Canis_familiaris Locus ENSCAFG00000016072
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000016072
Canis_familiaris
ENSCAFG00000016072
X
SNORA11
5861..5992
8548
ACGGACGCCATTGGAACCCCAGGGAAGGTAAGGATCCAGCCTCAGACCGGACCGGGAGA
GGGCGAGTGGCACCCGGCACGCTGCGCCCTCCCCGCCCCCACACCCGGATCCGAACAAAG
CCCAGGCACTCAGAACCGAGCCCTGTTAGACCCACGGTCTAGGTAGGACCCCACCCCCTC
GCCGTGCCGTCTCCCGCCAGGATCTCTGCCAGGAGACGCAGAGCCCTGCATACACCGGAG
CCCACCATCCGAACCCCTTTAGCAGATCCGTGTGCTCCGTGCTGAGCTTCCTTAGAGCGG
AGGCCCTACCCCCACCCCAACCACTCCTAGATCACTCCCAACCTGCTGACCCGCGTTGCC
CCCTTCCTGGAGTTGCAGTCCTGGGGTTTGAGACCTCCAGCGTTCCAATTCATGCCTCAC
TTACTCCGAGCCCCTACCCCACCCCCCGACACACACACCCCTAGAGCTGCTGTATGAGCC
CAACCCAGACCTGAATCAGCTGAATGCCCCCACCCGGACCTAGCCAGAGGGTCTCTGGAT
TCAATTTCCCATAGCTTTCCGGGGTCCCTGTTGTCTGAGCCCTCTCATGTCATCTGCTCC
CCCTTCATCACTAAATCAAAACCCTTTGTTTCTCCCTCTCTCGATGCACATCCCCTTTGG
GACTTTTCAGACCCAAGCCCGCCAGTCCACTCCCTATTCAAAGCTAGCCGCTGGGATGGG
GAGCTTGCCCAGCCTAAACTCCCCTTTAAGTGCGAGGTTTCCTCCGACCACCTCTGTCCC
TCTCTTAGGGCTCTGCCTCTGACACTATCTAACCCAACAGAACCCCCACACGCCCACCCC
CTCCCTGGCCCCTCCCTCTGCCTTGTACTGCCTAGTAACCTGATGATTGCCGCCCCCCAC
CTCCTGAGAGATCCCACCTCCCGCTGTGTCCCGCCCTCTCCCCCTGAAGAGGCCTCACCC
TCCCTCCCAGGCTGAGCTCTCTTCTCCTTGGGACCCCCAGCATGGCTGAGGGAAGCTACC
GCACGGAATCGGAAACCTACAACGTTGAAGACATGGATGAGGGCAGTGATGAAGTGGGGG
AGGAAGAGATGGTTGAAGGAAACGACTATGAAGAATTCGGTGCTTTTGGAGGCTACGGCA
CCCTCACCAGCTTTGACATCCGTATCCTCAGAGCCTTTGGGAGCTTGGGTCCAGGCCTTC
GCATCTTATCGGTGAGACCCCTTGTGGGCCACCTGCTGGCCCTGGGCCCTTTCCCCTGTG
AAGCTGCTGGAGAGGGGGCTGCTGTGGATGAAAGGGAGGGTTGTGTGGGGAAGGACTGCC
CAGCTTCCCCAGCCTTCCCTCTCCTGCTCAGAGAAAGGGGGTTTCGGAAGTCTGGGGCCG
GGGGTGGGGGGGGTGGGGGCAGGGGGAGCTGGCTGCAGGGGGGAGGCTGGCCAGCACAGG
GAAGCATGATGTGCAGCACATGTAGAGCTGTCTGCCCTCCCCTCCCTTTCTCTCTGGCCT
TGCAGAATGAGCCCTGGGAACTGGAAAACCCTATGCTGGCTAGGACTCTGATGGAGGCAT
TTCAGCTGGATCCAGAAACACTTGCCAATGAGGCTGCCGCCCGTGCTGCCAACGTAGCCC
GCGCAGCTGCCTCCAACCGTGCTGCTAGGGCCGCTGCTGCTGCGGCCCGTGCCACCTACA
ATCAGGTGGTTGCTAACCACCCGGTGACCACAGACCAGGCTTCAGGAGAAGATCCTCGGC
CCATGACATATGGGGCCCAGGGTCAGGCAGCCACCCCTGAGACAATCCGTGCTGCTCCAC
ACATCTCCCAGATGCTAGTCAACAGTGAGATGGCCGCCCCAGGAGCTCCGGCAACGTCCA
CACAGCCCCACACAGCCTCCCAGGCCCAGGAGGCTGCAAACGAGGGCCCTAGTAGCGCCT
GTGCTTTCTCTCAGGCTCCATGTGCTAGTGAGATGGATGCCACTCGGCCCAAGACCGCCT
TCCTGGGTCAGAACGACATCTTTGATTTTACCCAGCCAGCAGGTGTCAGTGGCATGGCCT
TCCCACGCCCCAAGAGACCTGCCCCAGCCCAAGAGGCCGCCACAGAGGGCCCCAGTGCTG
CCTCCTCCGGGGTGCCCCAGGCAGCACCTGCCAGGGAGGGGGCGGCCACCCGGCCCAAGA
CGACCAAGTCTGGAAAGGCTCTTGCCAAGACTCGGTGGGTGGAGCCCCAGAATGTTGTGG
CAGCAGCTGCTGCCAAGGCCAAGATGGCCACAACGAGCATCCCTGAGCCCGAGGGCGCAG
CTGCCACTGCTCAGCGCAGTGCTGAGCCCTGGGTCAGGATGGGAGGCAAGAGGACCAAGA
AGGTGAGACCTCCCTGCTATCTCCAACCCTCCTTTCTCTGTTCAGCCCTCTTCTCTGGCC
CCTCCCCTCCCCTCCCCTCCCCTCCCCACCCTCCTCCCCTCCTCCCCTTCTCTCAGCTCT
TGCATGTTTGTCCAACATGAGTTTGCTAGCATGCTCAGACTCCACCGAGTCTCTGCCCTC
AGGCGTGGAGGAAGAAGAGGTTGGCTCAGTGCCGGGCACGTAGTAAGCACTCAGCACATG
TCATCCACTGTTTGTACTACTCTTATTTCCAAGTACGTGCTTTGGTTGAGATGTGTGCTG
GGCACTCTTGGACGGTGAGCCTGCTAGCCCTGGGTCTCCTCTCTCTGACACTCTGACTAT
AGTCCAAGCACCTGGATGACGAATATGAGAGCAGCGAGGAGGAGAGAGAGCCTCCTGCGG
TCCCACCAACCTGGAGAGCACCGCAGCCCCCATTGACGGTGCGGGCTCAGGTGGCTCCCC
GGCCCTCGATGGCCCTGAGGTCCCAGGTGCCCTCAAGACACGTGCTGTGCTTGCCACCCC
GCAACGTGACCCTTCTGCAAGAGAGGGTAAGAAACCTGCTTTTCTCCCATCTCCCTCCTC
TCCTCTCCTGTGGGCCAGTTCCTGGAGGTCACCCATGCCTTGCTCTCCCCGTGTGCTCCT
CTTCCTCCTCCAGGCAAATAAGTTGGTGAAATATCTGATGATTAAGGACTATAAGAAGAT
CCCCATCAAGCGCTCAGGTGGGCAGCCCGGGCCCCCTCCCCGAGCTCTGCACACCCCCCA
CAATCCCCATCTCTACCCTATGGGGCCTGGCATCAGATGTCTCCACCCGGCAGGCCCAGC
TGATCCCTCCATGTGCACAGTACGGGGTGGAGGGGGGAGTGGGGTTCCCGACGGTGCTCC
CCTCAGCAGGGTTGACCGAGGGTTGCTGCAGCTCTTTGGACCCTGCTCAGCCCAGGTGCT
CTCTCCACCCCACTCCCCCGCAGACATGATGAAGGATGTCATCCGAGAATATGATGAACA
TTTCCCTGAGATCATCGAACGAGCAACATACACTCTGGAAAAGGTGAGCGAGGGGCAGAG
GCAGCTCACTGTGGTACAAGAGCTGCAGGGAAGCCTTGCACCCTGCAGCCCCCTGAGGTC
CACTTTCAGTACACCTCCTCTGGCGGGCTCTCCTAGCTTCTCCCGCATGATCCCTTCTTC
GAGGCTTCCCCTCCCTCATGCTGTCTGTTCTCTGAGCCTCCCTGGTCTCCTGAAGCCAGT
GCCAGAGCTCCCACAGGGCAGTTCTCTGCAGCCTCTCTCCTTGAGCCTTCCGAATAACTT
CGGGGTGCCTGTGGAGGGAAAGTTCTAGCGGGGAACTCAAGGACTGCCTGCAGGACAGGC
AGCACGGGTTTCTGATCCCATGTTGTCTTCTCCCCCACATAGAAGTTTGGGATCCACCTG
AAGGAAATTGACAAGGAGGAACACCTGTATATTCTCGTGTGCACCCGGGATTCCTCAGCT
CGCCTCCTGGGAAAGTAAGAAAGGGCAGGAGGGTTGTGGCCTTCCTCACTGTGGCCTCCC
CCTCCCCTTCCTCTCAGAGCAGCTGGAAAAGGGGCCTTTGGTGCCTGGCACAGCTCCGGC
TCCCAGCCCCGCAGTCCGTGGTACCCAGTGATTAGGGGATGAAAGGGGAAGTGGCCTAGG
CTGAAGCCTTGCTCGATGCTCTTGATGCTCTCGGGGGGGGCTTCCCCTCCCCACGCCCAT
AACCCCACCCCCCACACCACCTCCAAACCCCATCTTCTGGGAAAGAAAAAAAAGTGGGCT
CCTTGTTGCCTGCCTCTTCCTGCTATGTGCCTGGCCTGGGCTTGGCAGTGGTGGTCCTGG
AGGAAGGAAGCTTCCTGTCCAGTGTAACTCCCGATGCTCAAGGGGCAGGGAAGGTCTGGA
TGTGCCCCCGAACACGAACACGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCCGCTGCT
GCCACTGCCAAGTGGTTGCTCCCTGCCTGACCCCCTCCTGGATGGAACTCTGTGAGGGGG
CATTCACATCCGCATTTGAGGCATGAAGCGATTCAGTCTCAGACAGAGGAATGAATGGTC
TGGATTAGAGAGCAACTTGTGCGTAGTGTGCGAAGAACAACCCCGTAGCCCAGGCCTGTG
GGCAAAGCTGGTTGGGTGAGCCAGCCCTAGTCTCTTGGGCAAACGGCTGCTGGACAGGAT
CCCTCTTTCTACCCCTCTAGGACCAAGGACACTCCTAGGCTGAGCCTCCTCTTGGTGATC
CTGGGAGTCATTTTCATGAATGGCAACCGTGCCAGCGAGGGTGAGTGGCTGGACCCGCAG
CCAGGGGGTTGCCCAGTCTCAGCCTGGTGTGCTGAATTCTTGTGTCTCTTCTCCTCTCGC
AGCCGTCCTCTGGGAGGCACTACGCAAGATGGGACTGCGCCCTGGGTATGATTGGGCTCT
CGGCTCCCGCTCCTCAGTGCTGTCCTTGGGCACTGGTGGCCCCGGGATTGTAAATAGCCT
GGTGGCCTCGTGCAGGAGGGTGGATGTCCTGGACTGGGTTGAGCGCTGAGGGTGCATGGT
GAAATGGCCCTGGACTCTCAAGCCCCTCTCTGCTCCGTGTCCCCCCTCTGTCCCCAGATG
AGATCTCAGAGAACCCATCAGAATTGAGGGTTCAAATCCGACCCTTGCCGAGGGCATCCC
TGACATGGGGCCATGTGGCCCCTGCTGCCACTCCAGACCTCCATGGGGATGCCCCACAGG
CTGGGACGCTCTCCATCCCGCTAGGGAGCACACCTGCCCACATCCAGGCACTGCCATTGT
GTGTGGTTATGGATTCCTTCCTTTCCTGGCCCTCAGGGTGAGGCACCCATTCCTTGGAGA
TCTGAAGAAGCTCATTACAGAGGACTTTGTGAAGCAGAAGTAAGTATTGGCCAAGTTAAC
TCTGTCTCACACTCGCGCATTCCTCGTGGGCTGATCAGGCTGAGCGAGCCACTCTCCATG
CCGGATCTTAGCACAGCGGGATAGGCGTCTCTTCTGTGAGGGTGGGTGGGGTGTGTGAGT
GTTGGCGGGGAGTAGACTTCCAGCGCAGCCTTGGAGAGAGGGAGTAGAAGTCGACAGAGA
CTCCAGTGCAGGTTGTGTTAGAACCACTGTGCCATTTGGCCCCTGTCCCCCTAGGCTGTA
GGAGAATGTCTCCTGCTTTACATCCCAGGAACCTGGGGCTCAGAGAGTTGGAAGCCTGAG
CGTGGCCCCAGCTGGTGAGGGGCCCATTGGGTCCTGGAGCCCAGCCCGCCTACCTTTCTG
GTCAGGGCCCACCCGGTCCTTGGTCGTAGGAGAACACGTGTGTACTCATGCAGGCACACT
ACACATGCCCGGGTGCACACAGACATGCGAATGTGTGCGCACACAAACAGACACGGAGTT
GGGGGGTGTGCGGAGAGTATGCTGCGTTTCTCCCCTTTACAGTCCTCTCCTATGGTGGAT
TGTCCTGGGGTTCCGCCAGGCCATGGGCGGGACCCTGCCGAGGAGTGTGCTCAGAGCAGG
GGACCCGAAGAAATGGCTCCTCTGTTTACGACACACCCAATGGGAATCTGGGTTCATTGT
GACAAGGGGCCAGAAACTGGTGGCCTTACTACAAACAGAGACACCCTACACGTGTTCCAC
TCTGCATGCACTTCCTGTGGCGTCTGGGCAGGACCGGCGCCACGTGGAGGCCTCGGTCCT
GGAGGCAGAAACCCTGGGAGTGAGCATGGGCGTGAGGCATGGGCTGGAGGGCCAGGACAG
TCCTCCTGCAGGAGCTGAGCTGCAGTATCGGGGCTGGGAAGGGACGACCCGGGAGCCCTT
GGCACAACAGCAGGTCTGCTTGGCTGGAGGCAAACGTTTATCTTCCTCTCGCACTGAGGT
ACCTGGAATACAAGAAGGTCCCCAATAGCAGCCCACCCGAGTATGAATTCTTCTGGGGTC
TGCGAGCCCGTCACGAGACCAGCAAGATGAGGGTGCTGAGATTCATCGCCCAGGTAACTG
CCTCTGTTTGGGGCCAGGCGGTGGGGTGTGGGTTTGGTCTGTGCCATACCTTCTCTGTTT
CTTGGTCATGGCCCCCTTCCTTAGGCTGTCTGTCCAGTGAGGATACTGATGCATTCCTAA
GTAGGTGTCTTCCCCAAGTTCACAGAGGTGTAGTAAGTGGGAGGCATGGGGTGAGGTCCT
GGGGCTGGCAGGGAGTCCTTAGGAGAGCCGGATCCCAATGGTCTTTCCTTTCGTCGGGAC
CATGCACAAGGCACTGGGGGTGGGAGCTGGTGGTGGCAGTGTATGGCAGGAAGCAGGTGC
CCCGTGAACGTGGGGTCGCTGTTTGCATGGTCTCTGTTGCTCTACCGCAGAATCAGAACC
GAGACCCCCGGGAATGGAAGGCTCATTTCTTGGAGGCCGTGGATGATGCTTTCAAGACGA
TGGACGTGGATATGGCTGAGGAACATGCCAGGGCCCAGATGAGAGCCCAGATGAACATCG
GCGATGAAGCCCTGATTGGACGGTGGAGCTGGGATGACATACAGGTGGAGCTCCTGACCT
GGGATGAGGATGGAGATTTTGGCGACGCCTGGGCCAGGATCCCCTTTGCATTCTGGGCCA
GATACCATCAGTACATCCTGAATAGCAACCGTGCCAACCGGAGAGCCACTTGGAGAGCCG
GCGTCAGCAGTGGCACCAATGGCGGGGCCAGCACCAGCATTCTGGATGGGCCCAGCACCA
GCTCCACCATCCGGACCAGAAATGCCGCCAGAACGAGTGCCAACTTCTTCTCCTGGATCC
AGTAAGATTTTCAGTCCATAAACAAAACCCCGAAGCAAGGGATGGGAAGGGGCTGTGAGG
AGTCCAGTCGGGGGAAGGCCTGGGTGCAGTGGGGGAGCAAAGAGTGTGAAAGACCCTTGT
TTCGTTCTTCGTACCCCTCCCCCACTGCCATGTGTTTATACTTCTGCACCTGCTCCTGTG
TCTTCCTTTACAGGCAACGCTGACGCTGCCGAACCGCAACCGTCCCTCACCAAGCCAGAG
TGCCTCCTCGGATCCCTCCTTAACAAGGCACTCTAGGCAGCTTCGACCTGCCCATCCCAG
ATGGCATGCAAGATGAAGCTCTCTTTGCCCTTCCTGCTTTCATCATGTGCTTTCCTTGTG
CGCTTCCGTGGTGCGCCTTTGTCGTGTTTTCATGTTTTTGGTATCAGTGTTACATTAAAG
TTGCAAAGTTACTTGGGGCGTTTCCTCCTTCCCTTGTGCATGGACCTGGGGACGTGGCCA
TCTGGGGGGCACGTGGTTGAGGGCTTTGAGGTAGATACTACCCGCCTCTGCCTGGAAGGC
AGCAGGTGTGGGTAGGGTGCTGGGAAGATGTGGAGGTGCCAGCTGGGTGTCCAGACCATG
AGTTTTGAGAGGCTCCAGTCCCCACGGTGGCGTGACTTCCTACGAGGTACAACCTCACTT
GGGCGCCAACGGTGGCAGGGGGAGGGGGGTTGGCAGGAAGAGGGGTGGAATGAAAGGCTG
TGGGTTGGTGCCACTATCCCTCCCACCAAGGTGCAGGGTCCACAGACATCCACCAAGACC
CTTCCACCTCATCTTTGGAGGTGCCATCTTGGAACCCTTCCCTCATCATCCACACAACTT
TAGCACCTCATCTCTCCCTCAGGTGGAGTCTTCAGGACAATGAGATAGGCCTCGGGGACA
TTTTCACCCCTCCAGCAGGTTGAGGGAGGAGCCATAATTGCCCACAGAGTAGGTTTAATG
AAAACAGACCTCAACAACCTGTGACCGGACCCGAGGCCTGTTTGTGGGCTCCAGAGCTCT
CCTTTGCTGGGAACCAGTGAAGGCCAAGGCTGGGCCTAAGTTCTGGTGTCTTCCAGGGCT
TGGGGTGATCCCTGTAGGAGCGGGGTTGGGACTGCGATTCCTGCAAGGGACGACAGTAAG
AGCAGAGATGCCTGGGAAGAGCTCAGTGGCACGCAGTAACAGTGTCCAGAGCTCTCTCAG
GTCCCTCAGTGATGCCCACAGTTGAAGAACGAGGCCCCAGGTTAAGAAGAAGAAGAGGAT
CGTGTGAGGGCCCCTGCACACCATTGCCTCTTTTCCCCCAAGAAGAGGTTCCCTCCTCTC
ACCCAGACTTGGCTCCTGACCCAGATCCAGGCACATACTTTCACAGGCCCAGTGGAGAAT
GAAAACCGTGGGACCCCTTGCTCGGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1210, 1505..2341, 2702..2905, 3013..3076, 3323..3402, 3762..3853, 4580..4659, 4742..4784, 5196..5258, 6238..6352, 6710..7140, 7333..7548
1001..1210, 1505..2341, 2702..2905, 3013..3076, 3323..3402, 3762..3853, 4580..4659, 4742..4784, 5196..5258, 6238..6352, 6710..7140, 7333..7339
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved