Canis_familiaris Locus Mono:122:SNORA72
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:122:SNORA72
Canis_familiaris
Mono:122:SNORA72
2
SNORA72
1001..1133
2133
GCATCCCCCGTCCAGGGCAGCTACCCACCTCAGGGCTCCAGCCCCCATCCTGCCAAGTT
GAGGCTTTGCCTTCCTCCCCTCATCCCTCCCCTTCAGGGTGCTCGCCATGGGCCTGCATG
CCAGGTTGGCACCCACGAACCCCCTCAGACTCCTGCAAAGACCCGAGGGCAGGATGTCAC
ACCCAGGCTGCCAGGAGCTGGGTTCACTGGGGGAGGCGGGGTGATCCCTGGCTGGTGTTA
ACGAGGCCCGGGACAGATGGATAAGCCGAGAGGGCCAGGCGCCAGCTAGGAGCAGACACG
TCATGCCCTCAAGTCTGCGGCTGAGTGGGCACCCCAGCCCCGCGAGGCCAAGCTGGTGAC
CCTCACCACCGAGTGAGTGAAGACCGGAGAGGCCGACTGGCTCCCCAGAGGCCATGGGAC
ATGTGCGGGGCTGAGCAGATGTTAGATCACAGAGCCTGTTCCCTTGGGCCAGACTCAGTA
AACATCCTCTTCTACCCTGACACTGCTTTCCAGTCTTGCTCAAAGCGCCTGTGTTTGACA
CCAACCAACTGGCCGTTTCTGTCCATTTCCATGGCCACCACCGCATCCCATGCCACTGTC
ATGACTCACCCGGACGCTGCGGTCACCTTCGCCCTCAGTCCCCCACTTCCAGTGTTGCTC
TCCTGAAATGCATGCCCCACCCTGCACCTGGGTGATCTGCCTGCAGTGCAGAAACAACCA
TGACCCCCCGCCCCCAAAAAAAGTCCAGAAGCCTTCAGTGCCCTCAGGTGGAAAGGCCAG
CTCCCCGCCACGAGCCGAGTCCTCTCCTCCTGCCACTTCCTTCCCCCTTGCTCACCTACT
GCGGCCACACCGATCCCCGCTGCCTCCAACGCCCCGGGCTGATGTCCACCTCGGCCCCCA
CCCAGGCTGTCCCTGCTGCCTGGAAATCTCTGCTCCTCTTCCTCCTCTCTTTGTCCAATT
CGCTGGTTCTCAAACTATGGTCCCTGGACCAGCAACATCAGCAGCAGCAGGAGCACCTGG
GAACTTGTTAGAAACACAGTTTCCAGACTAAATGTTCGCTATGTTAAGACCGTGCGTGTG
TCGCCGGTTCTCGTTCCCTCCCTAGGCCGGGTTTTATAAATGCTAGTGATACACCAACTC
TGACTTATATCGAGCTTCTTCTGTGGGAAGTTGTCTATGATTCCAGGTATCCGATCACCC
TCGAGAAATGATAGCACGTTTGGGGTCATAACTTTTGAAGGTAACCGTTGTTAATTTGCC
ATCAAATGAGTTACAAAACCGAGAAAAGAAAGGAATGCGGTTTCATTCCATAATGTGGAT
ATATAGCAAGTCATCATGCTGGACACTTTAAATATATATAATTATATTTGTCGATTGTTC
CTCTGCAAATCTAGGGGAGAAAAAGAAATGTAAACCACGTGTCTCAGGCTCCGCCCCAGA
GCAGCGAGTCAGAGACAGGATGGTCCCACAACCTGTATTTTACGAGGCCCTTAAGGTAAT
GCTGATGCACGCTCCAAATCTAAGATCCACTGGTCTAGCTAATTCTTGCTGTCCTTCAGA
GTCCAGGGTTAGACCTCAGCTCCAGTGCCACCTCCTCCAGGAAGCCCTCCTTGACCTGCA
GGCCAGGGCTTCAAGGCACTCCCTGCTTCTATAGTAGAGCCATTCTCACAGCCAAAGCCG
CATTGTCATCCGCTGTGTAGTCCACTGAACGTCTCTCTCTTCCCCTAGAACACGTGCTCC
GTGGGCCCGGGGAGCCGGTTCTCTTGGGCCTGGCACATAGTAAGTGCTCCGTCAGTAGGT
GTTGAGGGCGTGAGTGACCACATGAGCAAGCCCTGCTCTCCCCGCCCTTCCTTCAGCCAA
TGCTTGTACTCGCCCTGGGCCTGGACTGGGCCGGAGGCTGAAAGAGAAAAAAGAGACAAC
CCCCACCTTCTGGGATCCAACAGCCACAAGGGGAAAAAAAACACGGATGGAGACAAGTGG
ATTGAGCTGGGTCTTTTATGAGGGCTGGTCGCTGCCCGGTAGAGAAGTCAGGGGAAAGGA
CAGAGGGAACCACCTGTGCAGAGTGTACAGTGAGCTGGAGCAGCGTCGGGGGGGATGAGG
CTGGAGGGTGAAGCTGAGGCCCAGTGGCTGAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved