAGTTTTCTTCTTATGCTCATAACCTCTTTTCCTGTTGAAA
ATGCCTCTGCATACATCTGGGGAGTACCATATCTGATTGATTGATTGATTAATTGATTTA
CTGATGGATTTTTCTTTCTCTGCTATCAGGATACATCACTCGCTTTTTGGGGACGTGAAG
AAGCTTATTACTGATGAGTTTGTGAAGCAGAAGTAAGTGTGTCTGATGATGGTGTGTTCC
ATATGTTTTGCTTGTTTCAGAACTGAGTAATTAACCTATGGTTCGTGAGTGTGCATGCAG
GTGGTAGGTCACTTTTTCCTAAGTTAGTGAGAGGGAACAGGAGGACATATTCCCTGACCT
ACATGTACTTTCACATATGCTTTAGAGCAATTTTTCAAGGTAGGGATTATTATCACCAGC
ATTGTAGATGTAAGTAAACTGAGGTTCAGAGAAGTGAAGTAATTTGCTCAGGGGGGTTAC
ACAGGTAGCAAATGGAAGAGTCATATTTAGATCCTGGCCACAATGCCTTGGTTCTTTTTA
CTGCGCTAACCAGGGCTTTATAAAAATTAACGTCCATAAAGAAATGCTATAGAATGATAG
CTTTAGGCAGCCAGGTACTGTGCTGGTGACTTGACTTGTACATCTCATTTCATTTTTGTA
ACTACCCTGCAGAATAAGTGCTGCCATCCCATCCCCATTTTCAATTGAGGGACCTGGGTC
TCAGAGAGTGGAAGTCTGATTGTGGCCCTGGCTGGTAAGGGGACCATTTGGTCATGGGGC
CCTCCTGACTTTCTGGCCAGGGCCCACCATACCCATTATCCTTAGAGAACACATGTGTAC
TCACATAGGCACGTTAATATGTACCTTCATGAGCATACACACATACACACACACACACAC
ACACACAGTTGGGAATATGCACAAGCACACTACTCTTGGTAGACTGTTTCTTCCATTTAG
TCATTTTCTATGGTAGACTGTCTCAGGGCTCACCAGGTCATGGACATGACCACTGGTGGG
GTGTGCTCAGGGCAGAGGGGCCTGAGGAAATGGCTCCTCTAAACATAACAGAGCCAACAA
GAATCTGGGTTAATTGTGACAAGAGCACAAAACTTGTGGCCTTCTTATGAACAGATAGCG
CCTACTTGTGTCTCACCTTGCACCTCCACATGGCTTCTGAACAGGACCAACGGGACAAGG
CTCAATAATGGAAGAAAAGCTAAAGTACTTAGTAGGGTTGATTGCCATTTAGAATTTTTC
CAGTCCATACATGGGTGGGCCGTGGTTGTCTTAGACATAAAGGCTTTCAACCTCTCTTTT
CAAGGTACTTGGACTATGCCAGAGTCCCTAATAGCAATCCCCCTGAGTATGAGTTCTTCT
GGGGCCTGCGTTCCTACTATGAGACCAGCAAAATGAAAGTCCTCAAGTTTGCCTGCAAGG
TAATTGGATAGCTGCCCAAGCTTGGCATATTAAGAGCATGGGGTGCTGCTGGCTAGGTTA
CGCTGTGTAAAGAGCAGCCCGCCACTCAGATGTGAACATTCTGAAGCTTCTGTTAATGTG
CCAAACATTTATCTGAATTGTTTAATTTGTACAACTAACATGTCATTACCCTCTGCCAGA
TTAGAAAAATCAGGCTCGGAGAGGTGATTAGGTGACATGTCTAAGGTCTCAGAGCTAATA
AGTGTCAGAGCAGGGATGGAATGTTAAGTACATAAATACTAGTAGTTAGGTTGTCTTATT
ATATTGTTGTTGTTGTGTAGAGCATGCAGCACGGTGCCTAGCATACAGTTAGGGGTTCAG
TTCTTGGATTTTTAAGAAGATTTTATTTATTTATTCATGAGAGACAGGGAGAGGCAGAGA
CAGAGGCGGAGGGAGAAGCAGGCTCCCCGTGAGGAGCCCGATGTGGGATTTGATCCCAGG
ACCCAGGGATCACAACCCGAGCCAAAGGAGACACTCAACCACTGATCTACCCAGGTGCCC
AGTTCTTGGAATGTGATTCTTCTGACGGTCGTTGTTTCTGTTTCAGGTACAAAAGAAGGA
TCCCAAGGAATGGGCAGCTCAGTACCGAGAGGCAATGGAAGCAGATATGAAGGCCGCTGC
TGAAGCTGCAGCTGAAGCCAAGGCGAGAGCAGAGATTAGAGCTCGAATGGGCATTGGGCT
TGGCTCTGAGAATGCTGCTGGGCCCTGCAACTGGGACGAAGCTGATATTGGACCCTGGGC
CAAAGCCCGGATCCAAACTGGAGCTGAAGCTAAAGCCAAAGCCCAAGAGAGCAGTGGTGC
TAGCTCCAGTGCTAGCGCCAGTGCTAGTGCCAATGGTGGCTTTGGTGCCAGTGCTAGCCT
GACTGCCACTCTCACATTTGGGCTCTTCGCAGGTCTCAGTGGAGCTGGTGCTAGCACCAG
TGGCAGCTCTGGTGCCTGTGGTTTCTCCTATAAGTGAGATTTCAGGTATCTACTTAGACT
GGGTTGGAATAGCTGGGGCTTCATGGGTTGGGATGAAGAGCTGGCTGGTTATAGAAAGGC
CAAGGTTGCAGGACCATATGGAGCATGTGGGAAAATTCCATTATTGGCATTTTGTTCCTT
CCCTTTTGGTGGTTCTTGGGTGACTTTTTGAATTTCTTTTACTTGTATTTTCAGATACTC
CTAATCCCAGCAGTCTTTCTCTTCGAGCCAGGGTGCATCCTCAGAAACCTACTCAAATAG
CACTCTAGGCAGCCACTATCAATCAATTGAAGTTGACACTCTACATTAAATCTATTTGCC
ATTTCTGAGTTTATTGCTTTTTTTTTTTGGTGGGCTGTCATATTTTGGTATTGCATTTAA
AAATAAATGGGGAGAGTTTCCACCTCAATCTTTGTTTACTGGATTCAGGGGAGCAAGATT
ATGATCTCTCAGATAGTTTGGTCTGCATCTCTAGTCTTGCAGTGTAGACAGGATTGCAGT
GGGGTGGGGGGTCATGAAGATCGTAAGCACACACTTTGAAGATTGAGGACACACTTTGAA
GAAGAGCCCTAAGATAGGCAAGTCAAGCAGAAAGCAGAGGTAGAGGAGACTGGACATCAA
ACATAGGTTCTCTTTTTTAAGGAATTTGGATGAGAGAGGGAAGAGAGAGGTAGCTAAAGG
AACAAGTACAGGATTTTCTTGGGAAAGGAGAGAGAGGCTTGAGCAGGCAGGAGCCAATAG
GGAGATGTTAAAGACTGACCCATGTAGCCCTGAGAAGGCAGAAGGGTAAGGTCTGGGAAA
AGGGACTGTCCAGAAAGACCTGGAGAGGGGACTGTGGAAAGATGTCAGGCAGAGGGGAGG
CTGCAATTGAGGATGGAGCCCATCATTTTTAGGAGACCCTTCTCCCATGGCAAGGTGCTC
AGCAATCTTGGAATCAGGATGAGTTAATTTATCCCAAGTTTTTAGTTCTGGAATAAGGAC
ACACGATCAAGGGCAGTGAGTATGTGGGTCTGTATCTTCATTACTTTGTACACCGTGCCT
GACAAAGTAGATATGCAGAATGGTGGAAGAGATGGATCATGAGACCCAGGCAGGCTTGGA
GAGGCAGGTAAGGAAATTGTGTGATGACCTGGGAGACCACATAGGAGTCTGTGGGCAGGA
GTTTCAGTGAAGTCTGAATAGGGCAGAATGTTAAATAAATGTACCAAGTGCCTGCTCTAT
GTCTGGCAGTGTTAGAGGTGTTTGGGAAGGGGTGTTGGGAGAGCTGGAAAGGTGATCTAA
GGGACTGGTCATATGGTCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1434..1922, 2526..2834, 2953..3016, 3275..3354, 3933..4027, 4712..4791, 4881..4923, 5249..5311, 6424..6538, 7126..7544, 7734..7840
1001..1045, 1434..1922, 2526..2834, 2953..3016, 3275..3354, 3933..4027, 4712..4791, 4881..4923, 5249..5311, 6424..6538, 7126..7533
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved