Canis_familiaris Locus TBRG4
snOPY snoRNA Orthological Gene Database
Canis_familiaris TBRG4
Canis_familiaris
TBRG4
Un
SNORA5, SNORA5
4517..4653, 5038..5172
9392
CGCCGAGCGGCGTGGCCCTGGGACGCTGCGGGGGCACATGGAGGTCAGCGGCGGTGCTG
GCGGCCGCGGTGTAGGTCTGATGGCGCGGGGGGGCGGCTGGGCGGCGGTTGTAAGGCCCC
CAAGGGCGCGGGAGGACGCGGGGGAGTTGAGAGTCCCGGGGCGAGGGGAGGCCGGTCCGC
GCGCACGCCCTCGTCCGCCGCCATCCCGCGGGCGCGGGTGCAGGTACTCGGTTTGTACCC
GGAGGCCGAGCCTCGGGGCGCGAGTACGCCGATACCCCGCGTCTCCCAGCGTCCGCTCTT
CTGCGGTTAGGACGGGCGTCTGGCGCGGAGGGAGCCGAGGGAGCCCCGGAGGCCCGGGGC
TGGAGCGCGCCGCCGTGGCGGGAGGAGGCCGTCGGGGCCTGTGCGACCTGCCCGTGGCGT
GCGCGGCCCCGTCCGCGGGGTTTGTGATAGGCCGGGGAAGAGGGCGATGCCCCGGGTCGC
GGCGGGGGGGTAGGGGGGAAGGGTGGGAGGGGAGGAGAGTTCCCGGGGGCCGGGAGGGGG
CGCGGTGATGTGGGAGGGGAGGGGAGGGGTGATGGGGCCTGGAGGGGAGCGCCGTGGTGA
TGTGGGGAGGGGGCGGGGTGATGGGGACCCCCTCCCCGCCCTTGGGAGCCTGCTGCTCGC
CTGGAGCCCCGGCTTCGGGCTGGGCCCCGGGGTCACTGTTGAACCGCTGGCCCAGCCACC
CCCTCGGGTGATGCCAAGCACAGTGCGCGGACTCTCCGCAGCCCAGGCTCTAATGCGGAT
GAGTTCTGGGCCTCGGTCACCTGCGCGGAACCAAAAGCCTGAAAGGTGGTTCTTCAGGAA
ACAGATGTACAGCGCCGGCAGGAAGCAGAGGCTGCGGCCTCTGGAGAGGGGCTGAGCTGC
GGTCCGTGTGTCTTGCTCTGTGTCTGGGAGTCCGCAGCTGTGCCCGCCTCACCTCTTCCT
CTCCTTTGTGTCTTCAGGGCTGTGGAACTGCCGGCTAGGAGTCTCAGCTGCCTGCCCCCC
GGGCCGAGATGGCAGTTCGCCTGGTGAAGCGATGCACCTGCCTCCTGAGGGGGGCCATGC
TCGAGGCCCCTGCCCTGGCTCCGGGCTGCGGACTCCGACTTAGCAGGGTCGCCCCCAGGG
TTCTGACGTCCTCAGCTACCTCGCCCAGTTCCCACTTCCCAGGTCCCTTATCGGGGCTTG
TGGAGAAGGAACGGGCATTCGCCGCCAACTCAGAGCACCAAGATGTGGACCAGCTCATCG
AGAAGGCTACTCGGCCTGAGGAGCTGCTGGAGCTCTTTCGTGGTGGTCACTGCTTGCACG
AGAACCATGCAGCCCTCATCCTCATCCAGCTCTCTCGCCTGCTGGCCAACAAGCCAGAAG
ACAAGAAGGCATTGCTTCTGCAGGATGCCCACTTCCAGCAGCTGCTTCAGCTGGTCAATA
GCCAGGTGGGTTTCTAGAATGTACTCTGAGGGTTCAACGAGCAGGAAAAGGTGGCCCTAG
AGTCCAGAGTAGCCGGTCAGTTTCCAGGTACAGCCAGGAGCTCCACCACCCTGCCAGGTA
AGTCCTCCACATCCTCTAGGTTTTCATTTTGGGGGTTTTTTGGTGTGTTTTTTGTTTAAA
GATTGTATTTATTCATGAGAGACACAGAAAGAAGCAGAGACACAGGCAGAGGGAGAAGCA
GGCTCCATGCAGGAGCCCGATGCAGGACTTGATCCCAGGACCCTGGGGTCACACTCTGAG
CCAAAGGCAGACGCTCAACCCCTGAGCCATCCAGGTGCCTCTAGTTTTTCATTTCGTAGA
GTACAAATACTTTTATGTGTCTTTTTCCTGTTAGTGCTTTATGCAGACGTTTTAGGTGAA
TGAGTATAAACTGTGTTGTTGTTGTTGTTTTAAGATTTTATTTATTTGTTCATGAGGGAC
GTGGGGGCGCGGGGGAGACACGGGCAGACGGAGAAGTAGGCTCCATGCAGGGAACTGGAC
ATGGGACTCGATCCCAGGTCTCCAGAATCACACCCCTGGCCAAAGGCAGCGCCAAACCAC
TGGGCCATCAGGGCTGCCCAGTATAAGCTTTTTTTTCCCAAGCAGCAAACGCCCTTCCCT
GGCGAGGCAGTCCTGACTTGTGTAGCTCCCGTCCAGGGTCTGTATGGCTAACAGTGGGCA
TGCTCCCATGGCTGGAAGGGATACAGGGTATTGGACGGAGGGCGCCAGGCCACTGGGCTG
GGTACAGCCATCATCCAGCTAGTCAGACCCTTACACTGAGGGAACAGGGCAGGGGGAGGG
CCTGAGTAGCACCTACAGGGGAGGAAGCAGAACTCCAGTTGGCTCTTTTGCCAGAGGGGG
GGGTCCACACCACAGGCAGGAGGTCGAACCCCTGCTCTGGCCTTGTCTGCCCACATTCCC
TCCCCAAGTCTATGCTTCTGTCCCTTGCTGAGCAAAAGGGATAGGAGATTCACAGTTCAA
GGGCGGGGTTTCCAGGCTTCCACTGAAAAGCAGGGGGTGTGGCTGGCTGTTTTTTATGAG
ATAGGCTAACTAGGCCAAGGGAGGAAATGCTAGAACGTGTGTGTTAGGGGAAGTATCACG
TCCGGGAGCTGTGTCTCAGTGAAACGTGTGCGTGCACGCTGGAGTCATGACAGAAGGTGG
TCGAGTGCCACTGCCAGTGCCAGTGCTCGTGATCTCATCCTGAGCCCTTCTGGTGGTGAG
GGTGTGGTCCTGACGGTTATTTATTGAGTACCAGGTACACACTAAGGAAGCAAGTATTAG
GAGGTGGATGTGAACAACATGACAAATTGACGAGCCAGGATAAACCAGGAACAAATTATA
ACGAGTTTGGAGATTTAAGCTTCCTTTTAAAAGTTCCCCTGCTATCCAGGAGACGCACAG
ACATAGGCACCAGGTTTCCTGAAACAGACTCAGATTCCAGACTTGTCAGCCTCCGCAGCC
CTTCGCACACCGGCTCCCCTGTTTGCACTCAGCACCAGGTGTGGTTCCAGCTCACATTTG
AAGGGAACAGCTTCACAAGAAGGGGCACCATTAGAGGCTCAGTGCTCCAGACAGCCCCTC
CCCACCGAGTGCCTGTGTCCTGGCTCTCCTGTGGGCCCCCTGCCATATACTGCCTCTGCA
AGGGGCTGGGCTGGAGGGGCCCCATGCATCTCTGAGGCCTGGAAACACACACCCTGCTGG
GAACGGCAGAGTCTTCTTGTCAGAAACAGGTACCAAGGAGGAGGGAGGGAGGTGCCAGCA
TGGCACTGCTGTAGATGGTGGGGCTTTAAGGAAACTGAAGTGGGGTGTGAAGCTCCCCTG
GTGTTGGTGCCTGACACGGCCACGGTGGCAGCCGGTGAACAACCAGCCCCTTGTCCCAGA
CGCCTGGGTTAGGATGGCCAGGACTGTGTTGGACCCAGGCCTCCTTTTGCCCACACATTC
AAGGGCCTCTCACGCCCTGAGGAGCACGGACTGGGTGGGGCAGGGGGGTCCCCCGTGCCT
GGACATGCTGTGCTGGATGCCGGCGTTACTCTCATCAACGTCCATGAGAAACACTTTACC
ACAACTGTGGGACCGCTCCATTGGGGAAAAGGGGCTTAGAATTTGGGCTTCTCAGACTCA
GTGGGGCAGTTGTGTGCTGTAGGAAAGTCAGTGTGTCTGTAACAGCCAGGGAGCGATACG
GTCACCACAAGCAAAGGAACGAGCGGGCTCCTGCAGGCTTGCCTCCCAGTCCTGGACGCA
ATGGCTTGCCTGGGTTCAGGCCTGCATGTGTGAGATGGGCACTCACCAGATGTGCCCGCC
ATGCAGAGCAGCTGTGGCCGAGTCTGTGTGTAACCGGCCTCCTCTGTGGAATTTGCATTG
GAGAAACTCGGGAATTTCGCTTCTCATGCAACCTTCTTGTTTGAAGGTGACCCAGACAGC
TGCCAGAAGCCCCCTCCCCCACCCCAAAGCAGTGGGTGGGCTGTGCTGGGCAGGCAGCTT
CTAGTCCAAACCCCTGACATAAGTCAGGTGGAGTCTTGCGTGTGACTTTTTTGTGTCCTT
CCAACCCAGATAACCTCCGTGTGGCACGGGATCCTCGTGAAGCTGCTCCGGAGCCTCTAT
GCGCTGGCGCTCCCCGGGGCCTGCAAGGAGCTGCAGTCGGTGGAGCAGGAGGTCCGCTGG
CGCCTGCGCAGGCTTAAGTACAGGCACCTGGTCTTCCTGGCGGAGTCTAGTGCCACCTAC
ATGCAGGAGCGGGACTCCCAGGAGCTGCTGGCTGAGCTGCTTGTGCACCTGGAGCGGCGA
TGGGCAGAAATCGAGGATTGCCGCATGGTAGTGTCCATGATGGCCAAGATAGGGCACCTC
TCGGAGCCACTGATGAACCGCCTGGAAGACAAGGTACTGGGGCAGGAGCCCTGGGAAGCT
GCTTGCCACTCCTGGTGGGGAGAGCACAGGGCCCGAACCGTGCCTGGTCTTACTCCACAA
TCACCTTGTGCGCCTAACTGGGGCCGTCAGGTGGCTCAGCTCCAGGCTAGTGCTTGGTGG
TGATGCCTCCCGCACCTTGCAGTCAAGTCAAATTCAGCTCCCATTCCCGTCATAGTGGGT
GCTGGCCCAGATGGCTGCCACAGCAAGCCCTGCAGCTCATGGGCCCTGGGTCCTCTGCAC
TAGGACCTGGGGATAAGTTTGGCTGCAGACAGGGCACCCCAGAACCCAGCGGGGGTCCCT
AGCTGGGAGCAGAGGCAGGGCCCACCCAGCTGGGGCCTGGGGTTACTGAGCTCAGGTCCA
GTCGCTGTCCCACAGGGGCTGCACTGCATGGGACCCCTGGCCTCGGCCGTCGAGCTGACC
CCTGCCGGCTGTGATTGACAGTGCCTGGAGCTGGTGGAGCAGTTTGGCCCCGACGAACTA
CGGAAGGTGCTGTTGACGCTAGCCACTCAGAATCGGCGGTCAGTGCCCTTGCTGCGGGCC
ATCTCTTACCACCTGGTCCAGAAGCCCTTCCCCCTGACGAAAGGCATCCTCCTGGACCTG
GCTTACGCCTATGGTGAGCCCTTCCCACCAGGAGCACTGGGCGAAGGGGCACTATGGCCG
CAGCTATGTCAAATTCGATGCCTGCCTATCCTGTGGCCGGCACTGGTCCAAAAGGCTGCC
ACAGCAACACTGTGACCCATGGGCCCTGATTCCCCGCACTGGGCCTCAGGGATAAATCTG
ATCACAGACACCAACCTCCCAGACCTTGAGGCCATACAGGGGTGGCTGGGTGGCTCCCAG
GCAGCCCGCTGACCCTCACTGGGTGAACCCTGGGGTCACTGTGTCCCGAAGGCAAACTCG
GCTTCCAGCAGACCCAGGTGTTCCAGCGCCTTGCATCTGACCTGCTGCCCCGTGCTCCCA
GCCTGACATCCAGCGAGGTGGCCCGCTGCACCAAGTCCTTCGCCCTCCTCAAGTGGGTCA
ACGGGCCCCTGTTTGAGGCCTTCGTCCAGGTGAGCTGGGCAGCGCCCTGCGTCTTCTATC
AGGCGCAGCAGGCCAGACACACTGCCAGACTGCAAAGGGGGGTGGCTAGAGAGGGGGGTC
CCCATCCGAGGGTGATTGGGGGAGGAGCCATCTCAGGTGGTGCAGATGACATGGGTGAGG
GTGGTCTCCGGCCTCAGGTGACTGTAGCAGGGACTGTTGTGGACAGCGAAGCTCCGAATT
TGCTCTCTGCTCCTGAAGCAGCAAGGAAAGATGCTCACGTTTGCGTGCAACCACTTGAGG
CTATGCGGACTGGCTGCAGCATTTCCAGAGTCTCCACCTCTGGGGGAAGGTCTAGATGAC
CTAGGTGGCTGGGAGCCCTGTGGGAGGGCCCGTTGTGTCTTACGTTTCCCTCTGCTGTGT
GGCCGGTCTAGCACATCCTAGACAGAGCCCAGACTATCACTGGGCTACACCTGTGCAACA
TGCTCCTGGCCTTCGCGCATCTGAACTTCCACCCGGAACAAGAGGACCAGTTCTTCTGCT
TGGTACAGTCTGTGTACCCCTGCTCCCCCATCCTCTTCCTGTGCCTGCCGGACCCCCGGG
GGGAGCTCCAGACTGGACTTGTGCATGGGAGCCCTAGGTATAGAGGCAGAAAGGAAGACC
CAGCGTGGGGGCCATGGGGACGCCAAGAGGGCCATGGGAGCCAGCTGGAGCCACACGGGA
CATGCGTTGTCTGGGGTCTAAGACCTGAAATCCCCACATGTGCACTGTGTGGCCCAGAGC
AGCTGCAGGTCAAGGACCATCAGCCTGCTCAGTCACCACGTGGTCAGGGCTGGGTCTCCC
TGGTGCTCCCTCAACTCCCTGCTGATGCTGTGAGACTTGCCAGCAGGCACAGGTGTGCAG
GTCACTGCAGAGTGCCCCTGCGCAGGGGTGAGACTGCCTGTGTGTCTACCGGCCTCAACC
CTAGGTCTGCTGGCTGTGGTCCCTTACCAGTGGGAGGGGCAGTGGGAAAGTCTAGCTGAA
GGTCGTGCTGCCCAGGTTGCTCCTGGGTGACAAGGAGGGTTTCTGGAGCTTTCTACGAGG
GGATGCGCCAAGCCTGAGCAGAGCAACTGCAGGCTCACTCCCCAGAGCTGCTTTGGGCCT
TGGTGCGGCCAAGTCCTTCGGGAGCCCTGAGCATGGCTGGCCCTGGGATGTGTGCTGCCG
CTGAGGGAGACCCCCATCCGTCCACCTCGCCCTGTCCTCACCCAGGTCCGTGAGAAGCTG
GGCTCAATGCTGTCGGGCCTGCCCCCAGCCCTGCAGGTGGACGTGGTGTGGGCTCTGTGC
GTGCTGCAGCAGGTGCAAGAGGCAGAGCTGCGGGCTGTGCTGTGCCCTGAGCTGCATACC
CAGTTCCTAGGTGAGTGGTGTGTGGCATCTCCTCTTACCCTGAGGGATGCGGAGCCCTTC
CCGCTGTAGCTCCAGCTGGTTGGCTGCCTGGTCCTGCATGTGTCCAGCACCTCCAGCGGG
GCTGGGCAGGGGAGAGGGGACATCCCAAGCCCACCTGGCACTCACTGCTCCCCCGCCCCC
TCCCCGAGGGTGGCCCACACACCCTCTTCTACCTGTGATGACATGTATTTCATGGTGCAG
CTTGGGGGCAGAGCGTGCTGGTCCTCAGTTCACCCGCTCTTCTCGTTGTGTCCTCTTCCT
TAGGGGGCGGGTCCCCAAAACATCAGAGCACCTTTCAGAAGCTGCTGCACATCAACGCTA
CTGCCCAGCTGGAGTATCCCGAGTACACGGGCCCCCTCCTTCCGGCCTCTGCTGTGGTCC
CCAGGCTCTCAGCCTTAGACAGGAAGGTGACCCCTTTGCAGAAGGAGCTGCAGGACACAC
TGAGGGGGCTGCTGGGGAGCAAGGGCAGCTTCATGGTGCCCACGCAGTACGGCTGGGTCC
TGGGTGAGGCCCTCCCCATACTCCCACCACAGCGGCCGCGGGACTGCTCCTAGTTCTGCC
CCCTGCTCCCCCGAGGACAGTGCCCAACATGTGCCCCACACCTATCCCTAGACGCTGAGG
TAGTGTTGGACCCAGATAGCCAGTTCCTGCCCCCGAGGGACTTCGTGGCCCCCCATCTTG
CCCCACCCTCCGGGAGCCAGCCGTTGCCTCCTGGAGCCAAGAGGTAGGCAGGCCTGCAGC
TTTTCTGGGCTCCCCACTCCTCCCAAGGGCCCAGGAGCCCCTGAAGCTGAAGCCCTGCGC
CTCTCCCCCCACCAGGCTGGCCTTCCTACGCTGGGAGTTCCCCAACTACAGCAGCCGGAG
CCGAGACTTGCTGGGGCGCTTCGTGCTGGCCCGGCGCCATGTGCTGGCCGCTGGCTTCCT
GGTGGTGGATGTGAGTACTGTTGGGCAGGCAGTGACCACATGGCCCCCCAGCTCCTGAGG
GTGTCCCTATGAGGGTTCCCCCTTCACGCAGGAGAAAGGGCAGCTTCAAAGATCCTATTT
TCCCCAAGGCCGTGGCTTCTGTTACCCGCTCTAGGCCTTGTGCACCAGATCTGCACGTCC
ACGTCAGCCGGTGCTAGAGCTGGGTGCTGCCCAGGACACTGCGCTCCTTCTTGCTCCCAT
CGGAGAGCAGACTGTCCTATATGGGCCACAGGACACAGGAGTGGCCTTAGAGGCCACATG
ATGGTTTTGTCATGCATCTCAGGGTGGTTTTTTGGTTTTGTTTTTAACAATGTTTAAAAA
TTTAAAAGTTGCTCTCAGATGCCACAGGCTCTTGGATCCCAGGCTTAGAGGTCAGGCTCC
TGTAGCTCTGAGCCCTGCGGAAACCAGGATCTCTTCCCTGAACACGGTGCCACAGCTCCG
TGGGCTTGGGAGGCCTGGGGTGTGGGCGCAGAACAGCAGACAGAGCAGGGGTCCCCACAC
CCTCCCCACAGGTCCCGTACTACGAGTGGCTGGAACTCAAGTCTGAGTGGCAGAAAGGCG
CCTACCTGAAGGACAAGATAAGAAAAGCAGTGGCGGAGGAGCTGGCCAAGTGACCTGTCC
TGAGCCGTGAACTGCGTTTCCCCAGGGTGGGGCCAGGTTCCCCCAGAGGCCTGGCCATGG
CCACTCATGGACACACGTCCCTGTGGGGCTTGCCCAGAGAGGAGTGCTGGCCGGCAGCTC
TTGCCTCTTGTGGGCAATAAACCTAGAATTTCAGTTTTCAACACCAGAAGGCATCTTGGC
CTTTGTCACCGTCACCACCATCCACCCTGCTTTCCAGGCGGTCCGTCTGTCCTAGCTTCT
GCCTCCACGGGGGCCCTTGTCCTGTACATGCACACACAGCCACCTGCCTCCTGCTCACAC
TGCGCAGATTTGGTCCTAGAGTTCCAGCTTTGGAGCCATGAGGACCTTCCTGGGGTAGGC
CCATTGGGGTTTGAGCACATGAGTACATGGCTTGGGGCTCTCATCATGGTTTGGTACCCA
GCACAGTTGTCCTAGAAGTTCTCTTGTGCATGGTCTCGAGTGAGTGGGGGGAAGCCAGAG
ACCCAAGCTGACCAGGAGGCAGTGGCTCTGGAGCAGAAGGCAAGTGTACTCATCTGTTAC
AGCAGGGTTGGAGTCCCCTCCTTGCCGTCTCATCCCAGCCAGGGGGCCCTGGTGTTGTGT
GCCCTAAGCCTCCTGTCCTGGCCTGGCAGTAGTCCCACTAGACACTGGAAAGAACAGTCT
GCTTCCCTCCTGGTCCCTTGCCAGAAATTTCATTGGTAGAATAGACAAGAGTGATTACTG
GGCACTGCCATTTGCCCCCAGCAGCTCAGAAGAGTGCAAAGGCAGCCAGGGAGAAGGGCC
CCTCAACCCCAGGTCCCCATCCCAGCGGTGCCACAAGCCTCCAGAGGGTCTCAGGAAGAG
CTAGTTCATCTCTTGAAACCTCGCGGGCCTGGGGGTGGATGGGGAGCCATTGGACCCTTG
TTTGCACAGGCTGGTGGCTGTCCCTCACCAGGTGGGAGGGGGCAGCCAAGGTGGCCTAGG
CAAGATGGGGGCAGGAGGGCCTGCCACAGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1444, 4029..4352, 4821..4992, 5271..5428, 5831..5941, 6645..6789, 7083..7357, 7373..7396, 7481..7542, 7635..7749, 8291..8392
1001..1444, 4029..4352, 4821..4992, 5271..5428, 5831..5941, 6645..6789, 7083..7357, 7373..7396, 7481..7542, 7635..7749, 8291..8389
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved