Canis_familiaris Locus Mono:169:SNORA70
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:169:SNORA70
Canis_familiaris
Mono:169:SNORA70
1
SNORA70
1001..1118
2118
TGTTGTAAGTTTCTCACATTGTCCAAAAAATGGTAAAAAGTACTAATTTAAGATAGAAC
CCTGATAAGCCAAGGCTGTATATTGTAGTATCTAGGAAATCCACCAAAAGAATAACAAAA
GACTATAACTAAAATATAACAGAAGACAGTAAAATAATAACAGTAATAATAATAAATACT
TCATTAGTATAAAAGAAATCCAGAAGAGAATACACAGAATAGGTGGGGGAAAATGGAAAA
CAAACAGTAAAATGATAGATTAAAACAAATATATTAGTACTACATTAAAACTAAATGGAA
CATTGTCAGAATTGCCCCAAGACCTATGCTTTTCTATACATGTAAATTTACCTGAAATTT
GGAAATATTAAAAAATCATAACAATATAAAGTGGGGGTGAGAGTGGAGGTATAAATGTCA
TGAGAATGGCTGGATATTAGCCAGTGTTAAAGCAAGGTGTTGGATAGATGGAACTTCATT
ATGCTCAGTTTGTATATGTTTGAGATTTTTCAAAATATCAAGATTTATTTTAAGTAACCA
GATCTAAATACTCCAAATAAAGGGCAAAAACTTTCTGATCTACAACTTCATGTAACAGTG
TGACTGAAACTTACAAAATACTGAGCAAAAAGCTTGCTTGGGTGGCTCAGTGGGTTGAGC
ACCCAGCTCTTGGTTTCAGCTCAGGTCATGATCTCAGAATCCTGGAATCCAGTACCAGAT
CAGGCTCCCTGCTCAGCTGGGGGAGCCCTCTTCTCCCTCTCCCTGTATCCCTCCACTCAT
TTGTGCTCTCTCTCTCTCTCTTTCTCTCTCTATTTCTCTCTCTCTGAAATAGAATATTTT
TAAAAAATAACAAAAGTGGGGATGCCTGGGTGGCTCAGTGGTTGAGCCTCTGCCTTTGGC
TCAGGTCCTGATCCTGGAATGCGGGATCAAGTCCTGCATCGGGCTCCTTGTGGGGAGCCT
GCTTCTCCCTCTGCCTATTTCTCTGCCTCTCTCTGTGTCTCTTATGAATAAATAAAATGT
TTTTTAAAAATAACAAAAGTTCTGCAAACAGTAGCCTCCTTGGTAGTGTATGCAGCCTGT
TGATTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCCCTTTGTGGTCGACTTTGAGGT
CTGACATAATGCTATCTCCAATCTAGGCTGCAGACAGGTATGCGAGGTGCCTGTGGGAAG
CCCCAGGGCACAGTAGCCAGAGTCCACATTGGCCAAGTCATCATGTCCATCCGTACCAAG
CTGCAGAACAAGGAGCATGTGATTGAGGCCCTACGCAGGGCCAAGTTCAAGTTCCCTGGC
CGCCAGAAGATCCACATCTCCAAGAAGTGGGGCTTTACTAAGTTTAATGCGGACGAATTT
GAAGATATGGTGGCCGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAATACATCCCT
AATCGTGGCCCCTTGGACAAATGGAGGGCTCTCCACTCATGAGAACCTTGCACCACCCGA
ACCCTATTCATGCCCACCAATAAATCCTGCTTCCTGTCTAAAAAAAAAAAAAAAAAAAAG
TTATAAGGTCAAATATTAGCAGTACACACACACACACACACACACACACACACACACACA
AGAAACTATGTGCTGTTACAAGAGCCACACCTCAACTATAAGGACACAGAAAGATGGAAA
GTTCCAGGGTGGAAAAATATATACCCTGTATACAATAAAAATAATGCTGGAGTAGCTACT
TTGTACATCAAAGTCATCATTAAGGCAAAAAACATTGCTAAAAGTAAACAGGGACATTTT
ATAGGGGAGTCAATTCACCAGGAAGATATATTCCGATTTATACACAGAGAGAAGAAACTG
AAAGGAGTGATTAGAATTGGGGTTTACAGGGGCACCTGGGTGGCCCAGTGATTGAGCATC
TGCCTTTGGTTTGGGTCATGATCCCAGGGTCCTGGAATCTCCTGGAATCAAGTACTGCAT
CAGGCTCCCTGCAGGGATCAGGTTTCTCCCCCTGCCTAAGTCTCTGCCTCTCTCTGTGTG
TCTCTCTTGAATAAGTAAATAAAATATTTAAAAAAAAAAAAAGGAATTGGGGGTTTATAC
AGCAGCTTTTTAAAAGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved